A SNP molecular marker associated with plant height and first fruit branch height of upland cotton and its application

Abstract

The present invention provides a SNP molecular marker associated with plant height and first fruit branch height of upland cotton and its application, and relates to the technical field of molecular marker-assisted breeding. The SNP molecular marker is located at the 21043956th base of chromosome A05 of the upland cotton genome, wherein the nucleotide type of the 21043956th base of chromosome A05 of the upland cotton genome is C or T. In germplasm with high plant height and first fruit branch height, the nucleotide type of the SNP molecular marker is C, and in germplasm with short plant height and first fruit branch height, the nucleotide type of the SNP molecular marker is T. Experiments show that the molecular marker is highly linked to the plant height and first fruit branch height traits, and can effectively distinguish extreme materials of plant height and first fruit branch traits in a population. It is developed into a molecular marker that can simultaneously select plant height and first fruit branch height traits of breeding materials, and can be conveniently and quickly applied to improving cotton plant height and first fruit branch height, and cultivating early-maturing cotton breeding.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular marker-assisted breeding, and in particular to a SNP molecular marker associated with plant height and first fruit branch height of upland cotton and an application thereof. Background Art

[0002] Cotton is an important source of textile fiber in the world, and upland cotton is the main cultivated variety, accounting for about 90% of the world's cotton production. With the tilt of policies, the contradiction between grain and cotton land preparation has become increasingly prominent. How to ensure the stability of production on the shrinking land area has become a major problem. Early-maturing cotton is a variety with a shorter growth and development period among upland cotton. The growth period is shorter than 110 days, which is 20-30 days shorter than late-maturing varieties. Due to its short growth cycle, it can increase land utilization rate, such as sowing soybeans and potatoes after cotton harvest, making full use of the remaining growing season, which helps to resolve the contradiction between grain and cotton land preparation. In addition, due to the short frost-free period in northern regions such as Xinjiang, early-maturing varieties shorten the cotton harvest cycle and prevent the reduction in production due to low temperature weather in the late growth period. The characteristics of early-maturing cotton plant type are short and compact, which is also conducive to increasing planting density and increasing yield per unit area. Cotton precocity is a comprehensive trait, composed of multiple indicators, including plant height, the first node of the first fruit branch, the height of the first fruit branch, and the horizontal and vertical spacing of flowering. The height of the first fruit branch and plant height of cotton are significantly positively correlated with the cotton growth period. Therefore, reducing the height of the cotton plant and the height of the first fruit branch has become an effective way to cultivate early-maturing varieties. Cotton varieties with short and compact plant types are more suitable for large-scale mechanized operations.

[0003] Traditional breeding methods, such as selective breeding and hybrid breeding, rely on natural variation and artificial selection. Although this method has played an important role in crop improvement in history, it also has some obvious disadvantages. First, the traditional breeding cycle is long, and it often takes many years from parent selection to the cultivation of new varieties. Secondly, it is limited by the existing gene pool and it is difficult to introduce new genetic variation, which limits the potential and speed of improvement. In addition, traditional breeding is often difficult to control precisely because the complexity of genetic effects and the interference of environmental factors lead to uncertainty in breeding results.

[0004] In contrast, Molecular Assisted Breeding (MAB) utilizes molecular markers, such as SNP (single nucleotide polymorphism) markers, which refer to variations at a single nucleotide position in the genome. SNPs are the most common form of genetic variation and are widely distributed in the genome, and can occur in gene coding regions (exons) or non-coding regions (introns, promoters, etc.). By locating SNP markers that are closely linked to the target trait, variety improvement can be performed more accurately and quickly. This approach can shorten the breeding cycle and improve breeding efficiency because it allows the screening of offspring with desired traits at an early stage. In addition, molecular-assisted breeding is not limited by geographic and reproductive isolation and can introduce a wider range of genetic variation. Summary of the invention

[0005] In view of the problems existing in the traditional breeding process, the present invention provides a SNP variation located in the upstream regulatory region of the Ghi_A05G10671 gene of upland cotton, which is extremely correlated with the phenotypic values ​​of cotton plant height and first fruit branch height under multiple environments. The phenotypic values ​​of cotton plant height and first fruit branch height corresponding to different genotypes are significantly different, and can be developed as a molecular marker for rapid, accurate and reliable breeding of cotton germplasm with low plant height and low first fruit branch height. Since the SNP variation is double-linked with plant height and first fruit branch height, and both are significantly different, it is helpful to simultaneously breed short and compact excellent varieties with low plant height and low first fruit branch height traits. This study provides the SNP variation, primers for detecting the variation, and the names of 387 germplasm resource materials used for detection and their plant height and first fruit branch height phenotypes. It has a positive effect on molecular assisted breeding of cotton plant height and first fruit branch height.

[0006] To achieve the above object, the present invention specifically adopts the following technical solutions:

[0007] The first aspect of the present invention provides a SNP molecular marker associated with the plant height and the first fruit branch height of upland cotton, wherein the SNP molecular marker is located at the 21043956th base of chromosome A05 of the upland cotton genome, wherein in germplasm with high plant height and first fruit branch height, the nucleotide type of the SNP molecular marker is C, and in germplasm with short plant height and first fruit branch height, the nucleotide type of the SNP molecular marker is T, and the reference genome is Gossypium hirsutum (AD1) 'TM-1' genome WHU_v1.

[0008] As a further illustration of the present invention, the SNP molecular marker is located in the upstream regulatory region of the gene Ghi_A05G10671.

[0009] As a further illustration of the present invention, the nucleotide sequence of the gene Ghi_A05G10671 is shown in SEQ ID NO.1.

[0010] The second aspect of the present invention provides a detection primer for detecting the above-mentioned SNP molecular marker, wherein the detection primer comprises two upstream primers and one downstream primer, wherein the nucleotide sequences of the two upstream primers are respectively shown as SEQ ID NO.3 and SEQ ID NO.4; the nucleotide sequence of the downstream primer is shown as SEQ ID NO.5.

[0011] A third aspect of the present invention provides a kit for detecting plant height and first fruit branch height of upland cotton, the kit comprising the above-mentioned detection primers and PCR amplification reagents.

[0012] The fourth aspect of the present invention provides the use of the above-mentioned SNP molecular marker or the above-mentioned detection primer or the above-mentioned kit in the detection of plant height and first fruit branch height of upland cotton.

[0013] A fifth aspect of the present invention provides a method for detecting plant height and first fruit branch height of upland cotton, comprising the following steps:

[0014] Step 1: Extract DNA from the upland cotton sample to be tested;

[0015] Step 2: using the above detection primers to perform PCR amplification based on KASP technology on the DNA of the upland cotton sample to be tested, to obtain a PCR amplification product;

[0016] Step 3: Perform fluorescence detection and analysis on the PCR amplification product. When FAM fluorescence is generated, it indicates that the genotype of the upland cotton sample at the above-mentioned SNP molecular marker is CC. When HEX fluorescence is generated, it indicates that the genotype of the upland cotton sample at the above-mentioned SNP molecular marker is TT. Among them, the CC genotype upland cotton is a cotton with high plant height and first fruit branch height, and the TT genotype upland cotton is a cotton with low plant height and first fruit branch height.

[0017] Compared with the prior art, the present invention has the following beneficial technical effects:

[0018] The SNP molecular marker associated with plant height and first fruit branch height of upland cotton provided by the present invention can be used for early prediction and screening of cotton plant height and first fruit branch height traits, and based on the fact that the SNP is significantly correlated with cotton plant height and first fruit branch height at the same time, it can also be used for molecular marker-assisted selection breeding of cotton plant height and first fruit branch height, and improve plant height and first fruit branch height traits at the same time. It is directly expressed in the form of DNA, can be detected in all tissues and development stages of cotton, and is not limited by environmental factors, which can greatly accelerate the breeding process, improve the accuracy of selection in breeding and the efficiency of cotton drought-resistant germplasm innovation.

[0019] Other features and advantages of the technical solution will be described in the subsequent description, and partly become apparent from the description, or understood by implementing the technical solution. The purpose and other advantages of the technical solution can be achieved and obtained through the structures specifically pointed out in the written description and the drawings.

[0020] The technical solution of the present technical solution is further described in detail below through the accompanying drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] The accompanying drawings are used to provide a further understanding of the technical solution and constitute a part of the specification. Together with the embodiments of the technical solution, they are used to explain the technical solution and do not constitute a limitation of the technical solution. In the accompanying drawings:

[0022] Figure 1 This is the structure diagram of gene Ghi_A05G10671 and SNP: A05:21043956.

[0023] Figure 2 This is the KASP genotype diagram of 387 materials. Red represents CC homozygotes (308 copies), blue represents TT homozygotes (79 copies), and black represents water (control).

[0024] Figure 3 This is a box plot of the correlation between 387 materials and plant height and first fruit branch height. The year is represented as: 2022 Anyang: 22_AY, 2023 Xinjiang: 23_XJ, 2023 Anyang: 23_AY, the best linear unbiased prediction (BLUE) value of the three environments: BLUE, plant height is represented as: ZG, and the height of the first fruit branch is represented as: GZG.

[0025] Figure 4 The phenotypes of plant height and first fruit branch height are shown for the five selected materials: Zhongmian 113 (genotype CC), Zhongmian 50 (genotype CC), Han 686 (genotype CC), Zhongmian 49 (genotype TT), and Xinluzao 49 (genotype TT). Red fonts represent the height of the first fruit branch, and white fonts represent plant height. DETAILED DESCRIPTION

[0026] The preferred embodiments of the present technical solution are described below in conjunction with the accompanying drawings. It should be understood that the preferred embodiments described herein are only used to illustrate and explain the present technical solution, and are not used to limit the present technical solution.

[0027] 1. Acquisition of SNP molecular marker loci associated with plant height and first fruit branch height of upland cotton:

[0028] 1. Material selection

[0029] The present invention uses 387 core germplasms of upland cotton for phenotypic investigation and genotyping. The materials are provided by the National Cotton Germplasm Resources Medium-term Bank of the Cotton Research Institute of the Chinese Academy of Agricultural Sciences. These materials mainly come from foreign countries and the Yangtze River, Yellow River, Liaohe River basins, etc. in China. They have a wide range of sources and a long time span, which is conducive to analyzing the genetic diversity of cotton germplasm resources from the whole genome level.

[0030] The plant height and first fruit branch height survey experiment of 387 materials was conducted in three locations for two years, including Anyang, Henan (22SY) in 2022, Bozhou, Xinjiang (23BZ) in 2023, and Anyang, Henan (23AY) in 2023. Three replicates were set in each location, for a total of three environments in three locations for two years. The material planting adopted a completely randomized block design and strictly followed the local planting management methods.

[0031] The plant height and the height of the first fruit branch of 387 materials were measured in various environments. In order to eliminate the edge row effect, 5 well-grown plants from the second to the sixth in each row were selected for investigation. The measurement standards were: plant height: the distance from the cotyledon node to the top growth point (cm), the first fruit branch height: the distance from the cotyledon node to the first fruiting branch (cm), and the average value was taken as the phenotypic value of the material in the repetition after removing the extreme outliers between rows (year + environment + trait + repetition). For environments with multiple repetitions, the average value between repetitions was taken as the phenotypic value of the material in the environment (year + environment + trait + mean). The statistical analysis of the phenotypic values ​​was based on R processing: the built-in function cor in R was used to calculate the correlation of the phenotypic values ​​of the traits, and the R package Hmisc was used to calculate the correlation coefficient and significance level between the variables. The visualization of the results was generated using the chart.Correlation function in the PerformanceAnalytics package. To assess the contribution of genetic factors to the observed phenotypic variation, we used generalized linear mixed models (GLMM) to estimate broad-sense heritability and calculated the best linear unbiased prediction (BLUE) value. The analysis was performed based on the lme4 (Bates et al., 2015) and emmeans packages (Lenth, 2020) in the R language environment.

[0032] 2. Sequencing and genotyping

[0033] In this study, an extended locus set A1 for cotton variety rights confirmation was screened out based on the CottonSNP63K chip, with a total of 3948 loci; an extended locus set A2 for cotton variety rights confirmation was screened out from the CottonSNP80K, with a total of 4857 loci; and an extended locus set A3 for cotton variety rights confirmation was screened out by collecting and sorting trait-associated loci from reported GWAS (Genome-wide association study) data, with a total of 281 loci. After 10× resequencing verification of 76 core germplasms of upland cotton, the three extended loci sets A1, A2, and A3 from different sources were integrated, and the duplicate loci were deleted, and finally a set of SNP variant loci suitable for cotton variety rights confirmation was obtained, with a total of 8753. The loci were designed using a fixed-point sequencing kit, and 8347 were successfully designed. The 8347 SNP loci covered a total of 1,934,654,758bp of the genome, with an average label density of 1 variation detected every 231,778 base pairs. After filtering with MAF>0.05 and missing rate<0.2, 7779 core SNPs remained.

[0034] 3. GWAS Analysis

[0035] The repeated phenotypic values, average values ​​between repeats, and BLUE values ​​of 387 materials in various environments were used as independent analysis objects, and GWAS (genome-wide association) analysis was performed in combination with 7779 SNP data. Three analysis software were used: GAPIT, rMVP, and gemma. The model used was MLM (Mixed Linear Model), and the threshold line was set to 1 / number of markers. To ensure the stability of the model and SNP sites, the GWAS results were screened, and stable SNPs that could be detected in at least two software and at least two environments were selected.

[0036] SNP A05:21043956 was identified in both plant height and first fruit branch height, and was located in more than two software and more than two environments. The SNP is located in the upstream regulatory region of the Ghi_A05G10671 gene. The full-length sequence of the Ghi_A05G10671 gene is shown in SEQ ID NO. 1, and the sequence table of the upstream 2000bp sequence of the Ghi_A05G10671 gene is shown in SEQ ID NO. 2. The structure of the gene Ghi_A05G10671 is shown in Figure 1 As shown, it is located at the 21043956th base on chromosome A05, which is a diallelic SNP. The structure of SNP: A05: 21043956 is shown in Figure 1 As shown, the reference genome base is C and the variant base is T. This SNP is significantly correlated with plant height and the height of the first fruit branch in multiple environments, is not affected by the environment, and is relatively reliable.

[0037] 2. Genotyping of 387 materials based on competitive allele-specific polymerase chain reaction (KASP) technology:

[0038] 1. Extract the sequence of 100bp upstream and downstream of the 21043956th base of chromosome A05 (excluding the SNP),

[0039] And organized into the following format:>A05:21043956

[0040] CACAACTCTTAAAAGTCTCACCTTTCAAACCCTATGATTGCGCCATTAGAATTAAACAAGACAAGCATACATACCATCACGGAAAGCTATATTTAGTTTG[C / T]GCATATTGTTTCTGTTTTTGTGCACTATTCTCTGTGTTTGGCAATTATTTCCTTGCTTGGACCAGCCATACACATTACAAAATCTAGGCAAGGTTTCAGA, where [C / T] is the reference and variant bases. SNPWay Submit and design primers, including two forward primers (upstream primers), whose 3' end is the base C or T of SNP A05:21043956, and one universal reverse primer (downstream primer): the nucleotide sequence of forward primer 1 is shown in SEQ ID NO.3, the nucleotide sequence of forward primer 2 is shown in SEQ ID NO.4, and the nucleotide sequence of the universal reverse primer is shown in SEQ ID NO.5.

[0041] 2. The KASP typing of 387 materials was performed using the primer combination, including the following steps:

[0042] 1) Extract DNA from 387 samples of upland cotton to be tested.

[0043] 2) Add 2X Master Mix for ASPCR V1 and specific KASP primers (the above-mentioned forward primer and universal reverse primer) to the DNA template extracted in step 1) for PCR amplification. The resulting amplification product is 91 bp in size and has a nucleotide sequence of: TCACGGAAAGCTATATTTAGTTTG[C / T]GCATATTGTTTCTGTTTTTGTGCACTATTCTCTGTGTTTGGCAATTATTTCCTTGCTTGGACCAGC, wherein [C / T] is a variant base.

[0044] 3) Analyze the PCR products using a fluorescence detector.

[0045] The above 2X Master Mix for ASPCR V1 contains the following components: FAM fluorescent probe, HEX fluorescent probe, ROX internal reference dye, Taq DNA polymerase, dNTP and MgC12.

[0046] The above PCR reaction system is shown in Table 1 below:

[0047] Table 1 PCR reaction system

[0048]

[0049] The water bath PCR reaction conditions were: 95°C for 10 min: 95°C for 20 s, 61-55°C for 40 s (0.6°C reduction per cycle), 10 cycles: 95°C for 20 s, 55°C for 40 s, 30 cycles.

[0050] Among them, the material with C at the 21043956th base of chromosome A05 can bind to and extend with upstream primer 1, and the FAM group in the PCR system is separated from the quenching group, and combined with the FAM tag sequence of the DNA amplification fragment to produce FAM fluorescence (red light), thereby being detected, indicating that the genotype of the material at the 21043956th base of A05 is CC. Similarly, the material with T at the 21043956th base of chromosome A05 can bind to and extend with upstream primer 2, and the HEX group in the PCR system is separated from the quenching group, and combined with the HEX tag sequence of the DNA amplification fragment to produce HEX fluorescence (blue), thereby being detected, indicating that the genotype of the material at the 21043956th base of chromosome A05 is TT. If green light formed by a mixture of red and blue is detected, it means that the genotype of the material at this site is CT. The results are as follows: Figure 2 As shown, after using KASP to detect the typing of 387 materials at the 21043956th base of chromosome A05, the genotype of 308 materials was CC, and the genotype of 79 materials was TT (as shown in the 44 materials in Table 2). By comparing with the typing results of the SNP: A05:21043956 in the population in the resequencing data of the 387 materials, the KASP typing results were consistent with the resequencing typing results, which proved the reliability of the typing.

[0051] Table 2 Typing of 387 materials (only 44 are shown) at SNP A05:21043956

[0052]

[0053] 3. Correlation test between genotypes of 387 materials and cotton plant height and first fruit branch height phenotypes

[0054] The plant height and first fruit branch height investigation experiment of 387 materials in the present invention was conducted in three locations, Bortala Prefecture, Xinjiang and Anyang, Henan for two years, with a total of two years, three locations and three environments: Anyang, Henan in 2022, Bortala Prefecture, Xinjiang in 2023, and Anyang, Henan in 2023. Three replicates were set in each environment, and 5 consecutive plants with normal growth and development except the first one in the side row were selected for measurement. The measurement method is: plant height: the height from the cotyledon node to the terminal bud, the height of the first fruit branch: the height from the cotyledon node to the first fruit branch node. The average value of the 5 plants was taken as the phenotypic value of the variety under the replicate, and the average value of the 3 replicates was taken as the phenotypic value of the variety under this environment. By statistically analyzing the genotypes and phenotypic values ​​of the 387 materials at the 21043956th base of A05, the following results were obtained, as Figure 3 shown.

[0055] The results showed that the plant height and the height of the first fruit branch of the materials with genotype C / C were significantly higher than those of the materials with genotype T / T. Figure 4 As shown. And the results were consistent in multiple environments. Genotype analysis showed that this SNP is a molecular marker associated with cotton plant height and first fruit branch height. In practical applications, the plant height and first fruit branch height of the tested plant can be determined by detecting the genotype of the tested plant: CC genotype cotton is cotton with higher plant height and first fruit branch height, and TT genotype cotton is cotton with lower plant height and first fruit branch height.

[0056] In summary, the present invention also provides the following method for detecting plant height and first fruit branch height of upland cotton, comprising the following steps:

[0057] Step 1: Extract the DNA of the upland cotton sample to be tested. Specifically, the following steps can be used for extraction:

[0058] 1. Take a single shelled upland cotton seed and place it in a 2 ml centrifuge tube. Add two 4 mm steel balls and grind it into powder.

[0059] 2. Add 800 μl of preheated SDS extraction solution (1% SDS, 0.01% EDTA, 0.705 mol / L NaCl, 0.05 mol / L Tris-HCl, 0.5% sorbitol, 1% PVP, 1% β-mercaptoethanol) to the centrifuge tube, vortex to mix, and place in a 65°C water bath for 30 min, inverting to mix every 10 min.

[0060] 3. Add 800 μl of a mixture of phenol, chloroform and isoamyl alcohol (volume ratio 25:24:1) to the centrifuge tube, mix by inverting until no layers are formed, and centrifuge at 12,000 rpm for 10 min.

[0061] 4. Pipette 650 μl of supernatant into a new centrifuge tube, add an equal volume of a mixture of chloroform and isoamyl alcohol (volume ratio 24:1), mix by inverting until no layers are formed, and centrifuge at 12,000 rpm for 10 min.

[0062] 5. Pipette 500 μl of supernatant into a new centrifuge tube, add 0.7 times the volume of isopropanol, mix slowly until the DNA clumps and precipitates, and let stand at room temperature for 30 min.

[0063] 6. Wash the DNA precipitate twice with 70% ethanol and once with anhydrous ethanol.

[0064] 7. Dry the ethanol in the centrifuge tube, add 100μl ddH2O to fully dissolve the DNA and set aside.

[0065] Step 2: Use the detection primers (two forward primers and one universal reverse primer) in the above genotyping experiment to perform PCR amplification on the DNA of the upland cotton sample to obtain a PCR amplification product. The specific PCR reaction system refers to the PCR reaction system in the above KASP typing experiment.

[0066] Step 3: Perform fluorescence detection and analysis on the PCR amplification products (the specific fluorescence detection and analysis process can refer to the fluorescence detection in the above-mentioned KASP typing experiment process). When FAM fluorescence is generated, it means that the genotype of the upland cotton sample at the above-mentioned SNP molecular marker is CC. When HEX fluorescence is generated, it means that the genotype of the upland cotton sample at the above-mentioned SNP molecular marker is TT; among which, the upland cotton with CC genotype is cotton with high plant height and first fruit branch height, and the upland cotton with TT genotype is cotton with low plant height and first fruit branch height.

[0067] It should be noted that the 5' end of the forward primer 1 mentioned above carries a FAM tag sequence, and the 3' end base is C; the 5' end of the forward primer 2 mentioned above carries a HEX tag sequence, and the 3' end base is T. At a specific annealing temperature, the CC genotype cotton germplasm combines with the forward primer 1 and extends, and the FAM group in the PCR system is separated from the quencher group, and combines with the FAM tag sequence of the DNA amplification fragment to generate FAM fluorescence (red); similarly, the TT genotype cotton germplasm combines with the forward primer 2, and the HEX group in the PCR system is separated from the quencher group, and combines with the HEX tag sequence of the DNA amplification fragment to generate HEX fluorescence (blue). Therefore, the genotype of the cotton germplasm to be tested can be accurately and intuitively judged by detecting the fluorescence value of the PCR product, providing technical support for molecular marker-assisted cotton breeding.

[0068] In summary, the SNP variation located in the upstream regulatory region of the Ghi_A05G10671 gene of upland cotton provided by the present invention is closely linked to the phenotypic values ​​of cotton plant height and first fruit branch height. The phenotypic values ​​corresponding to different genotypes are significantly different and behave consistently in multiple environments. It can be used as a molecular marker and applied to the identification and breeding of cotton plant height and first fruit branch height traits. The genotype of the molecular marker in the population is detected by the KASP technology, and cotton germplasms with differences in plant height and first fruit branch height are efficiently distinguished based on the fluorescence value of the PCR product, so as to realize rapid, accurate and reliable identification of plant height and first fruit branch height. The germplasm with low first fruit branch height is not affected by environmental factors and has a wide range of applications. It can greatly accelerate the breeding process, improve the accuracy of selection in breeding and the efficiency of innovation of cotton germplasm with short and compact plant type. Specifically, when the SNP variation site in the cotton germplasm to be tested is detected as CC genotype, it can be judged that the cotton germplasm plant height and the first fruit branch height are relatively high. When the SNP variation site in the cotton germplasm to be tested is detected as TT genotype, it can be judged that the cotton germplasm plant height and the first fruit branch height are relatively low, which can greatly improve the screening efficiency of cotton plant height and first fruit branch height traits and accelerate the breeding process of excellent varieties. In addition, the variation site provided by the present invention can be used as a target for genetic engineering breeding, and the CC genotype point mutation is converted to the TT genotype by gene mutation and the like, thereby providing a fast and effective way for the genetic improvement of cotton plant height and the first fruit branch height, which has important application value for cotton germplasm innovation.

[0069] Obviously, those skilled in the art can make various changes and modifications to the technical solution without departing from the spirit and scope of the technical solution. Thus, if these modifications and variations of the technical solution fall within the scope of the claims of the technical solution and their equivalents, the technical solution is also intended to include these modifications and variations.

Claims

1. Application of a detection primer or a kit in detecting plant height and first fruit branch height of upland cotton, characterized in that: The detection primers are used to detect the following SNP molecular markers; The SNP molecular marker is located at the 21043956th base of chromosome A05 of the upland cotton genome, and the reference genome is Gossypium hirsutum (AD1) 'TM-1' genome WHU_v1, wherein in germplasm with high plant height and first fruit branch height, the nucleotide type of the SNP molecular marker is C, and in germplasm with short plant height and first fruit branch height, the nucleotide type of the SNP molecular marker is T, and the SNP molecular marker is located in the upstream regulatory region of the gene Ghi_A05G10671, and the nucleotide sequence of the gene Ghi_A05G10671 is shown in SEQ ID NO.1; The detection primers include two upstream primers and one downstream primer, wherein the nucleotide sequences of the two upstream primers are shown as SEQ ID NO.3 and SEQ ID NO.4 respectively; the nucleotide sequence of the downstream primer is shown as SEQ ID NO.5; The kit comprises the detection primers and PCR amplification reagents.

2. A method for detecting plant height and first fruit branch height of upland cotton, characterized in that: The following steps are involved: Step 1: Extract DNA from the upland cotton sample to be tested; Step 2: using the detection primers described in claim 1 to perform PCR amplification based on KASP technology on the DNA of the upland cotton sample to be tested, to obtain a PCR amplification product; wherein the 5' end of the upstream primer with the nucleotide sequence of SEQ ID NO.3 carries a FAM tag sequence, and the 3' end base is C; the 5' end of the upstream primer with the nucleotide sequence of SEQ ID NO.4 carries a HEX tag sequence, and the 3' end base is T; Step 3: Perform fluorescence detection and analysis on the PCR amplification product. When FAM fluorescence is generated, it indicates that the genotype of the upland cotton sample at the SNP molecular marker described in claim 1 is CC. When HEX fluorescence is generated, it indicates that the genotype of the upland cotton sample at the SNP molecular marker described in claim 1 is TT. Among them, the upland cotton with CC genotype is cotton with high plant height and first fruit branch height, and the upland cotton with TT genotype is cotton with low plant height and first fruit branch height.

Images