A long-acting recombinant single-chain follicle-stimulating hormone fusion protein, gene, preparation method and application thereof

Abstract

The present invention relates to the field of molecular biology and pharmaceutical technology, and specifically to a long-acting recombinant single-chain follicle-stimulating hormone fusion protein, gene, preparation and application thereof. A long-acting recombinant single-chain follicle-stimulating hormone fusion protein, the protein structure formula from N-terminus to C-terminus is FSHβ-Linker E2-FSHα, wherein FSHβ is the follicle-stimulating hormone β subunit, FSHα is the follicle-stimulating hormone α subunit, and Linker E2 is the connecting sequence between the two subunits; the amino acid sequence of Linker E2 is shown in SEQ ID NO: 12. The long-acting recombinant single-chain follicle-stimulating hormone fusion protein obtained by the present invention is highly active and can be used for a single injection to replace multiple injections of natural FSH.

Description

Technical Field

[0001] The present invention relates to the field of molecular biology and pharmaceutical technology, and in particular to a long-acting recombinant single-chain follicle-stimulating hormone fusion protein, gene, preparation and application thereof. Background Art

[0002] Mammalian gonadotropins, including follicle-stimulating hormone (FSH) and luteinizing hormone (LH), are glycoprotein hormones secreted by pituitary gonadotropin cells and are regulated by hypothalamic gonadotropin-releasing hormone (GnRH, also known as luteinizing hormone-releasing hormone, LHRH), ovarian hormones and inhibins. FSH can stimulate the growth of female animals' ovaries, increase ovarian weight, stimulate follicle growth and development; and promote the development of spermatogenic epithelium and sperm formation in male animals. Different levels of FSH and LH in animals and the ratio between them (FSH / LH) will have different effects on the reproductive capacity of animals, especially the intensity of female animals' estrus, the duration of estrus, the number of mature follicles, the time of ovulation, the quality of eggs and related biological effects. Comparing the duration of estrus of cattle, horses, sheep, pigs and other animals, cattle have the shortest duration, horses have the longest duration, and sheep and pigs are in between. In animal production and veterinary clinics, FSH is often used to induce estrus ovulation and superovulation in female animals, as well as to treat ovarian function diseases, and is also used to maintain the sexual ability of breeding animals.

[0003] Both FSH and LH are composed of two polypeptide chains (or subunits) of α and β, which are bound together by non-covalent bonds to form functional units, so that they can bind to their receptors and exert corresponding biological effects. The amino acid sequences of the α-subunits of FSH and LH of the same species are the same, and the specificity of the hormone function is determined by the sequences of their respective β-subunits. At present, veterinary FSH is mainly extracted from animal pituitary tissue, which not only contains different amounts of LH, resulting in unstable biological effects, but also has the potential risk of carrying biological infectious agents. Due to the short half-life of natural FSH, multiple injections are required to achieve the desired effect, generally 1-2 times a day, and continuous medication for 3 to 4 days. Frequent injections not only increase labor costs, but also easily lead to animal stress reactions and affect drug effects. With the advancement and popularization of genetic engineering technology, a large number of target proteins have been obtained through genetic recombination technology. So far, there are two main genetic engineering strategies for recombinant FSH that have been reported. One is that the α and β polypeptide chains are expressed and folded separately, and then they are bound to each other by non-covalent bonds to form heterodimers. Due to the limited efficiency of the two free subunits binding to each other, the functional expression of this recombinant protein is low, that is, most of the expressed polypeptide chains are in a non-functional single subunit state. Therefore, many researchers turned to explore the second strategy, that is, how to connect the α and β polypeptide chains at the genetic level to encode a single polypeptide chain fusion protein.

[0004] For example, the Chinese invention patent (publication number: CN109970871A, publication date: 2019.07.05) discloses a recombinant human follicle stimulating hormone rFSH and its genetic engineering strain, as well as the recombinant expression vector, expression cassette, transgenic cell line or recombinant bacteria of the gene, and the recombinant bacteria are fermented to obtain the recombinant human follicle stimulating hormone rFSH; the coding gene of the protein and the engineering bacteria (recombinant Pichia pastoris) containing the coding gene are also provided; the recombinant human follicle stimulating hormone rFSH produced by the method of the invention has the advantages of long-term and stability, and is suitable for use as an ovulation hormone for humans and animals. Its recombinant strategy is to add three elements, namely CTP, peptide linker and Fc, on the basis of the two subunits b and a. There are too many exogenous sequences, and there is a concern of stimulating immune response after repeated use.

[0005] There are two main forms of constructing a single peptide chain fusion protein, namely, indirect fusion with an additional connecting element (connecting sequence) and direct fusion with head-to-tail connection. Since the function of a protein molecule depends on the correctness of its spatial structure, the two subunits of natural FSH must be fully folded freely before they can bind to each other through non-covalent bonds to have a functional spatial structure, otherwise they cannot be recognized by their receptors. Therefore, indirect fusion is better than direct fusion. The structure of the former can provide appropriate space for the correct folding of the two polypeptide chain subunits of α and β. The key to achieving indirect fusion is how to choose the linker between the two subunits. If the target protein is a long-acting FSH, the design of the linker sequence must take into account both the extension of the half-life and the improvement of the biological effect. In terms of the commonality of indirect fusion, the factors affecting the fusion protein in which the linker sequence is located include whether the length of the sequence itself provides just the right space for the free folding of the two subunits before and after it, the physical and chemical properties of the amino acid residues in the sequence (rigidity and flexibility, hydrophilicity and hydrophobicity, charge polarity, etc.) that cause the mutual influence between the amino acid residues, and whether the histidine tag used for downstream purification interferes with the correctness of folding. The relationship between the two subunits and the connecting sequence between them, the three-dimensional structure of the space directly affects the biological activity of the fusion protein, and also affects the expression of the recombinant fusion protein. Experiments have shown that sometimes a gene sequence difference of only one nucleotide is enough to affect the expression of the target protein; or a difference of one amino acid is enough to lead to a very different biological effect. As far as the characteristics of recombinant glycoproteins are concerned, in addition to the need to select a suitable host, when designing the connecting sequence, it is also necessary to consider whether glycosylation is required, and if so, how to determine the type, site, and number of glycosylation of the connecting sequence and its effect on the biological function of the target protein. In addition, during the expression process of the host cell, the folding state of the protein is restricted by many factors. The same gene sequence is subject to different constraints during the expression process of different host cells, and the degree of glycosylation and expression of the recombinant fusion glycoprotein are also different. Although it has been reported that several different recombinant single-chain FSHs were prepared by using several different connection sequences through indirect fusion technology, and studies have also shown that the glycosylation degree and half-life in the test animal of the recombinant fusion FSH containing glycosylated linkers are improved compared with wild-type FSH, its biological effect is not simply linearly related to the increase of glycosylation sites. The optimal sequence of FSH with low dose and high effect needs to be further explored. There is no clear and unified theoretical guidance for how to design a specific construction strategy of a fusion protein with a specific function. Researchers can only design the connection sequence by dry experiments through bioinformatics methods, and then conduct trial and error comparison by molecular biology wet experiments to test its real effect. Therefore, for recombinant single-chain follicle-stimulating hormone, there is no single, unchanging, universal connection sequence so far. Summary of the invention

[0006] The present invention aims at the deficiencies of the prior art and provides a long-acting recombinant single-chain follicle-stimulating hormone fusion protein, gene, preparation and application thereof, and in particular provides a connecting sequence for fusing two subunits of FSH. The long-acting recombinant single-chain follicle-stimulating hormone fusion protein has high expression and high activity and can be used for a single injection to replace multiple injections of natural FSH.

[0007] In order to achieve the above-mentioned purpose, the present invention adopts the following technical solutions:

[0008] The present invention takes sheep follicle stimulating hormone gene as an example to design a series of long-acting recombinant single-chain FSH containing different linker sequences according to the rotational freedom, hydrophilicity, charge effect, length and rigidity and flexibility of the amino acid monomer. The expression product is a single-chain fusion protein connected from the N-terminus to the C-terminus in the order of FSHβ-Linker-FSHα. Then, their expression levels and biological effects are compared, and the best sequence is preferably obtained.

[0009] The expression level is based on Chinese hamster ovary (CHO) cells as host cells, and the amount of recombinant protein secreted by the host cells into the culture medium and the biological effect are detected.

[0010] The biological effect is determined according to the follicle stimulating hormone bioassay in the quality standard of the Chinese Pharmacopoeia.

[0011] The research process of the long-acting recombinant single-chain FSH comprises the following steps:

[0012] Step 1: Design a series of candidate long-acting recombinant single-chain FSHs with different linker sequences based on the rotational freedom, hydrophilicity, charge effect, and length, rigidity, flexibility, and glycosylation of the amino acid monomers that constitute the candidate linker sequence between the α and β peptide chains of follicle-stimulating hormone. The order from the amino end to the carboxyl end is FSHβ-Linker-FSHα. Full gene synthesis of the coding sequence of one of the fusion proteins provides a template for subsequent research.

[0013] Step 2: Recombining in sequence by localized replacement PCR to obtain the coding sequence of long-acting recombinant single-chain FSH containing different linker sequences. The different linker sequences include control group and experimental group sequences.

[0014] Step 3: The target fragments obtained after double restriction digestion of the FSH gene sequence (confirm that the coding sequence is in the correct translation reading frame) replaced and amplified by PCR and containing different linkers and double restriction sites (such as Nhe I and EcoR I, or XbaI and XmaI) are cloned into the vector plasmid [such as pcDNA3.1(+)] that has been digested with the same double restriction enzymes, and connected by T4 ligase to make FSHβ-Linker-FSHα- pcDNA3.1(+) into a circular structure, and transformed into competent DH5α Escherichia coli. The expression product of this gene is the secretory target protein.

[0015] Step 4: Extract plasmids from transformed E. coli, and transfect Chinese hamster ovary (CHO) cells after each sequence is determined, and conduct parallel experiments to transiently express secreted target proteins.

[0016] Step 5: Take the supernatant of transiently expressed cell culture fluid to analyze and compare the expression of the target gene. Select one clone with the highest expression from each of the control group and the experimental group for further study.

[0017] Step 6: The selected control group and experimental group FSHβ-Linker-FSHα-pcDNA3.1(+) were linearized by single enzyme digestion and then transfected into CHO cells.

[0018] Step 7. Select the transfected CHO cells for further cloning and compare the expression levels.

[0019] Step 8. Take one stable and highly expressed clone, also called cell line, from each of the control group and experimental group for further study.

[0020] Step 9: Cultivate two cell lines in parallel, take equal amounts of expression products from each, and compare the biological effects of the two according to the method specified in the pharmacopoeia to determine the optimal sequence.

[0021] The present invention obtains a long-acting recombinant single-chain follicle-stimulating hormone fusion protein through the above research process. The protein structure formula from N-terminus to C-terminus is FSHβ-Linker E2-FSHα, wherein FSHβ is the follicle-stimulating hormone β subunit, FSHα is the follicle-stimulating hormone α subunit, and Linker E2 is the connecting sequence between the two subunits; the amino acid sequence of the Linker E2 is shown in SEQ ID NO: 12.

[0022] Preferably, the nucleotide sequence of the gene encoding Linker E2 is shown in SEQ ID NO: 7.

[0023] Furthermore, the present invention also discloses a gene encoding the fusion protein of the claims, and the nucleotide sequence of the gene is shown in SEQ ID NO: 13.

[0024] Furthermore, the present invention also discloses an expression vector, which contains a gene encoding the fusion protein.

[0025] Furthermore, the present invention also discloses a host cell, wherein the host cell contains the expression vector or contains a gene encoding the fusion protein.

[0026] Furthermore, the present invention also discloses a method for preparing the fusion protein, which comprises the following steps:

[0027] 1) The fully synthesized FSHβ-Linker E2-FSHα fragment was inserted into the expression vector pcDNA3.1(+) by double digestion with Nhe I and EcoR I to construct a recombinant expression plasmid;

[0028] 2) The recombinant expression plasmid is transformed into competent DH5α Escherichia coli, and the plasmid is extracted after culture, screening and verification; 3) The recombinant plasmid obtained in step 2) is transfected into host cells, such as CHO-K1 cells, to induce the expression of FSHβ-Linker E2-FSHα recombinant protein.

[0029] Furthermore, the present invention also discloses the use of the fusion protein or the gene in preparing a drug for stimulating the growth of female animal ovaries; or, in preparing a drug for stimulating the growth and sexual ability of male sperm.

[0030] Furthermore, the present invention also provides a pharmaceutical composition, which contains the long-acting recombinant single-chain follicle-stimulating hormone fusion protein or the expression vector, and a pharmaceutically acceptable carrier and / or excipient.

[0031] Furthermore, the present invention also provides a pharmaceutical preparation, which contains the pharmaceutical composition.

[0032] Preferably, the pharmaceutical preparation is an injection.

[0033] In summary, the present invention provides a novel gene sequence of a connecting sequence for a recombinant long-acting single-chain FSH fusion protein, which can connect the FSH α subunit and the FSH β subunit together at the gene level, thereby encoding a fusion protein of a single peptide chain. In addition, the gene can be expressed long-term and stably, with a high expression level. The obtained long-acting recombinant single-chain follicle-stimulating hormone fusion protein is highly active and can be used for a single injection to replace multiple injections of natural FSH. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1Western blotting was used to characterize the expression level of the recombinant protein (1, culture supernatant of non-transfected cells; 2, culture supernatant of cells transfected with the empty vector pcDNA3.1(+); the connection sequence numbers of 3-12 are C1, C2, C3, C4, E1, E2, E3, E4, E5 and E6, respectively).

[0035] Figure 2 is the expression level of recombinant FSH carrying different connection sequences.

[0036] Figure 3 Line graphs showing dose versus ovarian weight comparing the bioactivity of follicle stimulating hormone analogs using the follicle stimulating hormone bioassay. DETAILED DESCRIPTION

[0037] The following is a clear and complete description of the technical solutions in the embodiments of the present invention in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0038] Example 1 Expression of long-acting recombinant single-chain follicle-stimulating hormone fusion protein

[0039] 1. Design candidate sequences of long-acting recombinant single-chain follicle-stimulating hormone genes. Taking the sheep follicle-stimulating hormone gene as an example, a series of long-acting recombinant single-chain FSHs with different linker sequences were designed based on the rotational freedom, hydrophilicity, charge effect, length and rigidity and flexibility of the amino acid monomers. The gene sequence from 5' to 3' is FSHβ-Linker-FSHα. The corresponding sequences of FSHβ and FSHα are derived from GenBank, with numbers NM_001009798.1 and NM_001009464.1, respectively. The FSHβ subunit coding sequence retains its signal peptide and start codon coding sequence but deletes the stop codon, and the FSHα subunit coding sequence deletes the signal peptide and start codon coding sequence but retains its stop codon. Design the linker sequence. According to the length, rigidity, flexibility, hydrophilicity and charge effect of the linker sequence, 6 linker sequences (Linker) with histidine tags and different O-glycosylation and N-glycosylation sites were designed, numbered from E1 to E6 (SEQ ID NO: 6-11). Four sequences reported in existing literature were set as controls, numbered from C1 to C4 (SEQ ID NO: 2-5). The long-acting recombinant single-chain follicle-stimulating hormone gene FSHβ-Linker C1-FSHα connected by linker sequence C1 was fully synthesized, and its sequence is SEQ ID NO: 1. Other linker sequences were synthesized in the form of primers, and the purification method was PAGE. The synthesis amount was 1OD each, and the synthesized single-stranded DNA sequence was stored at -20°C for preparation of other full sequences.

[0040] 2. Prepare the other 9 complete sequences.

[0041] 2.1 The Linker C1 in FSHβ-Linker C1-FSHα was replaced with different linker sequences in sequence by local replacement PCR technology. The corresponding primers were named F1, R1, F2C2-F2C4, F3C2-F3C4, R2C2-R2C4, R3C2-R3C4, F2E1-F2E6, F3E1-F3E6, R2E1-R2E6 and R3E1-R3E6, as shown in Table 1. The 5' ends of F1 and R1 contain restriction endonuclease Nhe I and EcoR I cleavage sites, respectively.

[0042] Table 1. Primer list

[0043] Name Sequence (5’-------3’) F1 AAAGCTAGCCACCATGAAGTCCGTGCAGTT R1 CCGAATTCTTAAGATTTGTGATAATAACAAGTAC F2C2 CAGAGAAggatc cggcagcaac gccaccggca gccaTcacca TcaTcaTcac caTcaccaTc cg F3C2 cacca TcaTcaTcac caTcaccaTc cggcagcaac gccaccaa ctagtT TTCCTGATGG AGAGTTTACA ATGCAGGG R2C2 CAGGAAAactagttggtggcgttgctgccggAtggtgAtggtgAtggtgAtggtgAtggct R3C2 gAtggtgAtggtgAtggtgAtggctgccggtggcgttgctgccggatccT TCTCTGATGT CACTGAAGGA GCAGTAGCTG F2C3 CAGAGAAggc agcaaccata ccggcagcca ccatcaccat c F3C3 a ccggcagcc accatcacca tcaccatggc agcaaccaca ccgagTTTCC TGATGGAGAG TTTACAATGC AGGG R2C3 CAGGAAActc ggtgtggttg ctgccatggt gatggtgatg gtggctgccg R3C3 ggt gatggtg atggtggctg ccggtatggt tgctgccTTC TCTGATGTCA CTGAAGGAGC AGTAGCTG F2C4 CAGAGAAagc ggcaacctga ccagcggcag caacatgacc ag F3C4 ga ccagcggc agcaacatga ccagcggcag cTTTCCTGAT GGAGAGTTTA CAATGCAGGG R2C4 CAGGAAAtgccgctggtcatgttgctgccgctgg R3C4 ggtcatgttgctgccgctggtcaggttgccgctTTCTCTG ATGTCACTGA AGGAGCAGTA GCTG F2E1 CAGAGAAcac catcaccatc accataggac cggcagcaac gtgaccggca gcggcagcaa c F3E1 gaccggcagc ggcagcaacg tgaccagcgg caccTTTCCT GATGGAGAGT TTACAATGCA GGG R2E1 CAGGAAAggt gccgctggtc acgttgctgc cgctgccggt cacgttg R3E1 gc cgctgccg gtcacgttgc tgccggtcct atggtgatgg tgatggtgTT CTCTGATGTC ACTGAAGGAG CAGTAGCTG F2E2 CAGAGAAcat catcatcacc accaccacca ccatcatcac catacctccg gaagcaatgg gactggctcc F3E2 ccggaagcaa tgggactggc tccggaagta acgtcacctc tggcacaTTT CCTGATGGAG AGTTTACAATGCA R2E2 CAGGAAAtgt gccagaggtg acgttacttc cggagccagt cccattgctt ccggaggtat ggtgatgatg gtggtggt R3E2 Ccggaggtat ggtgatgatg gtggtggtgg tggtgatgat gatgTTCTCT GATGTCACTG AAGGAGCAGT AGCTG F2E3 CAGAGAAagc ggccaccatc accatcacca tggctccaac cacaccggca gcggc F3E3 ccaaccacac cggcagcggc agcaacatca ccatcggctc cTTTCCTGAT GGAGAGTTTA CAATGCAGGG R2E3 CAGGAAAgga gccgatggtg atgttgctgc cgctgccggt gtggttg R3E3 tgc cgctgcc ggtgtggttg gagccatggt gatggtgatg gtggccgctT TCTCTGATGT CACTGAAGGA GCAGTAGCTG F2E4 CAGAGAAagc cccggcagca accactccgg cgtgggcagc aacatcacca tcggcag F3E4 gggcagcaac atcaccatcg gcagccacca tcaccatcac catTTTCCTG ATGGAGAGTT TACAATGCAG GG R2E4 CAGGAAAatg gtgatggtga tggtggctgc cgatggtgat gttgctgccc acgccg R3E4 ggtgat gttg ctgcccacgc cggagtggtt gctgccgggg ctTTCTCTGA TGTCACTGAA GGAGCAGTAG CTG F2E5 CAGAGAAcaccatcacc atcaccatcc cagcgtgtcc aacggcaccg gcagcg F3E5 gtcc aacggcaccg gcagcggctc caacgccacc tccggcaccTTTCCTG ATGGAGAGTT TACAATGCAG GG R2E5 CAGGAAAggt gccggaggtg gcgttggagc cgctgccggt gccgttggac acgc R3E5 gccggtgccg ttggacacgc tgggatggtg atggtgatgg tgTTCTCTGA TGTCACTGAA GGAGCAGTAG CTG F2E6 CAGAGAAggc agccaccatc accatcacca tggctccaac cacaccggca gcatcagc F3E6 ccaaccacac cggcagcatc agcaacgtga ccatcggccc cTTTCCTGAT GGAGAGTTTA CAATGCAGGG R2E6 CAGGAAAggg gccgatggtc acgttgctga tgctgccggt gtggttggag ccat R3E6 gccggtgtgg ttggagccat ggtgatggtg atggtggctg ccTTCTCTGA TGTCACTGAA GGAGCAGTAG CTG

[0044] 2.2 The following 9 candidate sequences encoding single-chain FSH were obtained by local replacement PCR: 2.2.1

[0046] FSHβ-Linker C2: PCR amplification product using SEQ ID NO: 1 as template and F1, R2C2 and R3C2 as primers.

[0047] Linker C2-FSHα: PCR amplification product using SEQ ID NO: 1 as template and F2C2, F3C2 and R1 as primers.

[0048] FSHβ-Linker C2-FSHα: PCR amplification product using FSHβ-Linker C2 and Linker C2-FSHα as joint templates and F1 and R1 as primers. 2.2.2

[0050] FSHβ-Linker C3: PCR amplification product using SEQ ID NO: 1 as template and F1, R2C3 and R3C3 as primers.

[0051] Linker C3-FSHα: PCR amplification product using SEQ ID NO: 1 as template and F2C3, F3C3 and R1 as primers.

[0052] FSHβ-Linker C3-FSHα: PCR amplification product using FSHβ-Linker C3 and Linker C3-FSHα as joint templates and F1 and R1 as primers. 2.2.3.

[0054] FSHβ-Linker C4: a PCR amplification product using SEQ ID NO: 1 as a template and F1, R2C4 and R3C4 as primers.

[0055] Linker C4-FSHα: PCR amplification product using SEQ ID NO: 1 as template and F2C4, F3C4 and R1 as primers.

[0056] FSHβ-Linker C4-FSHα: PCR amplification product using FSHβ-Linker C4 and Linker C4-FSHα as joint templates and F1 and R1 as primers. 2.2.4.

[0058] FSHβ-Linker E1: PCR amplification product using SEQ ID NO: 1 as template and F1, R2E1 and R3E1 as primers.

[0059] Linker E1-FSHα: PCR amplification product using SEQ ID NO: 1 as template and F2E1, F3E1 and R1 as primers.

[0060] FSHβ-Linker E1-FSHα: PCR amplification product using FSHβ-Linker E1 and Linker E1-FSHα as joint templates and F1 and R1 as primers. 2.2.5.

[0062] FSHβ-Linker E2: PCR amplification product using SEQ ID NO: 1 as template and F1, R2E2 and R3E2 as primers.

[0063] Linker E2-FSHα: PCR amplification product using SEQ ID NO: 1 as template and F2E2, F3E2 and R1 as primers.

[0064] FSHβ-Linker E2-FSHα: PCR amplification product using FSHβ-Linker E2 and Linker E2-FSHα as joint templates and F1 and R1 as primers. 2.2.6.

[0066] FSHβ-Linker E3: PCR amplification product using SEQ ID NO: 1 as template and F1, R2E3 and R3E3 as primers.

[0067] Linker E3-FSHα: PCR amplification product using SEQ ID NO: 1 as template and F2E3, F3E3 and R1 as primers.

[0068] FSHβ-Linker E3-FSHα: PCR amplification product using FSHβ-Linker E3 and Linker E3-FSHα as joint templates and F1 and R1 as primers. 2.2.7.

[0070] FSHβ-Linker E4: PCR amplification product using SEQ ID NO: 1 as template and F1, R2E4 and R3E4 as primers.

[0071] Linker E4-FSHα: PCR amplification product using SEQ ID NO: 1 as template and F2E4, F3E4 and R1 as primers.

[0072] FSHβ-Linker E4-FSHα: PCR amplification product using FSHβ-Linker E4 and Linker E4-FSHα as joint templates and F1 and R1 as primers. 2.2.8.

[0074] FSHβ-Linker E5: PCR amplification product using SEQ ID NO: 1 as template and F1, R2E5 and R3E5 as primers.

[0075] Linker E5-FSHα: PCR amplification product using SEQ ID NO: 1 as template and F2E5, F3E5 and R1 as primers.

[0076] FSHβ-Linker E5-FSHα: PCR amplification product using FSHβ-Linker E5 and Linker E5-FSHα as joint templates and F1 and R1 as primers. 2.2.9.

[0078] FSHβ-Linker E6: PCR amplification product using SEQ ID NO: 1 as template and F1, R2E6 and R3E6 as primers.

[0079] Linker E6-FSHα: PCR amplification product using SEQ ID NO: 1 as template and F2E6, F3E6 and R1 as primers.

[0080] FSHβ-Linker E6-FSHα: PCR amplification product using FSHβ-Linker E6 and Linker E6-FSHα as joint templates and F1 and R1 as primers.

[0081] 2.3 The above-mentioned localized replacement is to prepare a single-stranded FSH candidate sequence containing a unique linker sequence through three rounds of PCR (PCR system is shown in Table 2-4):

[0082] Table 2. 1st round PCR system

[0083] Platinum PCR SuperMix High Fidelity 45µL F1 (20 µM) 1.5µL R2*(20 µM) 1.5µL R3** (10 nM) 1µL FSHa-Linker C1-FSHb (0.5 ng / µL) 1µL

[0084] R2*: According to the primer names of the amplification objects, they are R2C2, R2C3, R2C4, R2E1, R2E2, R2E3, R2E4, R2E5 or R2E6.

[0085] R3**: According to the primer names of the amplification objects, they are R3C2, R3C3, R3C4, R3E1, R3E2, R3E3, R3E4, R3E5 or R3E6.

[0086] PCR reaction parameters for the first round: 95 O C, enter the cycle after 1 min, 95 O C, 20 s, # O C, 20 s, 72 O C, 1 min, react for 30 cycles, and finally at 72 O C for 10 min. The PCR products were separated by 1% agarose gel electrophoresis, extracted, and O CSave for later use.

[0087] # Annealing temperature: C2: 58-72 O C, preferably 68 O C; C3: 58-72 O C, preferably 70 O C; C4: 58-70 O C, preferably 68 O C; E1: 58-72 O C, preferably 70 O C; E2: 58-72 O C, preferably 72 O C; E3:58-72 O C, preferably 72 O C; E4:58-72 O C, preferably 72 O C; E5: 65-72 O C, preferably 72 O C; E6: 60-72 O C, preferably 72 O C.

[0088] The annealing temperature in this test adopts the preferred temperature.

[0089] Table 3. Second round PCR system

[0090] Platinum PCR SuperMix High Fidelity 45 µL R1 (20 µM) 1.5 µL F2*(20 µM) 1.5 µL F3** (10 nM) 1µL FSHa-Linker C1-FSHb (0.5 ng / µL) 1 µL

[0091] F2*: According to the primer names of the amplification objects, they are F2C2, F2C3, F2C4, F2E1, F2E2, F2E3, F2E4, F2E5 or F2E6.

[0092] F3**: According to the primer names of the amplification objects, they are F3C2, F3C3, F3C4, F3E1, F3E2, F3E3, F3E4, F3E5 or F3E6.

[0093] Second round PCR reaction parameters: 95 O C, enter the cycle after 1 min, 95 O C, 20 s, #O C, 20 s, 72 O C, 1 min, react for 30 cycles, and finally at 72 O C for 10 min. The PCR products were separated by 1% agarose gel electrophoresis, extracted, and O CSave for later use.

[0094] # Annealing temperature: C2: 58-70 O C, preferably 68 O C; C3: 59-71 O C, preferably 70 O C; C4: 59-71 O C, preferably 70 O C; E1: 55-71 O C, preferably 70 O C; E2: 55-72 O C, preferably 71 O C; E3:55-72 O C, 72 O C; E4:58-72 O C, preferably 70 O C; E5:56-72 O C, preferably 72 O C; E6:58-72 O C, preferably 71 O C.

[0095] The annealing temperature in this test adopts the preferred temperature.

[0096] Table 4. PCR system for the third round

[0097] Platinum PCR SuperMix High Fidelity 45 µL F1 (20 µM) 1.5 µL R1 (20 µM) 1.5 µL First round PCR product (0.5 ng / µL) 1µL Second round PCR product (0.5 ng / µL) 1 µL

[0098] PCR reaction parameters for the third round: 95 O C, enter the cycle after 1 min, 95 O C. 20 s, 58-72 O C preferred 72 O C, 20 s, 72 O C, 1 min, react for 25 cycles, and finally at 72 O C for 10 min. The PCR products were separated by 1% agarose gel electrophoresis, extracted, and O CSave for later use.

[0099] The annealing temperature in this test adopts the preferred temperature.

[0100] The extraction and purification of the above PCR products were achieved by 1% agarose gel electrophoresis, which is well known to technicians in the industry. The target band was cut from the gel and purified using a column DNA purification kit (Shanghai Bioengineering), and then the concentration was determined using an ultra-micro UV spectrophotometer (Thermo Fisher nanodrop).

[0101] 3. Assemble the expression plasmid.

[0102] 3.1. The above 10 candidate sequences of single-stranded FSH with different linker sequences and the expression plasmid pcDNA3.1(+) were double-digested with restriction endonucleases Nhe I and EcoR I (Shanghai Biotechnology). The enzyme digestion system is shown in Table 5:

[0103] Table 5. Double enzyme digestion system

[0104] DNA 10 µg 10× Universal Buffer (Shanghai Biotech) 4 µL BSA 4 µg Nhe I 15 U EcoR I 15 U Deionized water Make up to 40 μL

[0105] After the above enzyme digestion system is mixed, it is incubated in a water bath at 37°C for 4 h. The digestion products are separated by 1% agarose gel electrophoresis. After electrophoresis, gel cutting and column purification are performed in sequence by techniques familiar to those skilled in the art.

[0106] 3.2 The target fragments obtained after double digestion of the candidate sequences containing different linker sequences with Nhe I and EcoR I were cloned into the pcDNA3.1(+) plasmid that had been double digested with the same enzymes, and ligated with ligase to make FSHβ-Linker-FSHα-pcDNA3.1(+) a circular structure. The ligation reaction system is shown in Table 6:

[0107] Table 6. Ligation reaction system

[0108] FSHβ-Linker-FSHα / EcoR I / Nhe I 14 μL pcDNA3.1 / NheI / EcoRI 2.4 μL 10x ligation buffer (NE BioLab) 2 μL Ligase (NE BioLab) 1.6 μL total 20 μL <![CDATA[16 o C Overnight]]>

[0109] The ligation product is the FSH recombinant expression vector containing different linkers. It is transformed into competent DH5α E. coli by the calcium chloride (CaCl2) method known to technicians in the industry, cultured on plates, single colonies are picked, cultured, strains are preserved, and plasmids are extracted. After verification by the double enzyme digestion method in 3.2 above, it is sent for sequencing confirmation. The cloned gene expression product is a secreted target protein.

[0110] 4. Transient expression of recombinant FSH in CHO-K1 cells.

[0111] According to the technology known to the technicians in the industry, a frozen CHO-K1 cell was taken, thawed, cultured and expanded. 24 hours before transfection, a 10 cm cell culture dish just covered with CHO-K1 cells was taken, the old culture medium was aspirated, PBS was washed three times, trypsinized for 1 minute, 5 mL of 10% serum F12 nutrient medium was pipetted evenly, and then counted, and the cell density was adjusted to 1x10 6 1 μg DNA of the FSH expression vectors containing different linkers was dissolved in 25 μL Ham's F12 serum-free nutrient medium; correspondingly, 1.5 μL lipofectamine 2000 was dissolved in 25 μL Ham's F12 serum-free nutrient medium. The above solutions were mixed evenly and allowed to stand at room temperature for 20 min. The mixed solutions were added to the 6-well plates with cells, gently blown and mixed, and then placed in a 37℃ 5% CO2 incubator for culture. After 6 hours, fresh serum-free nutrient medium was replaced. After 6 days of cell culture, the supernatants were taken for Western blotting to detect the expressed FSH protein: 4% polyacrylamide concentrated gel and 12.5% ​​separation gel were prepared, and 15 μl of supernatant was taken as specimens. After electrophoresis, the membrane was electrotransferred to a nitrocellulose membrane and incubated at 37°C for 1 h with rabbit anti-FSHα polyclonal antibody (1:400 dilution) as the primary antibody. The membrane was then washed three times with buffer. Then, goat anti-rabbit IgG-horseradish peroxidase-labeled secondary antibody (1:5000 dilution) was added and incubated at 37°C for 1 h. The membrane was then developed with chemiluminescence and photographed. Figure 1 shown.

[0112] Each experiment was repeated three times, and the expression levels of FSH recombined by different connection sequences were compared by analyzing the gray value of Western blot bands using ImageJ software. Figure 2 As shown. The experimental results show that there is no linear relationship between the expression level of the recombinant protein and the length of the linker, nor is there a linear relationship between its glycosylation state. The FSHβ-Linker E2-FSHα with the highest expression level was selected for further in-depth study, and the amino acid sequence of Linker E2 is shown in SEQ ID NO: 12. The FSHβ-Linker C4-FSHα with the highest expression level in the control group was selected as the control.

[0113] Example 2 Detection of expression of long-acting recombinant single-chain follicle-stimulating hormone fusion protein

[0114] 1. Stable expression of recombinant single-chain FSH in CHO-K1 cells

[0115] 1.1 Selection of G418 concentration for cell screening

[0116] CHO-K1 cells (1x10 5 Cells were added to each well) and when the cells grew to 50% confluence, the medium containing G418 was replaced, and the final concentrations of G418 in the medium were 0, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650 and 700 μg / mL, respectively, with 3 replicates for each concentration. The medium was changed every three days. After 10 days, the test results showed that there were no living cells in the cell culture wells with a G418 concentration greater than 200 μg / mL, so the G418 concentration of the cell screening medium was selected to be 250 μg / mL.

[0117] 1.2 Linearization of expression vector

[0118] The restriction endonuclease AcLI was used to linearize the empty vector pcDNA3.1(+), the expression vector pcDNA3.1(+)-FSHβ-Linker E2-FSHα and pcDNA3.1(+)-FSHβ-Linker C4-FSHα. The linearization system of the expression vector is shown in Table 7:

[0119] Table 7. Expression plasmid linearization restriction enzyme system

[0120] DNA molecule (vector) 10 µg Restriction endonuclease AcLI (Shanghai Biotech) 1µL 10× Tango Buffer 4 µL BSA 0.4 mL Deionized water Make up to 40 μL

[0121] After the above system was mixed, the enzyme digestion was incubated in a 37°C water bath for 4 h.

[0122] After the enzyme digestion products were separated by 1% agarose gel electrophoresis, the gel bands containing the linearized expression vector and the empty vector were cut out, purified and recovered, and the DNA concentration of the recovered products was determined for later use.

[0123] 1.3 Stable transfection of CHO-K1 cells

[0124] According to the techniques known to those skilled in the art, CHO cells were seeded in 24-well plates 24 hours before transfection and the cells were incubated at 37 oC. Culture in a 5% CO2 incubator for 18-24 hours to ensure that the cell density reaches 50-70% confluence, preferably 70% confluence. Before transfection, replace with serum-free Ham's F12K (Thermo Fisher) medium. Calculate per well, dissolve 1 μg DNA in 25 μL Ham's F12K serum-free nutrient medium to obtain solution A; accordingly, dissolve 1.5 μL Lipofectamine 2000 (Thermo Fisher) in 25 μL Ham's F12 serum-free nutrient medium to obtain solution B. Mix the liquids in tubes A and B to obtain solution C, and place solution C at room temperature for 25 to 30 minutes, and optimize it at room temperature for 20 minutes. Add solution C to the cell culture wells of the above 24-well plate, and gently shake to mix solution C with the culture medium. Place the cells at 37 o C. Culture in a 5% CO2 incubator for 7 h, discard the old culture medium, and add 0.5 mL / well of fresh culture medium. After 24 hours of culture, replace with selection medium containing 250 μg / mL G418. Change the medium (selection medium containing G418) every two days. On the 8th day, observe that there are no living cells in the non-plasmid transfection group, and adjust the cell density of the remaining groups to 1x10 with Ham's F12 nutrient medium. 6 cells / mL, and 1 mL / well was transferred to a 6-well plate. The transfected cells were cultured for another 7 days with the screening medium. 15 μL of the cell culture supernatant was taken for WB detection. The results showed that the empty vector group was negative, and the expression vector pcDNA3.1(+)-FSHβ-Linker C4-FSHα and pcDNA3.1(+)-FSHβ-Linker E2-FSHα groups were both positive.

[0125] 1.4 Engineering cell monocloning: After the two groups of cells containing the expression vector were successfully transfected, they were accurately counted and serially diluted with culture medium to contain 10 cells per mL, and then added to 96-well culture plates at 100 μl / well and placed in a 5% CO2 incubator. After 6 days, the monoclonal cell wells were observed and counted, and 15 μl of the cell culture medium of the monoclonal wells was taken to monitor the expression of recombinant FSH according to the above WB method. The clones with the highest expression levels were selected from the two groups of pcDNA3.1(+)-FSHβ-Linker C4-FSHα and pcDNA3.1(+)-FSHβ-Linker E2-FSHα and monocloned again according to the same method.

[0126] After three consecutive monoclonal clonings, three clones of the highest expression level were retained from each of the two cell lines, the control group clones C41, C43 and C46 and the experimental group clones E24, E26 and E27 (the letter and the first number are the connection sequence number, and the second number is the clone number), and further cultured and expanded. Both monoclonal cell lines were inoculated with cells at a density of 2x10^6 / mL and cultured in parallel. After seven days, the cell culture supernatant was collected in sterile tubes, centrifuged for 20 minutes (2000-3000 rpm), and the supernatant was carefully collected.

[0127] 1.5 Detection of expression level: An enzyme-linked immunosorbent assay (ELISA) kit (Wuhan Cloud Clone) was used to detect the concentration of recombinant FSH in the supernatant samples of the two cell line culture fluids. Two parallel standard series were set up with five wells each, and the standard diluent provided with the kit was used to prepare a series of dilutions of the standard. After dilution, the sample volume in each well was 100 μL, and the concentrations were 600, 400, 200, 100, and 50 μg / L, respectively. A substrate blank well was set up, and 100 μL of the standard diluent was added. Corresponding to the two series of samples to be tested, 3 wells were added to each of the samples to be tested that were diluted 5 times and 10 times with the sample diluent. 50 μL of the sample (standard and sample) was added to each well, and 50 μL of the detection solution A working solution (prepared before use) was added. The ELISA plate was sealed with a film and then placed at 37 o C for 1 h. Discard the liquid in the wells, wash each well with 350 μL of washing solution, soak for 1-2 min and spin dry. Repeat the plate wash 3 times. After the last wash and spin dry, add 100 μL of detection solution B working solution (prepared before use) to each well, seal the plate and place at 37 o Incubate at 37 °C for 30 minutes. Discard the liquid in the wells, spin dry, and wash the plate 5 times. Add 90 μL of TMB substrate solution to each well, seal the plate, and incubate at 37 °C for 30 minutes. oC color development in the dark (reaction time controlled within 10-20 minutes). Add 50 μL of stop solution to each well. Immediately use a multifunctional microplate reader to read at a wavelength of 450 nm, and measure the absorbance (OD value) of each well in sequence. With the concentration of the standard as the horizontal axis and the OD value as the vertical axis, a standard curve is drawn, and the function formula is the linear regression equation y = 325.92x + 23.608, R² = 0.9987. Substitute the OD value of the sample into the equation, calculate the sample concentration, and then multiply it by the dilution factor to obtain the actual concentration of the sample (Table 8). The two groups of data were tested by T test, showing that the expression level of the recombinant single-chain FSH containing the linker sequence E2 was higher than that of the control group under the same cell density and the same culture conditions, and the difference was extremely significant (P<0.01). The highest concentration of the control group (pcDNA3.1(+)-FSHβ-LinkerC4-FSHα) was 1543 µg / L, and its clone number was C41; the highest concentration of the experimental group (pcDNA3.1(+)-FSHβ-LinkerE2-FSHα) was 1927 µg / L, and its clone number was E27. Based on µg / L, the amount of secreted target protein contained in 1.0 mL of the cell culture fluid of the C41 transfection group was approximately equal to the amount of secreted target protein contained in 0.8 mL of the cell culture fluid of the E27 transfection group.

[0128] Table 8. Concentrations of samples with different dilutions measured by ELISA and the actual mean concentrations (µg / L)

[0129]

[0130] Example 3 Detection of biological activity of long-acting recombinant single-chain follicle-stimulating hormone fusion protein

[0131] 1. Detection of biological activity: Select one sample with the highest expression of recombinant single-chain FSH from each of the two engineered cell lines with the connection sequence C4 and E2, i.e., clone numbers C41 and E27, respectively, and further evaluate the biological activity of recombinant single-chain FSH according to the follicle-stimulating hormone bioassay method in the quality standard of the Chinese Pharmacopoeia.

[0132] 1.1. Preparation of solvent: On the day of the experiment, weigh an appropriate amount of bovine serum albumin and dissolve it in 0.9% sodium chloride solution to make a 1 mg / mL solution. After it is fully dissolved, adjust the pH value to 7.2 with 1 mol / L sodium hydroxide solution.

[0133] 12. Preparation of standard solution (S): On the day of the test, the injection standard (GONAL-f, MerckSerono) was fully dissolved in the above solution according to the marked potency and prepared into high, medium and low dose concentrations (dS3, dS2, dS1: 12 IU / mL, 6 IU / mL, 3 IU / mL) of standard solutions. The potency ratio (r) of adjacent solutions was equal to 1:0.5. The standard solution was stored at 4°C and used within 3 days.

[0134] 1.3. Preparation of two groups of test solution: The two recombinant FSH proteins C41 and E27 prepared in Example 2 were used as test samples, and the titers (A T ) are 12 IU / µg each. The calculation in Example 2 shows that the volume ratio of the cell culture fluid (supernatant) containing equal amounts of secretory target proteins in C41 and E27 is 1:0.8. According to this ratio, the supernatants of C41 and E27 were measured respectively, and according to the preparation method of the standard solution, the two series of test samples were prepared into solutions of high, medium and low concentrations [dC3 (1 µg / mL), dC2 (0.5 µg / mL), dC1 (0.25µg / mL) and dE3 (1 µg / mL), dE2 (0.5 µg / mL), dE1 (0.25 µg / mL].

[0135] 1.4. Test results and analysis: Sprague Dawley healthy female rats of the same source aged 19-22 days and weighing 45±5 g were randomly divided into 9 groups on the day of the experiment, with 8 rats in each group. The rats were subcutaneously injected with the standard or the test product. The standard solution was injected 0.5 mL each time, once a day, for 3 consecutive days. The test products C41 and E27 series were injected with 0.5 mL only on the first day. 18 hours after the last administration, the animals were killed at the same time, weighed, dissected, the ovaries were removed, the surrounding attached tissues were peeled off, the oviducts were removed, the surrounding fluid was absorbed with filter paper, and the weight was directly weighed, and then converted to the weight of the ovaries per 10 g body weight (Table 9). The test results showed that the standard and the two test products each showed a dose-effect relationship, and the three were linearly related and parallel to each other within the dosage range ( Figure 3 ). This indicates that the highly expressed follicle stimulating hormone analogue of the present invention has similar biological activity to that of the standard product.

[0136] Table 9. Effects of each test product on rat ovarian weight gain* (ovarian weight mg / body weight 10g)

[0137]

[0138] 8 animals in each group. SL: low dose of standard product, SM: medium dose of standard product, SH: high dose of standard product; CL: low dose of control product, CM: medium dose of control product, CH: high dose of control product; EL: low dose of test product, EM: medium dose of test product, EH: high dose of test product. ∑y(k): sum within each dose group; ∑y(m): sum between each block group.

[0139] 2. Parallel line determination of quantitative response: According to the statistical method of biological assay in Chinese Pharmacopoeia, variance analysis and reliability test were performed on the experimental data, and the titer of recombinant FSH was calculated.

[0140] 2.1. Analysis of variance and reliability test: The test results showed that at the given probability level, the regression terms between the standard and the control group (Table 10), the standard group and the experimental group (Table 11), and the control group and the experimental group (Table 12) were all very significant (P<0.01), and the deviations from parallelism, quadratic curves, and directional quadratic curves were not significant (P>0.05), which proved that the experimental design was reasonable and the data were reliable.

[0141] Table 10. ANOVA and reliability test of standard products and control group (SC)*

[0142] Sources of variation f Sum of squares variance F-value P Sample Room 1 0.394341 0.394341 0.002232 >0.05 return 1 176.6977 176.6977 32823.36 <0.01 Deviation from parallel 1 0.002899 0.002899 0.538435 >0.05 Quadratic Curve 1 0.019204 0.019204 3.567294 >0.05 Reverse quadratic curve 1 0.003912 0.003912 0.726753 >0.05 Dosage room 5 177.1026 35.42053 6579.716 <0.01 Between blocks 7 0.043907 0.006272 1.165177 >0.05 error 35 0.188415 0.005383 total 47 177.335

[0143] * P<0.05 has a reliability of more than 95% in rejecting the null hypothesis, indicating that the variation is significant, P<0.01 is very significant, and P>0.05 is not significant.

[0144] Table 11. ANOVA and reliability test of standard products and experimental groups (SE)*

[0145] Sources of variation f Sum of squares variance F-value P Sample Room 1 0.394265 0.394265 0.16391 >0.05 return 1 175.5676 175.5676 72.98997 <0.01 Deviation from parallel 1 0.000127 0.000127 5.27E-05 >0.05 Quadratic Curve 1 0.021781 0.021781 0.009055 >0.05 Reverse quadratic curve 1 0.002867 0.002867 0.001192 >0.05 Dosage room 5 175.9702 35.19404 14.63147 <0.01 Between blocks 7 0.102245 0.014607 0.006072 >0.05 error 35 84.18782 2.405366 total 47 260.2603

[0146] *P<0.05 has a reliability of more than 95% in rejecting the null hypothesis, indicating that the variation is significant, P<0.01 is very significant, and P>0.05 is not significant.

[0147] Table 12. ANOVA and reliability test of the control group and experimental group (CE)*

[0148] Sources of variation f Sum of squares variance F-value P Sample Room 1 1.577211 1.577211 85.68036 <0.01 return 1 176.9972 176.9972 85.68036 <0.01 Deviation from parallel 1 0.001813 0.001813 0.098473 >0.05 Quadratic Curve 1 0.007231 0.007231 0.392809 >0.05 Reverse quadratic curve 1 8.11E-05 8.11E-05 0.004405 >0.05 Dosage room 5 178.5787 35.71574 1940.221 <0.01 Between blocks 7 0.144223 0.020603 1.119256 >0.05 error 35 0.644283 0.018408 total 47 179.3672

[0149] * P<0.05 has a reliability of more than 95% in rejecting the null hypothesis, indicating that the variation is significant, P<0.01 is very significant, and P>0.05 is not significant.

[0150] 2.2. Recombinant FSH titer and confidence limit: The calculation results show that the titers of the control group (C) and the experimental sample (E) are 11.65 IU and 12.66 IU, respectively, relative to the standard (S) 12 IU. It is important that the volume of the control group cell supernatant used in the experiment is larger than the volume of the experimental sample cell supernatant of the same concentration, and the ratio of the supernatant volume used by the two is 1.25:1; while the titer per unit mass (IU / µg) of the control group is lower than that of the experimental sample, and the titer ratio of the two is 0.92:1 (Table 13). According to the requirements of the bioassay statistics method, the confidence limit (FL%) is 2.34% (Table 14), which meets the requirements of the Chinese Pharmacopoeia, and the results of this experiment are credible. It is proved that the titer of the long-acting recombinant single-chain FSH containing the E2 linker sequence is higher than that of the recombinant FSH containing the C4 linker sequence of the same amount, that is, the FSH analogue containing the linker sequence E2 is superior to the FSH analogue containing C4 in terms of its biological activity (Tables 13 and 14).

[0151] Table 13. Comparison of sample dosage and potency of control group (C) and experimental product (E)

[0152] Control group (C4) Experimental group (E2) C4:E2 Sample volume (µL) 648 519 1.25:1 Potency (IU / µg) 11.65 12.66 0.92:1

[0153] Table 14. Results of the confidence limit rate (FL%) of the potency between two blocks according to method (3.3)*

[0154] SC SE CE FL% of R 1.19 31.19 2.34

[0155] * SC: between the standard and the group containing C4 linker sequence (control group); SE: between the standard and the group containing E2 linker sequence (experimental group); CE: the confidence limit of potency between the control group and the experimental group. The Chinese Pharmacopoeia stipulates that the confidence limit must be less than 45%.

[0156] The present invention designs a group of different connection sequences according to the length, rigidity, flexibility, hydrophobicity and charge effect of the connection sequence between the α and β peptide chains, thereby obtaining a new FSH analog, namely a long-acting recombinant single-chain FSH with high expression and activity, which can be used for a single injection to replace multiple injections of natural FSH.

[0157] The above is a description of the embodiments of the present invention. Through the above description of the disclosed embodiments, professionals and technicians in the field can implement or use the present invention. Various modifications to these embodiments will be apparent to professionals and technicians in the field. The general principles defined herein can be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to these embodiments shown in this article, but will conform to the widest range consistent with the principles and novelties disclosed herein.

Claims

1. A long-acting recombinant single-chain follicle-stimulating hormone fusion protein, characterized in that: The protein structure formula from N-terminus to C-terminus is FSHβ-Linker E2-FSHα, wherein FSHβ is the follicle-stimulating hormone β subunit, FSHα is the follicle-stimulating hormone α subunit, and Linker E2 is the connecting sequence between the two subunits; the amino acid sequence of Linker E2 is shown in SEQ ID NO: 12, and the nucleotide sequence of the gene encoding Linker E2 is shown in SEQ ID NO:

7.

2. A gene encoding the fusion protein according to claim 1, wherein the nucleotide sequence of the gene is shown in SEQ ID NO:

13.

3. An expression vector, characterized in that: The expression vector contains a gene encoding the fusion protein according to claim 1.

4. A host cell, characterized in that The host cell contains the expression vector according to claim 3, or contains a gene encoding the fusion protein according to claim 1.

5. The method for preparing the fusion protein according to claim 1, characterized in that: The preparation method comprises the following steps: 1) The gene fragment of FSHβ-Linker E2-FSHα was inserted into the expression vector pcDNA3.1(+) by double digestion with Nhe I and EcoR I to construct a recombinant expression plasmid; 2) The recombinant expression plasmid is transformed into competent DH5α Escherichia coli, and the plasmid is extracted after culture, screening and verification; 3) The recombinant plasmid obtained in step 2) is transfected into host cells to induce the expression of FSHβ-Linker E2-FSHα recombinant protein.

6. Use of the fusion protein of claim 1 or the gene of claim 2 in the preparation of a drug for stimulating ovarian growth in female mammals; or, use of the fusion protein of claim 1 or the gene of claim 2 in the preparation of a drug for stimulating sperm growth and sexual ability in male mammals.

7. A pharmaceutical composition, characterized in that The pharmaceutical composition contains the fusion protein according to claim 1 or the expression vector according to claim 3, and a pharmaceutically acceptable carrier and / or excipient.

8. A pharmaceutical preparation, characterized in that The pharmaceutical preparation contains the pharmaceutical composition according to claim 7.

9. A pharmaceutical preparation according to claim 8, characterized in that: The pharmaceutical preparation is an injection.

Images