Primer group for detecting brown wrinkled fruit virus and application thereof

Abstract

The invention provides a primer group for detecting brown wrinkled fruit virus and application thereof, the primer group comprises a forward primer and a reverse primer, the nucleotide sequence of the forward primer is as shown in SEQ ID NO.1, and the nucleotide sequence of the reverse primer is as shown in SEQ ID NO.2. The invention further provides a kit for detecting the brown wrinkled fruit virus. The method comprises the following steps: carrying out degenerate treatment on primers according to possible mutation sites of brown wrinkled fruit virus; the problem of leak detection caused by virus gene mutation is avoided; according to the primer designed by the invention, similar sequences are not found in genome data of solanaceae plants, and the primer can be used for detecting the brown wrinkled fruit virus in solanaceae crops.

Description

Technical Field

[0001] The invention relates to the technical field of plant virus biological detection, and in particular to a primer set for detecting brown rugose fruit virus and an application thereof. Background Art

[0002] Brown wrinkled fruit virus (ToBRFV) is a disease that mainly occurs on tomatoes and belongs to the genus Tobacco mosaic virus. The main hosts of the virus are tomatoes and peppers. The virus can destroy all tobacco mosaic virus resistance on tomatoes. Currently, all commercially available tomato varieties are susceptible to the virus. The main symptoms of infection of tomatoes are mosaic, dark green protrusions, narrow leaves, yellowing or necrosis of leaf veins, a decrease in the number of flowers and fruits, yellow or brown spots on the fruits, smaller fruits, wrinkles, and severe necrosis of the fruit stalks, which greatly threatens the production of tomatoes, peppers and other nightshade vegetables.

[0003] At present, the detection methods of ToBRFV mainly include electron microscopy technology, high-throughput sequencing technology and nucleic acid-based molecular biological assays. However, there are mutation sites in brown wrinkled fruit virus, and there is a problem of missed detection due to viral gene mutation. Summary of the invention

[0004] In order to solve the above technical problems, the purpose of the present invention is to provide a primer degeneracy treatment according to the possible mutation sites of brown rugose fruit virus.

[0005] The technical solution adopted by the present invention is as follows:

[0006] According to one aspect of the present application, the present application provides a primer set for detecting brown wrinkled fruit virus, the primer set comprising a forward primer and a reverse primer, the nucleotide sequence of the forward primer is shown in SEQ ID NO.1, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.2.

[0007] According to another aspect of the present application, the present application also provides a kit for detecting brown wrinkled fruit virus, and the kit includes the primer set.

[0008] According to another aspect of the present application, the present application also provides the use of the primer set or the kit for detecting whether a biological sample to be tested contains brown rugose fruit virus.

[0009] According to another aspect of the present application, the present application also provides a method for detecting whether a sample to be tested contains brown rugose fruit virus, the method comprising the following steps:

[0010] 1) Lysing the sample or extracting the total RNA of the biological sample to be tested;

[0011] 2) Using the obtained sample lysate or extracted total RNA as a template, synthesizing cDNA;

[0012] 3) using the synthesized cDNA as a template, and using the forward primer and the reverse primer in the primer set to perform PCR amplification to obtain an amplified product;

[0013] 4) Detecting the amplified product, and determining whether the brown rugose fruit virus is present based on the detection result of the amplified product.

[0014] In a specific embodiment of the present application, in step 4), the amplified product is detected to see whether it contains a specific DNA fragment. If it contains a specific DNA fragment, the biological sample to be tested contains brown rugose fruit virus; if it does not contain a specific DNA fragment, the biological sample to be tested does not contain brown rugose fruit virus.

[0015] Preferably, the specific DNA fragment is the target sequence of the forward primer and the reverse primer.

[0016] Preferably, if the amplified product contains a DNA fragment of 422 bp, the biological sample to be tested contains brown rugose fruit virus; if the amplified product does not contain a DNA fragment of 422 bp, the biological sample to be tested does not contain brown rugose fruit virus.

[0017] The beneficial effects of the present invention include but are not limited to:

[0018] The invention performs primer degeneration processing according to possible mutation sites of brown wrinkled fruit virus, thereby avoiding the problem of missed detection caused by viral gene mutation; the primers designed by the invention do not find similar sequences in genome data of Solanaceae plants, and can be used for detecting brown wrinkled fruit virus in Solanaceae crops. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 PCR amplification results of different primer sets for ToBRFV detection; M: D 2000 Marker, 1-8: amplification results of primers ToBRFV-408F / R at different temperature gradients, 9-16: amplification results of primers ToBRFV-422F / R at different temperature gradients, 17-24: amplification results of primers ToBRFV-410F / R at different temperature gradients

[0020] Figure 2 The invention is to detect the suitability of the primer set for detecting brown wrinkled fruit virus;

[0021] Figure 3 The tomato samples infected with ToBRFV for testing in the present invention;

[0022] Figure 4These are the results of using ToBRFV-422F / R to detect tomato samples; M: Marker D2000; 1-3: ToBRFV detection; CK: negative control; Sample No. 1 was sent by the Urumqi Plant Protection Station; samples No. 2 and No. 3 were collected from Moyu County, Hotan City; and sample No. 3 was collected from Tuanjie New Village, Tekes County, Yili City. DETAILED DESCRIPTION

[0023] The present invention is described in detail below in conjunction with specific embodiments. The following embodiments are only for the convenience of those skilled in the art to understand the technical solution of the present invention, to implement or use the present invention, and are not intended to limit the protection scope of the present invention.

[0024] In the present invention, unless otherwise specified, the raw materials and equipment used can be purchased from the market or are commonly used in the art. The methods in the embodiments, unless otherwise specified, are all conventional methods in the art.

[0025] Example 1

[0026] The genome sequences of all brown rugose fruit virus (ToBRFV) were downloaded from the NCBI database, and the conserved regions were found by sequence alignment. Degenerate primers were designed in the conserved regions to amplify the sequence of brown rugose fruit virus.

[0027] (1) Collect the genome sequences of 122 ToBRFV viruses (Table 1);

[0028] (2) Perform sequence alignment to determine the conserved regions of the ToBRFV genome sequence and replace the sites where base mutations occur with degenerate bases;

[0029] (3) In the conserved region, a gene fragment of appropriate length (target fragment size between 300 bp and 800 bp) was selected for primer design, and the primers were compared with the Solanaceae database in NCBI. If no similar sequence could be compared, it was ensured that the primer sequence could not match the genome sequence of the Solanaceae plant. A total of 3 primer pairs that met the conditions were obtained, as shown below:

[0030] ToBRFV-422F GCATGGGCCGACCCTATAGA(SEQ ID NO.1)

[0031] ToBRFV-422R GGTGCAGAGGACCATTGTAAWC(SEQ ID NO.2)

[0032] ToBRFV-408F ATGTCTTACAMAATCRCWACTC(SEQ ID NO.3)

[0033] ToBRFV-408R TCCTTTGACCARTTCTACYRCT(SEQ ID NO.4)

[0034] ToBRFV-410F ATGTCTTACAMAATCRCWACTC(SEQ ID NO.5)

[0035] ToBRFV-410R GTTCCTTTGACCARTTCTACYR(SEQ ID NO.6)

[0036] (4) Screening of ToBRFV primers

[0037] Using any ToBRFV virus genome sequence as a template, 3 pairs of designed primers were used to perform PCR amplification using the temperature gradient PCR (annealing temperature gradient was 54-64°C, a total of 8 gradients); primers that can amplify specific target bands were selected as primers for ToBRFV detection ( Figure 1 ), it was found that only ToBRFV-422F / R could amplify the specific target band, and ToBRFV-422F / R amplified a specific band of 422bp. After sequencing the amplified product, it was compared with the NCBI database, and the similarity with the gene sequence of the ToBRFV isolate was more than 99%, indicating that the amplified sequence was ToBRFV.

[0038] The primer pairs screened in the experiment that can be used to detect ToBRFV virus on Solanaceae plants are as follows:

[0039] ToBRFV-422F:GCATGGGCCGACCCTATAGA(SEQ ID NO.1)

[0040] ToBRFV-422R:GGTGCAGAGGACCATTGTAAWC(SEQ ID NO.2)

[0041] Table 1 Genome sequences of 122 ToBRFV viruses collected

[0042]

[0043]

[0044] Example 2

[0045] A method for detecting whether a sample to be tested contains brown rugose fruit virus (ToBRFV), the method comprising the following steps:

[0046] 1) Plant RNA extraction

[0047] 100 mg of tomato sample tissue was placed in a 1.5 mL DNase / RNase Free centrifuge tube and ground into powder in liquid nitrogen; 1 mL TRIzol was added to the ground sample to lyse the plant cells, and the lysate was formed after thorough mixing, and then allowed to stand at room temperature for 5 min; 200 μL of chloroform was added to the above lysate, vortexed for 15 s, and allowed to stand at room temperature for 10 min; centrifuged at 12,000 × g and 4°C for 15 min. After centrifugation, the upper aqueous phase was carefully transferred to a new 1.5 mL centrifuge tube, 500 μL of isopropanol was added, and the tube was gently inverted and mixed, and allowed to stand at room temperature for 10 min; centrifuged at 12,000 × g and 4°C for 10 min, and the supernatant was discarded. At this time, RNA was precipitated at the bottom of the tube; 1 mL of 75% ethanol was added and prepared with DNase / RNase-free water; the precipitate was washed, centrifuged at 7,500 × g and 4°C for 5 min, the supernatant was discarded, and the washing step was repeated once; the precipitate was air-dried at room temperature for 5 min. Then, 30 μL of DNase / RNase-free water was added to dissolve the precipitate. After the precipitate was completely dissolved, the obtained RNA solution was stored in a -80°C refrigerator for subsequent experiments.

[0048] 2) Reverse transcription

[0049] The total RNA extracted in the above step was used as a template to synthesize cDNA using the PrimeScript RTreagent Kit with gDNAEraser kit. The specific operation was carried out according to the instruction manual.

[0050]

[0051] Briefly centrifuge to mix the components in the system. Reaction procedure: keep at 42℃ for 60min; 95℃ for 5min, then store at -20℃.

[0052] 3) PCR amplification

[0053] The above synthesized cDNA was used as a template for PCR amplification. The reaction system is shown in Table 4 below:

[0054] The PCR reaction system is as follows:

[0055]

[0056] The PCR reaction procedure is as follows:

[0057]

[0058] 4) Detection

[0059] After the PCR amplification reaction is completed, the reaction product is detected by agarose gel electrophoresis. When a 422bp specific band appears, it is judged as positive, and when there is no band, it is judged as negative.

[0060] Example 3

[0061] 40 of the 122 vectors containing the ToBRFV virus sequence were randomly selected as templates, and the designed primers (oBRFV-422F\ToBRFV-422R) were used for primer specificity detection, and the target bands were amplified ( Figure 2 ), and the PCR products were all ToBRFV sequences after sequencing and alignment.

[0062] Example 4

[0063] Referring to the method of Example 2, ToBRFV-422F\ToBRFV-422R were used to test 3 tomato samples infected with virus diseases from different regions of Xinjiang (Moyu County, Hotan City, Tuanjie New Village, Tekes County, Yili City, and Plant Protection Station, Urumqi City) Figure 3 ) for PCR detection. The results showed that the target band could be amplified using ToBRFV-422F\ToBRFV-422R ( Figure 4 ), after sequencing the PCR products, the sequences were compared with the NCBI database, and the similarities were all above 99%, indicating that the sequences amplified using ToBRFV-422F\ToBRFV-422R were brown wrinkled fruit virus.

[0064] The above is a detailed introduction to a primer set for detecting brown wrinkled fruit virus provided by the present invention and its application and its application. The principle and implementation mode of the present invention are described in detail using specific examples herein, and the description of the above embodiments is only used to help understand the method of the present invention and its core idea. It should be pointed out that for ordinary technicians in this technical field, without departing from the principle of the present invention, the present invention can also be improved and optimized in several ways, and these improvements and optimizations also fall within the scope of protection of the claims of the present invention.

Claims

1. A primer set for detecting brown rugose fruit virus, characterized in that: The primer set includes a forward primer and a reverse primer. The nucleotide sequence of the forward primer is shown as SEQ ID NO.1, and the nucleotide sequence of the reverse primer is shown as SEQ ID NO.

2.

2. A kit for detecting brown rugose fruit virus, characterized in that: The kit comprises the primer set as claimed in claim 1.

3. Use of the primer set according to claim 1 or the kit according to claim 2 in detecting whether a biological sample to be tested contains brown rugose fruit virus.

4. A method for detecting whether a sample to be tested contains brown rugose fruit virus, characterized in that: The method comprises the following steps: 1) Lysing the sample or extracting the total RNA of the biological sample to be tested; 2) Using the obtained sample lysate or extracted total RNA as a template, synthesizing cDNA; 3) using the synthesized cDNA as a template, and using the forward primer and the reverse primer in the primer set of claim 1 to perform PCR amplification to obtain an amplified product; 4) Detecting the amplified product, and determining whether the brown rugose fruit virus is present based on the detection result of the amplified product.

5. The method according to claim 4, characterized in that In step 4), the amplified product is detected to see whether it contains a specific DNA fragment. If it contains the specific DNA fragment, the biological sample to be tested contains brown rugose fruit virus; if it does not contain the specific DNA fragment, the biological sample to be tested does not contain brown rugose fruit virus.

6. The method according to claim 5, characterized in that The specific DNA fragment is the target sequence of the forward primer and the reverse primer according to claim 1.

7. The method according to claim 5, characterized in that If the amplified product contains a 422 bp DNA fragment, the biological sample to be tested contains brown rugose fruit virus; if the amplified product does not contain a 422 bp DNA fragment, the biological sample to be tested does not contain brown rugose fruit virus.

Images