Method for spatial tracing and sequencing of cells or organelles

Abstract

The present invention relates to a solution for labeling on or in a biological sample, which solution allows for the assignment of an identification tag to a region of a biological sample comprising single or multiple cells or organelles, such as about 2 to 10 cells.

Description

[0001] The present invention relates to a solution for labeling on or in a biological sample, which solution allows to assign an identification tag to a region of the biological sample containing single or multiple cells or organelles, for example about 2 to 10 cells. Background Art

[0002] Current single-cell sequencing technologies are very powerful because they allow, for example, obtaining “omics” information (genome, epigenome, transcriptome, proteome, etc.) of each cell in a sample, but they require dissociation of the cells, resulting in the loss of localization information of each cell in the starting sample.

[0003] In fact, a major problem in oncology, for example, is how to accurately characterize tumor / microenvironment interactions, which requires both the acquisition of molecular signals and the spatial localization within the tissue of cells that exchange these signals. These interactions may play a major role in the survival or death of tumor cells. A better understanding of these interactions will help overcome the adaptive mechanisms that occur in tumor systems.

[0004] Although "omics" technologies have revolutionized molecular biology by enabling genomic, transcriptomic, epigenomic, and proteomic analysis on a very large scale, until recently they have only produced "average" profiles of multiple cells that do not take into account the cellular heterogeneity present in healthy and pathological tissues. Recently, a number of techniques for single-cell analysis have been developed. In particular, droplet microfluidic systems in which individual cells are co-encapsulated in droplets with beads containing barcoded primers allow RNA sequencing of tens of thousands of cells at the single-cell level (scRNA-seq). However, in these systems, cells in the tissue are dissociated prior to analysis, and there is no correlation between the single-cell sequencing data and the localization of these same cells in the original tissue.

[0005] Currently, single-cell analysis techniques that allow spatial localization of measured signals are very limited in terms of target number (immunohistochemistry, in situ RNA hybridization) and cell number (e.g., sequencing of individual cells after laser capture microdissection (LCM)). Although "spatial transcriptomics" (Vickovic, Sanja et al. Nature methods 16.10 (2019): 987-990.), "Slide-seq" (Rodriques, Samuel G. et al. Science 363.6434 (2019): 1463-1467) and "DNA nanoball stereo-sequencing" (Chen et al., "Large Field of View-Spatially Resolved Transcriptomics at Nanoscale Resolution" bioRxiv 2021.01.17.427004) systems allow spatial resolution in individual tissue sections, they do not provide access to single-cell data. “XYZ-seq” (Lee et al., Sci Adv. 2021 Apr 21;7(17):eabg4755) measures whole-genome single-cell expression, but with low spatial resolution (500 μm resolution) and fewer mRNA reads and fewer detected genes than standard scRNA-seq. Fluorescence in situ sequencing (FISSEQ) uses in situ sequencing to spatially localize the expression of multiple genes in fixed tissues, with short reads (30 bases) and only about 200 mRNA reads per cell (compared to about 40,000 in scRNA-seq). Digital Spatial Profiler (DSP) is a platform developed by Nanostring based on sequencing of photocleavable oligonucleotide markers released from target tissue regions by UV exposure. Data on cellular localization in tissues provide numerical and spatial distributions of RNA or target abundance. However, this technology does not provide access to the entire transcriptome, does not have single-cell resolution, and only allows analysis of small areas.

[0006] In summary, current technological tools to study cellular interactions in tissue interactions at the single-cell level are still limited because they only allow the spatial localization of signals from a limited number of molecular targets in a large number of cells, or the measurement of a large number of molecular targets on a limited number of localized (microdissected) cells, or the measurement of a large number of molecular targets on tens of thousands of non-localized cells.

[0007] Currently, combining (i) information on the spatial localization of each cell within a tissue with (ii) measurements of molecular signals from each of these same cells, for tens of thousands of individual cells, has been clearly identified as a major technical challenge and clinical need in order to better understand the adaptive mechanisms that occur, for example, in tumors and to tailor patient treatment accordingly.

[0008] The methods and kits provided by the present invention meet this need for a system that allows single-cell "omics" analysis of thousands of cells from a tissue with a spatial resolution of tens of cells or less. Summary of the invention

[0009] The present invention relates to a method for marking individual cells or organelles in a biological sample with an identifying nucleic acid sequence, the method comprising:

[0010] a) providing a first nucleic acid set ("emitter nucleic acids"), wherein each nucleic acid molecule comprises an amplification sequence, an identification sequence and a capture sequence;

[0011] b) providing a second nucleic acid set ("receptor nucleic acids"), wherein each receptor nucleic acid is covalently or non-covalently coupled to a ligand of a cellular target or an organelle target, wherein the receptor nucleic acid comprises i) an amplification sequence that matches all or part of the amplification sequence of the emitter nucleic acid set, or a complementary sequence thereof, or ii) a capture sequence that matches all or part of the capture sequence of the emitter nucleic acid set, or a complementary sequence thereof;

[0012] c) contacting the emitter nucleic acid set and the receptor nucleic acid set with a biological sample in a solution so as to label individual cells or organelles within the biological sample with at least the receptor nucleic acids;

[0013] d) releasing a plurality of nucleic acid molecules which are copies of a region of the emitter nucleic acid comprising the amplification sequence, the identification sequence and the capture sequence or their reverse complements ("emitted nucleic acids") and hybridizing the emitted nucleic acids with receptor nucleic acids;

[0014] e) dissociating the biological sample and recovering individualized cells or organelles, wherein at least a subpopulation of the individualized cells or organelles are labeled with the emitted nucleic acid.

[0015] In a second aspect, the present invention relates to a method for mapping and sequencing individual cells or organelles of a biological sample, the method comprising:

[0016] a) providing individualized cells labeled with (i) a nucleic acid comprising an amplification sequence, an identification sequence and a capture sequence or (ii) the reverse complement of (i) as obtainable by the method for labeling individual cells or organelles according to the invention;

[0017] b) trapping the individualized cells or organelles labeled with the nucleic acid or its reverse complement in compartments, wherein the compartments comprise compartment-specific nucleic acids and at least one of the following sequences for nucleic acid labeling and further sequencing: a hybridization site, a ligation site, or a recombination site;

[0018] c) analyzing the captured cells, organelles and / or their secreted molecules, optionally using optical detection;

[0019] d) lysing the captured cells, or cells and organelles, thereby releasing nucleic acids from the cells or organelles in the compartment;

[0020] e) associating i) a compartment-specific sequence with ii) said nucleic acid released from said cell or organelle in said compartment and iii) said nucleic acid comprising said amplification sequence, said identification sequence and said capture sequence or their reverse complements;

[0021] f) recovering the nucleic acid produced in step e) from the compartment and sequencing the recovered nucleic acid; and

[0022] g) defining nucleic acids comprising the same compartment-specific sequence as originating from the same single cell, and mapping the original position of the single cell on the biological sample based on the identification sequence or its reverse complement sequence contained in the nucleic acid generated in step e), thereby combining the mapping and sequencing information of the individual cells of the biological sample;

[0023] h) mapping the initial position of the single cell on the biological sample by determining the relative proportion of the same identification sequence or its reverse complement contained in the nucleic acid generated in step e) to estimate the distance between cells based on the principle of triangulation; and

[0024] i) Optionally, mapping said sequencing information back onto microscopy-derived images of said biological sample taken prior to dissociation.

[0025] In a third aspect, the present invention relates to a kit comprising:

[0026] a) emitter nucleic acids, wherein each emitter nucleic acid comprises an amplification sequence, an identification sequence and a capture sequence;

[0027] b) acceptor nucleic acids, wherein each acceptor nucleic acid comprises i) an amplification sequence that matches all or part of the amplification sequence of the emitter nucleic acid set, or a complementary sequence thereof, or ii) a capture sequence that matches all or part of the capture sequence of the emitter nucleic acid set, or a complementary sequence thereof;

[0028] c) ligands for cellular targets or organelle targets;

[0029] d) Optionally, a nicking endonuclease and a polymerase with strand displacement activity. DETAILED DESCRIPTION

[0030] The present invention relates to a solution for distributing identification nucleic acids by diffusion to an area of ​​a biological sample (such as a tissue section) containing multiple cells or organelles (through cells (optionally permeabilized)), for example about 2 to 10 cells. Since cells carrying the same identification nucleic acid are in the same area, it allows the reconstruction of the network of adjacent cells after dissociation of the biological sample, as well as single-cell analysis of cellular nucleic acids, and thus reconstruction of the spatial organization of cells before dissociation. The different proportions of specific identification nucleic acids allow the original distance between cells to be estimated based on the triangulation principle. The present invention relies on local isothermal amplification or pre-amplification of identification nucleic acid sequences, followed by their diffusion. The identification nucleic acid sequences can be associated with surrounding cells via ligands modified to be conjugated to the generated nucleic acids.

[0031] Therefore, the present invention makes it possible to use existing technologies (droplet microfluidics, valve microfluidics, microplates, thermoactive hydrogels) to individually dissociate, analyze and sequence cells of a biological sample (single cell), making it possible to determine the location of each cell in the starting biological sample.

[0032] Methods for labeling individual cells or organelles

[0033] In a first aspect, a method for labeling individual cells or organelles within a biological sample with an identifying nucleic acid sequence is provided.

[0034] In a first embodiment, a solution containing a ligand carrying a first nucleic acid set called "emitter nucleic acid" containing an identification sequence and a ligand carrying a second nucleic acid set called "receptor nucleic acid" is contacted with a biological sample. After the ligand is conjugated to the cell or organelle, the biological sample is washed and then a second solution is added at the tissue surface, which contains a nicking endonuclease, a polymerase with strand displacement activity, and optional additional nucleic acids to improve local amplification in a buffer compatible with enzyme activity. By the action of endonucleases and polymerases on the emitter nucleic acid, a copy of a portion of these nucleic acids containing the identification sequence will be released. Then, copies of these "emitted nucleic acids" containing the identification sequence will be captured on the "receptor" ligand by hybridization on the receptor nucleic acid.

[0035] In a second embodiment, rolling circle amplification (RCA) is used to amplify the emitter nucleic acid containing the identification sequence to form concatemers of the same nucleic acid, which are then contacted with a biological sample having a restriction endonuclease to destroy the concatemers. A ligand carrying a receptor nucleic acid is also contacted with the biological sample. The cut concatemer fragments associate with cells or organelles by hybridizing on the receptor nucleic acid. Alternatively, in this second embodiment, the nucleic acid containing the identification sequence can be provided in the form of beads with multiple emitter nucleic acids containing the same identification sequence.

[0036] As used herein, Biological samples Any network of adjacent cells is encompassed, such as a tissue sample, an organoid, a 2D cell culture (particularly a 2D confluent cell culture) or a 3D cell culture. The biological sample may be fresh, frozen or fixed. According to one embodiment, the biological sample is a tumor tissue sample.

[0037] In the context of this method, a first nucleic acid set (" Emitter nucleic acid ”), wherein each nucleic acid molecule preferably comprises an amplification sequence, an identification sequence and a capture sequence consecutively in a 5'-3' direction.

[0038] At least some of the nucleic acid molecules of the emitter nucleic acid set differ from the other nucleic acid molecules at least in the identification sequence. According to one embodiment, each nucleic acid molecule of the emitter nucleic acid set differs from the other nucleic acid molecules at least in the identification sequence. The different identification sequence can be a barcode sequence, or comprise both a constant sequence and a barcode sequence. "Barcode sequence" means a nucleic acid sequence that is random or presents a determined (i.e., known) sequence.

[0039] According to some embodiments, the amplification sequence is identical in all or some (preferably all) of the nucleic acid molecules of the emitter nucleic acid collection.

[0040] According to some embodiments, the capture sequence is identical in all or some (preferably all) of the nucleic acid molecules of the emitter nucleic acid collection.

[0041] The emitter nucleic acid is preferably at most 110, 100, 90, 80, 70 or preferably 60 nucleotides long, but longer sequences can also be used. Typically, each of the amplification sequence, identification sequence and capture sequence is 10 to 30 nucleotides long, preferably 12 to 25 nucleotides long.

[0042] In some embodiments, the emitter nucleic acid also comprises a nicking site (for a nicking endonuclease) and a few consecutive nucleotides adjacent to the nicking site (forming a priming site) to allow priming of amplification by polymerization and nicking.

[0043] The emitter nucleic acid is preferably a DNA molecule and can be single-stranded DNA or partially double-stranded DNA (hairpin DNA).

[0044] For example, the emitter nucleotides include or consisting thereof, wherein underlined nucleotides represent capture sequences, italic nucleotides represent barcode sequences, which are identification sequences, and bold nucleotides represent amplification sequences as well as nicking sites, priming sites, loops, and the reverse complement of the priming site (for self-priming).

[0045] According to a first embodiment of the method, each emitter nucleic acid is bound to a ligand of a cellular target or an organelle target.

[0046] According to this embodiment, the emitter nucleic acid further comprises, 3' to the amplified sequence, a sequence complementary to the nicking site.

[0047] According to a second embodiment of the method, the emitter nucleic acid collection is provided in the form of a group of emitter nucleic acids, wherein all emitter nucleic acids of the group comprise the same identification sequence. According to this embodiment, the emitter nucleic acid does not bind to a ligand of a cellular target or organelle target.

[0048] In particular, the group of emitter nucleic acids can be provided in the form of concatemers of emitter nucleic acids generated by rolling circle replication, wherein each concatemer comprises the same emitter nucleic acid. The group of emitter nucleic acids can also be provided in the form of beads carrying emitter nucleic acids comprising the same identification sequence or beads carrying the same emitter nucleic acid.

[0049] In this second embodiment, the sequence of the emitter nucleic acid then comprises restriction sites or cleavage sites (such as photocleavage, diol bonds, peptide bonds or via modified bases such as uracil, methylation or RNA) in order to release the region of the emitter nucleic acid comprising the amplification sequence, the identification sequence and the capture sequence from the concatemer or bead, especially in the case of restriction sites under the action of restriction enzymes.

[0050] In the context of this method, a second nucleic acid set (" Receptor nucleic acid ”), wherein each receptor nucleic acid is covalently or non-covalently coupled to a ligand of a cellular target or organelle target.

[0051] The acceptor nucleic acid is designed to contain i) an amplification sequence that matches all or part of the amplification sequence of the emitter nucleic acid ensemble, or its complement, or ii) a capture sequence that matches all or part of the capture sequence of the emitter nucleic acid ensemble, or its complement.

[0052] As used herein, the term "matches" means that a sequence is completely identical to another sequence over a stretch of consecutive nucleotides, preferably over at least 8, 10, 12, 14, 16 or more consecutive nucleotides, and also preferably over the total length of the shorter of the two sequences.

[0053] According to some embodiments, the receptor nucleic acid also comprises a restriction site (for endonucleases) or a cleavage site (such as photocleavage, diol bonds, peptide bonds, or via modified bases such as uracil, methylation, or RNA) so that the receptor nucleic acid can release the captured identification sequence at the appropriate time, for example after isolation in a compartment for single-cell barcoding.

[0054] For example, when the emitter nucleic acid comprises or consists of SEQ ID NO: 2, the acceptor nucleic acid may comprise AACACCAAACCCTTCTAAAGCCCAAACCTC (SEQ ID NO: 3, i.e., the capture sequence of the emitter nucleic acid comprising or consisting of the sequence SEQ ID NO: 2) or In SEQ ID NO:4, the nucleotides in bold represent the sequence hybridized with the quencher, the nucleotide stretch in standard letters consists of SEQ ID NO:3, and the underlined nucleotides represent the spacer with biotin.

[0055] The acceptor nucleic acid is generally 10 to 30 nucleotides long, preferably 12 to 25 nucleotides long.

[0056] The receptor nucleic acid is preferably a DNA molecule, and more preferably single-stranded DNA. The receptor nucleic acid can also be double-stranded and partially single-stranded DNA to allow for ligation to the emitted sequence.

[0057] Ligand Bind to a cellular target or organelle target in a biological sample. According to one embodiment, the ligand binds to one or more receptors on the surface or inside of a cell. According to another embodiment, the ligand binds to one or more receptors on the surface or inside of an organelle of a cell. As used herein, organelles include, but are not limited to, mitochondria, chloroplasts, endoplasmic reticulum, flagella, Golgi bodies, nuclei, and vacuoles.

[0058] For example, a target present at the surface or inside a cell or organelle is selected from the group consisting of cell or organelle surface proteins (e.g., CD45, CD3, CD19, CD98, CD298, β2 microglobulin), carbohydrates (e.g., mannose, galactose, N-acetylglucosamine), and components of the lipid bilayer of the cell or organelle.

[0059] Preferably, the ligand is selected from the group consisting of antibodies, aptamers, lectins and peptides.

[0060] According to one embodiment, the cellular target or organelle target to which the ligand binds is a target that is ubiquitously present on the surface or inside all or most cells or cellular organelles in a biological sample (e.g., CD98, CD298, β2 microglobulin, lectin, mannose, galactose, lipid bilayer).

[0061] According to another embodiment, the cellular or organelle target to which the ligand binds is present only inside or on the surface of a subset of cells or organelles in the tissue sample (eg, CD45, CD3, CD19).

[0062] The ligands of the receptor nucleic acid may be all the same or different, preferably all the same.

[0063] The ligands of the emitter nucleic acids may all be identical or different, preferably all are identical.

[0064] In one embodiment, the ligands of the emitter nucleic acid and the receptor nucleic acid are the same.

[0065] According to the method for labeling individual cells or organelles, a collection of emitter nucleic acids and a collection of receptor nucleic acids are contacted with a biological sample in a solution to label individual cells or organelles within the biological sample with at least the receptor nucleic acids.

[0066] In the case of organelle analysis, biological samples (e.g., tissue samples) may need to be permeabilized to allow copies of the nucleic acid to diffuse through the permeabilized cells and reach the organelles. Alternative methods known to those skilled in the art may be used to enable the nucleic acid to reach the organelles, such as the use of beads carrying emitter nucleic acids with a penetrating peptide at one end, or antibodies specific for cell surface receptors that induce receptor-mediated endocytosis when they bind, leading to internalization of the antibody.

[0067] According to a first embodiment of the method, in which each emitter nucleic acid is bound to a ligand of a cellular target or an organelle target, both the receptor nucleic acid and the emitter nucleic acid label cells or organelles of the biological sample.

[0068] In this first embodiment of the method, the generation of the emitted nucleic acid comprising the reverse complement of the amplification sequence, the identification sequence and the capture sequence is carried out by isothermal amplification of the emitter nucleic acid via nicking and polymerization, which is catalyzed by a nicking endonuclease and a polymerase with strand displacement activity. Therefore, step c) of the method also includes adding a nicking endonuclease and a polymerase with strand displacement activity to a solution comprising the emitter nucleic acid set and the receptor nucleic acid set and in contact with the biological sample. The 3' portion of the emitter nucleic acid can be used for polymerization directly by self-priming, or, in order to improve local amplification, can be primed by adding a free oligonucleotide that hybridizes to the 3' portion of the emitter nucleic acid.

[0069] According to a second embodiment of the method, in which the set of emitter nucleic acids is provided in the form of a group of emitter nucleic acids having the same identification sequence, only the receptor nucleic acids label the cells or organelles of the biological sample.

[0070] In this second embodiment, the emitter nucleic acids of the population (concatemer or bead) are cleaved with a restriction endonuclease to release multiple copies of the region of the emitter nucleic acid comprising the amplification sequence, identification sequence and capture sequence ("emitted nucleic acid").

[0071] In both embodiments of the method, the biological sample is typically incubated with an emitter nucleic acid, an acceptor nucleic acid and (i) a nicking endonuclease and a polymerase or (ii) a restriction endonuclease (as appropriate) at between 25° C. and 37° C. for 10 to 60 minutes. The solution contains a buffer compatible with the enzyme activity. In the presence of a cleavage site (such as photocleavage, a diol bond, a peptide bond, or via a modified base such as uracil, methylation or RNA, as described above), the biological sample is typically exposed to UV light, or to a suitable chemical reagent capable of breaking the bond.

[0072] Following contacting / incubation, the biological sample is preferably rinsed.

[0073] In some embodiments, an image of the biological sample is taken by microscopy, optionally fluorescence microscopy, before dissociation. Labeling of the biological sample (such as fluorescent labeling) can be performed before, simultaneously with, or even after labeling with receptor nucleic acids and emitted nucleic acids. In some embodiments, fluorescent probes specific to one or more identification sequences are used to facilitate mapping of the reconstructed network to the real image.

[0074] The image of the biological sample may be taken by microscopy before step d) or before step e) or between step d) and step e).

[0075] The method further comprises dissociating the biological sample and recovering individualized cells or organelles, wherein at least a subpopulation of the individualized cells or organelles is labeled with an emitted nucleic acid comprising an amplification sequence, an identification sequence, and a capture sequence or reverse complements thereof.

[0076] Dissociation of biological samples can be achieved using, for example, collagenase I, DNase I, and hyaluronidase.

[0077] Methods for mapping and sequencing individual cells or organelles

[0078] Individualized cells labeled with the emitted nucleic acid as can be obtained by or by the above-mentioned method for mapping individual cells or organelles can be further used for sequencing. According to one embodiment, the method for mapping and sequencing individual cells or organelles comprises implementing the labeling method of the present invention to provide individualized cells or organelles labeled with the emitted nucleic acid. Individualized cells are thus labeled with (i) nucleic acids comprising an amplification sequence, an identification sequence and a capture sequence or (ii) their reverse complement sequences.

[0079] The method of mapping and sequencing (also) comprises trapping individualized cells labeled with the emitted nucleic acid in a compartment, wherein the compartment comprises compartment-specific nucleic acid and at least one of the following sequences for nucleic acid labeling and further sequencing: a hybridization site, a ligation site, or a recombination site.

[0080] In one embodiment, single cells or single organelles are trapped in compartments.

[0081] The compartment may comprise a plurality of compartment-specific nucleic acids for specifically targeting different nucleic acids. Preferably, the compartment-specific nucleic acid comprises a barcode specific to the compartment. Preferably, the compartment-specific nucleic acid comprised in the compartment is DNA.

[0082] The compartment-specific nucleic acid may comprise, for example, a 3' region of a sequence oligo d(T) or oligo d(T)VN for hybridization to the poly(A) tail of mRNA (for mRNA sequencing), a 3' region of a sequence complementary to a sequence of a specific RNA (for targeted RNA sequencing) or DNA (for targeted DNA sequencing), or a 3' region of a random sequence such as d(N)6 (for RNA sequencing or DNA sequencing). More specifically, it is a constant region of a primer containing a compartment-specific sequence that hybridizes to nucleic acids released by captured cells or organelles.

[0083] In one embodiment, the compartment-specific nucleic acid comprises a primer sequence that is complementary to all or part of an amplification sequence or a capture sequence present in a nucleic acid comprising the amplification sequence, identification sequence, and capture sequence, or a reverse complement thereof.

[0084] As used herein, the term "compartment" refers to, for example, a droplet, a hydrogel matrix, a microfabricated chamber separated by a pneumatic valve, a microfabricated chamber made with an actuatable hydrogel, a microfabricated well, an actuatable hydrogel cage, or a microplate well.

[0085] According to one embodiment, the compartments are wells of a microplate, wherein each well comprises a plurality of oligonucleotides comprising a compartment-specific sequence specific for the well, and individualized cells labeled with a nucleic acid comprising an identification sequence are captured in the well.

[0086] According to another embodiment, the compartment is a microfabricated chamber made of an actuatable hydrogel. In this embodiment of a microfabricated chamber made of an actuatable hydrogel, the compartment is preferably a compartment of a microfluidic device as defined in the "Microfluidic Device" section below.

[0087] According to one embodiment, the compartment comprises or consists of a hydrogel matrix, and the labeled individualized cells or organelles are embedded in the hydrogel matrix to form discrete biological units. According to this embodiment, the labeled individualized cells or organelles are contacted with a plurality of barcode units to form a biological unit / barcode unit complex, and the biological unit / barcode unit complex is contacted with a hydrogel solution, and then the hydrogel solution is polymerized to embed the biological unit / barcode unit complex in a hydrogel matrix, wherein each of the biological unit / barcode unit complexes in the biological unit / barcode unit complex contains a unique barcode. A hydrogel suitable for forming a hydrogel matrix is ​​described in International Patent Application WO2018203141, which is incorporated herein in its entirety. The hydrogel is particularly a thermosensitive or thermoreversible hydrogel, i.e., a hydrogel that depolymerizes if it is raised above the melting point of the polymer contained in the hydrogel after formation.

[0088] According to one embodiment, after capturing individualized cells or organelles, and prior to their subsequent lysis, the method comprises analyzing the captured cells, organelles and / or their secreted molecules using optical detection, such as by imaging (including fluorescence imaging) or fluorescence detection.

[0089] The method then comprises lysing the captured cells, or cells and organelles, thereby releasing nucleic acids from the cells or organelles in the compartment. Lysis can be performed by any suitable method known to those skilled in the art. For example, a solution of low saline, SDS or Triton X-100 is injected into the compartment to lyse the cells and / or organelles by osmotic shock.

[0090] The method further comprises associating i) the compartment-specific nucleic acid with ii) the nucleic acid released from the cell or organelle in the compartment. In particular, the association is performed by any of the following:

[0091] i) hybridizing the compartment-specific nucleic acid to the nucleic acid released from the cell or organelle by complementarity;

[0092] ii) hybridizing the compartment-specific nucleic acid to nucleic acid released from the cell or organelle by complementarity and extending the compartment-specific nucleic acid hybridized to the released nucleic acid using a DNA polymerase to produce a complementary strand of the released nucleic acid having an associated compartment-specific sequence;

[0093] iii) hybridizing the compartment-specific nucleic acid to the 3' end of a cDNA produced by reverse transcription of RNA from a cell or an organelle by complementarity, and extending the cDNA hybridized to the compartment-specific nucleic acid using a DNA polymerase to generate a complementary strand of the compartment-specific nucleic acid having an associated compartment-specific sequence;

[0094] iv) ligating said compartment-specific nucleic acid to said DNA present in said compartment; or

[0095] v) Recombining the compartment-specific nucleic acid with the DNA present in the compartment

[0096] The compartment-specific sequence and / or nucleic acid released from cells or organelles further associate with the nucleic acid of the emission comprising amplification sequence, identification sequence and capture sequence or their reverse complementary sequence.For this reason, compartment-specific nucleic acid can be designed to comprise primer sequences complementary to all or part of amplification sequence or capture sequence present in the nucleic acid of the emission comprising amplification sequence, identification sequence and capture sequence or its reverse complementary nucleic acid.Then the method additionally comprises that compartment-specific nucleic acid is hybridized to all or part of amplification sequence or capture sequence present in the nucleic acid of emission, and one or two hybridized DNA chains are extended using DNA polymerase, to produce a DNA molecule comprising identification sequence or its reverse complementary sequence and compartment-specific sequence or its complementary sequence.Alternatively, instead of hybridization and extension steps, the method additionally comprises that compartment-specific nucleic acid is connected to all or part of amplification sequence or capture sequence present in the nucleic acid of emission, or compartment-specific nucleic acid is recombined with all or part of amplification sequence or capture sequence present in the emission nucleic acid.

[0097] Nucleic acids resulting from the association of i) compartment-specific nucleic acids with ii) nucleic acids released from the cell or organelle in the compartment and (iii) the emitted nucleic acids are then recovered and sequenced.

[0098] Nucleic acids containing the same compartment-specific sequence are defined or identified as originating from the same compartment (i.e., if a single cell or single organelle is captured in a compartment, it is derived from the same single cell or organelle). The mapping of the position of the single cell or organelle initially in / on the biological sample is based on the identification sequence or its reverse complement contained in the nucleic acid thus produced, thereby combining the mapping and sequencing information of each cell of the biological sample. In practice, the mapping of the position of a single cell or organelle (or a plurality of cells or organelles contained in a single compartment) initially on the biological sample is performed by determining the relative proportion of the same identification sequence or its reverse complement contained in the nucleic acid produced in step e) to estimate the distance between cells according to the principle of triangulation.

[0099] The sequencing information can be mapped back onto images from microscopy taken of the biological sample prior to dissociation.

[0100] Microfluidic devices

[0101] In this embodiment, the compartment is a compartment of a microfluidic device comprising:

[0102] - a first wall (12), the first wall comprising a first substrate (14), a plurality of closed patterns (16) being grafted onto the first substrate,

[0103] - a second wall (18) facing the first wall (12) and comprising a second base plate (20),

[0104] - a plurality of nucleic acids (22), the plurality of nucleic acids being grafted onto the first substrate (14) or onto the second substrate (20), each nucleic acid (22) comprising a barcode encoding the position of the nucleic acid on the first substrate (14) or the second substrate (20),

[0105] At least the plurality of closed patterns (16) or the second substrate (20) is made of an actuable hydrogel, the actuable hydrogel being capable of swelling between a contracted state and a swollen state, in which the closed patterns (16) and the second substrate (20) are in a state of being swellable.

[0106] touch.

[0107] In the swollen state, the closed pattern is in contact with the second substrate of the device.The device thus comprises a plurality of cages, each cage being defined by side walls made of the closed pattern and end walls constituted by the first and second substrates.

[0108] In the contracted state, the closed pattern and the second substrate are no longer in contact. The gap between the closed pattern and the second substrate allows fluids and cells to circulate freely inside the device.

[0109] Between the contracted state and the swollen state, the device according to the present invention undergoes a plurality of intermediate states in which the actuatable hydrogel is only partially swollen. In these configurations, a gap between the closed pattern and the second substrate still exists. However, the height of the gap is sufficiently reduced relative to the contracted state so that cells trapped in the cage are retained in the cage. These intermediate configurations are generally useful for allowing the selective passage of fluids other than cells.

[0110] Thus, each closed pattern defines a cell trapping site, wherein closing and opening are triggered by an external stimulus. In a preferred embodiment, the external stimulus is a change in pH, light intensity, temperature or current intensity. In a very preferred embodiment, the external stimulus is a change in temperature.

[0111] The microfluidic device comprises at least 2 closed patterns. Preferably, the microfluidic device comprises a large number of closed patterns, typically 100, 1,000, 10,000, 100,000...

[0112] The first wall and the second wall are made of a rigid material capable of resisting temperature fluctuations ranging from -20°C to 100°C. According to a first embodiment, the walls (first and / or second wall) are made of a unique and homogeneous material. The walls thus consist of a base plate.

[0113] According to a second embodiment, the wall also comprises a support material on which the substrate is fixed / coated. Typically, the wall consists of a support material made of glass or polydimethylsiloxane, covered with a substrate layer.

[0114] A microfluidic device may equivalently include two single-layer walls, two multi-layer walls, or one single-layer wall and one multi-layer wall.

[0115] The first substrate is typically made of a material selected from the group consisting of silicon, quartz, glass, polydimethylsiloxane, thermoplastics such as cyclic olefin copolymers and polycarbonates, preferably glass and polydimethylsiloxane. Preferably, the first substrate is made of polydimethylsiloxane.

[0116] According to one embodiment, at least a portion of the surface of the first substrate is structured and / or functionalized.

[0117] By "structured" it is meant that the surface of the substrate is irregular. The surface of the substrate may be porous or microstructured. In particular, it may include microscopic stripes, columns, etc.

[0118] The structuring of the substrate can be carried out according to any known method. For example, standard soft lithography techniques may be mentioned, which are well documented.

[0119] The so-called "functionalization" means fixing chemical functional groups on the surface of the substrate. Generally, the surface of the first substrate is functionalized with chemical groups selected from hydroxide groups, silanol groups and mixtures thereof (preferably silanol groups).

[0120] Structuring and / or functionalization of the substrate allows facilitating the enclosed pattern and / or the grafting of nucleic acids on its surface.

[0121] According to a preferred embodiment, the first wall is made of a structured and / or functionalized polydimethylsiloxane-based sheet, preferably of a structured and functionalized polydimethylsiloxane-based sheet.

[0122] The closed pattern can have a variety of shapes. Preferably, the closed pattern is rectangular, square, circular or hexagonal.

[0123] Preferably, the closed pattern is covalently grafted to the first substrate.

[0124] According to a specific embodiment, the second substrate is made of a hydrogel and the closed pattern is made of a non-swelling material. Preferably, according to this specific embodiment, the second wall comprises a non-swelling support material on which a swellable hydrogel is deposited. The non-swelling support material can be structured and / or functionalized. The structuring and / or functionalization of the non-swelling material is carried out in a similar manner as described above in the context of the first substrate. Therefore, according to this embodiment, the closed pattern is non-swelling, and it is the swelling of the second substrate that allows the closure of the cage.

[0125] Preferably, according to this embodiment, the closed pattern is made of a material selected from the group consisting of silicon, quartz, glass, polydimethylsiloxane, thermoplastic materials such as cyclic olefin copolymers and polycarbonates, preferably glass or polydimethylsiloxane.

[0126] Preferably, the height of the closed pattern ranges from 0.1 μm to 100 μm, preferably from 1 μm to 30 μm.

[0127] Preferably, the thickness of the walls of the closed pattern ranges from 0.1 μm to 500 μm, preferably from 1 μm to 20 μm.

[0128] Advantageously, according to this embodiment, the thickness of the second substrate measured in a swollen state in contact with the closed pattern ranges from 1 μm to 500 μm, preferably from 1 μm to 100 μm.

[0129] Advantageously, still according to this embodiment, the thickness of the second substrate comprising the hydrogel, measured in the dry state, ranges from 0.5 μm to 150 μm, preferably from 0.5 μm to 50 μm.

[0130] According to a preferred embodiment, the closed pattern is made of hydrogel and the second substrate is made of a non-swelling material. Thus, according to this embodiment, the second substrate is non-swelling and the closed pattern swells to close the cage.

[0131] Preferably, according to this preferred embodiment, the second substrate is made of a material selected from the group consisting of silicon, quartz, glass, polydimethylsiloxane, thermoplastics (such as cycloolefin copolymers and polycarbonates), preferably glass or polydimethylsiloxane. Advantageously, when the hydrogel pattern is in contact with the second wall, the height of the hydrogel pattern measured in the swollen state ranges from 0.1 μm to 500 μm, preferably from 1 μm to 250 μm, more preferably from 1 μm to 100 μm.

[0132] Advantageously, the height of the hydrogel pattern measured in the dry state ranges from 0.1 μm to 150 μm, preferably from 0.5 μm to 100 μm, more preferably from 0.5 μm to 50 μm.

[0133] Preferably, when the hydrogel pattern is in contact with the second wall, the separation of the walls of the hydrogel pattern measured in a swollen state ranges from 0.1 μm to 100 μm, preferably from 1 μm to 10 μm.

[0134] Preferably, the separation of the walls of the hydrogel pattern measured in the dry state ranges from 0.1 μm to 100 μm, preferably from 0.5 μm to 5 μm.

[0135] By "hydrogel" in this context is meant a gel comprising a polymer matrix forming a three-dimensional network that is capable of swelling in the presence of water under specific physicochemical conditions. Swelling of the hydrogel can be triggered, for example, by thermal, optical, chemical or electrical stimulation.

[0136] For example, swelling (or contraction) of a hydrogel can be triggered by changes in the temperature, pressure, or pH of the medium in which it is placed.

[0137] Preferably, the hydrogel is a temperature-responsive swellable hydrogel. In the context of the present invention, "temperature-responsive swellable hydrogel" refers to a hydrogel that is induced to swell or contract by changing the temperature. Temperature-responsive swellable hydrogels generally exhibit a sharp change in water solubility with temperature.

[0138] Within a specific temperature range, hydrogels are water-soluble and absorb large amounts of water.

[0139] Conversely, by changing the temperature of the medium, the hydrogel becomes no longer water-soluble. The hydrogel then releases water and contracts.

[0140] In the context of the present invention, by "swollen state" is meant a state of the hydrogel wherein the closed pattern is in contact with the second substrate such that the device comprises a plurality of hermetically sealed cages.

[0141] In the context of the present invention, the so-called "contracted state" refers to a state of the hydrogel in which the closed pattern and the second substrate are not in contact: there is a gap between the closed pattern and the second substrate and fluids and cells are allowed to circulate freely inside the microfluidic device. The "contracted state" is different from the "dry state" defined below in that the hydrogel is not completely free of water. In the contracted state, the hydrogel is still at least partially hydrated.

[0142] In the context of the present invention, the so-called "dry state" refers to a state in which the hydrogel is almost completely free of water. Typically, during the manufacture of microfluidic devices, especially during the grafting of hydrogel patterns during coating of the second wall with a hydrogel substrate, the hydrogel is in a dry state.

[0143] The temperature at which the water solubility properties of a hydrogel change dramatically is designated as the critical solution temperature (CST).

[0144] Preferably, the critical solution temperature (CST) of the hydrogel ranges from 4°C to 98°C, more preferably from 20°C to 50°C, even more preferably from 25°C to 40°C.

[0145] According to a first variant, the critical solution temperature (CST) of the hydrogel is the lower critical solution temperature (LCST).At temperatures above the LSCT, the hydrogel is in a contracted state, whereas at temperatures below the LCST, the hydrogel is in a swollen state.

[0146] According to a second variant, the critical solution temperature (CST) of the hydrogel is the upper critical solution temperature (UCST). At temperatures above the UCST, the hydrogel is in a swollen state, and at temperatures below the USCT, the hydrogel is in a contracted state.

[0147] The polymer constituting the polymer matrix of the hydrogel is generally selected from homopolymers, copolymers and terpolymers of acrylic acid, alkyl (meth) acrylates, alkyl (meth) acrylamides, oligoethylene (meth) acrylates, sulfobetaine (meth) acrylates and N-acryloyl glycinamide, preferably selected from homopolymers, copolymers and terpolymers of alkyl (meth) acrylamides and any mixtures thereof, more preferably the hydrogel comprises poly (N-isopropyl acrylamide).

[0148] The polymer may be selected from LCST polymers, UCST polymers and mixtures thereof.

[0149] Similar to what was said above in the context of hydrogels:

[0150] - the expression "LCST polymer" means a thermoresponsive polymer having a lower critical solution temperature, and

[0151] - The expression "UCST polymer" denotes a thermoresponsive polymer having an upper critical solution temperature.

[0152] The overall behavior of the hydrogel (UCST and / or LCST behavior) depends on the nature and amount of the different polymers present in the hydrogel.

[0153] When the polymer is selected from UCST polymers, it is preferably selected from homopolymers, copolymers and terpolymers of acrylic acid, alkyl (meth)acrylates, alkyl (meth)acrylamides, oligoethylene (meth)acrylates, sulfobetaine (meth)acrylates, N-acryloylglycinamide and mixtures thereof.

[0154] Preferably, the UCST polymer is a terpolymer of methacrylamide, acrylamide and allyl methacrylate.

[0155] When the polymer is selected from LCST polymers, it is preferably selected from homopolymers, copolymers and terpolymers of acrylic acid, alkyl (meth)acrylates, alkyl (meth)acrylamides, oligomeric polyethylene (meth)acrylates and mixtures thereof, more preferably selected from homopolymers, copolymers and terpolymers of alkyl (meth)acrylamides, even more preferably the LCST polymer is poly (N-isopropylacrylamide).

[0156] Preferably, the LCST polymer is poly(N-isopropylacrylamide).

[0157] Advantageously, the polymer comprises, preferably consists of, one or several UCST or LCST polymers.

[0158] Advantageously, the microfluidic device further comprises at least one inlet (24) and at least one outlet (26) to allow reactants to be introduced into and removed from the device, respectively.

[0159] Preferably, the heating device is integrated in the device according to the invention.

[0160] According to one embodiment, each cage comprises independent heating means. This embodiment is particularly advantageous because it allows each cage to be opened and closed independently.

[0161] For example, the local heating means may consist of nanoparticles which heat up when irradiated with light (plasmonic effect). The nanoparticles may, for example, be deposited between the hydrogel and the wall coating the hydrogel, or dispersed in the polymer matrix of the hydrogel. Preferably, the nanoparticles are selected from metal nanoparticles and plasmonic nanoparticles, preferably comprising gold, graphene, silver, copper and titanium nitride.

[0162] In another example, localized heating is performed using micro-resistors; for example, micro-resistors comprising a chromium / gold bilayer or a TiO2 structure.

[0163] The microfluidic device further comprises a plurality of compartment-specific nucleic acids grafted on the first substrate or on the second substrate, wherein each nucleic acid comprises a sequence barcode encoding a position of the nucleic acid on the first substrate or the second substrate.

[0164] Advantageously, the nucleic acids are grafted to be positioned within the cages when the hydrogel is in a swollen state.

[0165] More advantageously, the nucleic acid is grafted on the first substrate inside the closed pattern or on the second substrate opposite to the closed pattern.

[0166] Preferably, when the closed pattern is made of hydrogel, the nucleic acid is grafted onto the surface of the second substrate. Preferably, when the second substrate is made of hydrogel, the nucleic acid is grafted onto the surface of the first substrate.

[0167] The grafted nucleic acid is RNA or DNA, preferably DNA. The grafted nucleic acid can be single-stranded, double-stranded or partially double-stranded.

[0168] The grafted nucleic acid is preferably 60 to 100 nucleotides in length.

[0169] The grafted nucleic acid can be attached to the substrate at the 3' end or the 5' end directly or through a linker.

[0170] According to one embodiment, the grafted nucleic acids sharing the same barcode have multiple sequences. According to another embodiment, the grafted nucleic acids sharing the same barcode have the same sequence.

[0171] According to one embodiment, all or part of the grafted nucleic acid hybridizes with another nucleic acid or nucleic acids and forms a partially or completely double-stranded DNA, double-stranded DNA / RNA or double-stranded RNA.

[0172] According to one embodiment, the grafted nucleic acid comprises one or any combination of the following sequences:

[0173] 1) restriction sites or photocleavage sites for nucleic acid release,

[0174] 2) sequences complementary to amplification primers used for further amplification,

[0175] 3) T7 RNA polymerase promoter sequence for further in vitro transcription (IVT),

[0176] 4) a hybridization site for nucleic acid labeling, a ligation site for nucleic acid labeling, or a recombination site for nucleic acid labeling, and

[0177] 5) A sequence of random nucleotide residues that functions as a unique molecular identifier (UMI).

[0178] Preferably, the grafted nucleic acid comprises at least i) a sequence barcode encoding the position of the nucleic acid on the first substrate or the second substrate, and ii) a restriction site or a photocleavage site, and optionally further comprises iii) a primer sequence, and / or a T7 sequence and / or a hybridization, ligation or recombination site.

[0179] According to one embodiment, the grafted nucleic acid of the microfluidic device comprises a constant sequence, i.e., a sequence present in all grafted nucleic acids. The grafted nucleic acid of the microfluidic device can hybridize with a DNA comprising a sequence complementary to all or part of the constant sequence of the grafted nucleic acid. One or more different DNAs comprising a sequence complementary to all or part of the constant sequence can hybridize with the grafted nucleic acid.

[0180] The microfluidic device may also include a structure capable of trapping cells or organelles. Such structures are typically selected from publications such as: Vigneswaran N. et al., 2017, Microfluidic hydrodynamic trapping for single cell analysis: mechanisms, methods and applications, Anal. Methods, 9, 3751-3772.

[0181] Preferably, the structure capable of capturing cells or organelles is located on a first substrate inside the closed pattern or on a second substrate opposite the closed pattern.

[0182] Preferably, each cage comprises at least one structure capable of trapping a cell or organelle.

[0183] According to a particular embodiment, a plurality of ligands are grafted directly or indirectly, covalently or non-covalently, on the first substrate (14) and / or on the second substrate (20), opposite the closed pattern.

[0184] Advantageously, the nucleic acid is grafted to be positioned within the cage when the ligand is in a swollen state.

[0185] In particular, when grafted onto the first substrate (14), the ligands are typically grafted within a closed pattern (16).

[0186] Alternatively, when grafted on the second substrate (20), the ligand faces the closed pattern.

[0187] The ligands may all be grafted onto the same substrate. Alternatively, some of the ligands are grafted onto the first substrate (14) and other ligands are grafted onto the second substrate (20).

[0188] Preferably, when directly grafted onto the first substrate (14) or the second substrate (20), a plurality of ligands are covalently grafted onto the first substrate (14) or the second substrate (20).

[0189] According to a more specific embodiment, the plurality of ligands are indirectly grafted: the plurality of ligands are grafted onto an intermediate structure, which is directly grafted onto the first substrate (14) or the second substrate (20). Thus, according to this specific embodiment, there is no direct bonding between the plurality of ligands and the substrates (14, 20).

[0190] Preferably, when indirectly grafted onto the first substrate (14) or the second substrate (20), the plurality of ligands are non-covalently grafted onto the first substrate (14) or the second substrate (20).

[0191] According to a first embodiment, a plurality of ligands are conjugated to the nucleic acid and associate with at least a portion of the grafted nucleic acid by hybridization (22).

[0192] According to another example, a plurality of ligands are non-covalently grafted onto an adhesive coating previously coated on the first substrate (14) or the second substrate (20). As an adhesive coating, mention may be made in particular of a streptavidin coating.

[0193] In these embodiments, preferably each ligand is independently selected from the group consisting of an antibody, an antibody fragment, a lectin and an aptamer.

[0194] The ligands are typically selected to bind one or more analytes that are secreted or released by lysis of cells or organelles that are trapped in a cage formed by a first wall (14) and a second wall (20) of the microfluidic device (10), and an enclosed pattern (16) of a hydrogel in a swollen state.

[0195] The microfluidic device can be manufactured by a method comprising the following steps:

[0196] 1) providing a first substrate,

[0197] 2) grafting a plurality of closed patterns on the surface of the first substrate,

[0198] 3) providing a second substrate,

[0199] 4) grafting a plurality of nucleic acids on the surface of the first substrate or on the surface of the second substrate, wherein each nucleic acid comprises a barcode encoding the position of the nucleic acid on the first substrate or the second substrate;

[0200] 5) positioning the first substrate and the second substrate by placing a closed pattern and nucleic acid between the first substrate and the second substrate,

[0201] 6) Bonding the first substrate and the second substrate.

[0202] The closed pattern grafting can be carried out according to any known method.

[0203] When the closed pattern is made of a non-swelling material, the grafting of the closed pattern is usually performed by soft lithography.

[0204] According to one particular embodiment, the first substrate and the closed pattern are prepared together in one and only one step.

[0205] When the closed pattern is made of a hydrogel, the grafting of the closed pattern is usually carried out by photopatterning, preferably under UV radiation. The photopatterning method consists in the surface grafting of the polymer matrix of the hydrogel on the first substrate and simultaneously by crosslinking the polymer matrix of the hydrogel.

[0206] Preferably, the polymers are covalently cross-linked.

[0207] More preferably, cross-linking of the polymer is performed in the presence of a cross-linking agent selected from dithiol molecules, such as dithioerythritol.

[0208] Patterning of hydrogels is typically performed by standard photolithographic techniques or using direct laser writing equipment.

[0209] These techniques are disclosed in particular in the following literature: Chollet, B., D'Eramo, L., Martwong, E., Li, M., Macron, J., Mai, TQ, Tabeling, P. and Tran, Y., 2016. Tailoring patterns of surface-attached multiresponsive polymer networks. ACS applied materials & interfaces, 8(37), pp. 24870-24879.

[0210] Nucleic acid grafting is usually performed by site-directed or in situ light-guided synthesis, which is described in detail in the following literature: DeRisi, J. et al. Use of a cDNA microarray to analyse gene expression. Nat. Genet 14, 457-460 (1996); and Fodor, SP et al. Light-directed, spatially addressable parallel chemical synthesis. Science (80-.). 251, 767-773 (1991).

[0211] Advantageously, during step 5), when the hydrogel is in the swollen state, the first substrate and the second substrate are positioned in a manner that allows the nucleic acid to be located inside the cage.

[0212] More advantageously, the nucleic acid is grafted on the first substrate inside the closed pattern or on the second substrate opposite to the closed pattern.

[0213] The bonding step can be performed according to any known method.

[0214] According to a first embodiment, the bonding step is performed by oxygen plasma treatment. Preferably, the oxygen plasma treatment is performed at room temperature, typically at a temperature ranging from 5°C to 50°C, more preferably from 10°C to 40°C, even more preferably from 15°C to 30°C. Preferably, the duration of the oxygen plasma treatment ranges from 10 seconds to 2 minutes, more preferably from 30 seconds to 1 minute.

[0215] Preferably, according to this first embodiment, the method further comprises, before step 6), a preparatory step of depositing a mask on the nucleic acid, which mask is capable of protecting the nucleic acid during exposure to the oxygen plasma. The mask is usually made of an adhesive tape, preferably a material selected from a plastic film, paper, cloth, foam or foil coated with an adhesive. After the plasma treatment, the mask is finally removed, usually by stripping.

[0216] According to a second embodiment, the bonding step is performed by applying pressure on the surface of the device. Preferably, according to this embodiment, the pressure on the surface of the device is performed by applying negative pressure into the external microfluidic channels surrounding the main design.

[0217] According to a third embodiment, the bonding step is carried out by using a crosslinkable composition comprising at least one polymer and optionally at least one crosslinking agent. According to this third embodiment, the bonding step is carried out as follows:

[0218] a) connecting the first wall and the second wall together,

[0219] b) depositing a layer of a composition comprising at least one polymer and at least one cross-linking agent between the two walls to fill the gap between the first wall and the second wall, and

[0220] c) crosslinking, preferably self-crosslinking, of at least one polymer.

[0221] Preferably, the polymer is selected from polyepoxides.

[0222] The method may further include:

[0223] - between step 1) and step 2), an intermediate step of structuring and / or functionalizing the surface of the first substrate, and / or

[0224] - Between step 3) and step 4), an intermediate step of structuring and / or functionalizing the surface of the second substrate.

[0225] When the substrate is made of a hydrogel, the functionalization of the substrate can generally be carried out following the protocol described in the following literature: Chollet, B. D'eramo, L., Martwong, E., Li, M., Macron, J., Mai, TQ, Tabeling, P. and Tran, Y., 2016. Tailoring patterns of surface-attached multiresponsive polymer networks. ACS applied materials & interfaces, 8(37), pp. 24870-24879.

[0226] If the structure is not made of a hydrogel, functionalization can generally be performed following the protocols detailed in Beal, John HL et al. "A rapid, inexpensive surface treatment for enhanced functionality of polydimethylsiloxane microfluidic channels." Biomicrofluidics Vol. 6, 3 36503. Jul. 30, 2012.

[0227] When the substrate is made of a hydrogel, the structuring of the substrate can generally be carried out following the protocol described in the following literature: Chollet, B. D'eramo, L., Martwong, E., Li, M., Macron, J., Mai, TQ, Tabeling, P. and Tran, Y., 2016. Tailoring patterns of surface-attached multiresponsive polymer networks. ACS applied materials & interfaces, 8(37), pp. 24870-24879.

[0228] When the substrate is made of a non-swelling material, the structuring of the substrate can generally be carried out following standard lithography protocols, in particular standard photolithography protocols.

[0229] According to a particular embodiment, the method may also comprise an additional step, before depositing the hydrogel material, consisting of depositing a layer of nanoparticles, preferably a patterned chromium / gold bilayer, on the surface of the substrate.

[0230] Deposition of the patterned layer may be performed, for example, by standard photolithographic techniques.

[0231] According to a particular embodiment, the method further comprises at least one of the following steps:

[0232] a) (directly) grafting a plurality of ligands on the surface of the first substrate (14) and / or on the surface of the second substrate (20), and / or

[0233] b) (indirectly) grafting a plurality of ligands on the surface of the first substrate (14) and / or on the surface of the second substrate (20).

[0234] The above step a) can be performed at any time during the manufacturing method defined above. In particular, step a) can be performed before or after the grafting of the closed pattern (16), before or after the grafting of the nucleic acid (22).

[0235] According to a first embodiment, indirect grafting of ligands is performed by associating a plurality of ligands with a plurality of grafted nucleic acids (22) by hybridization, the plurality of ligands being conjugated to nucleic acids complementary to at least a portion of the grafted nucleic acids (22).

[0236] According to this first embodiment, step b) is preferably performed after the grafting of the nucleic acid (22). Step b) can be performed until the conditions are changed to actuate the hydrogel to a swollen state, thereby trapping the cells or organelles in the cage formed by the first wall (14) and the second wall (20) of the microfluidic device (10), and in the closed pattern (16) of the hydrogel in the swollen state.

[0237] According to a second embodiment, the indirect grafting of the ligand comprises i) applying an adhesion coating on at least part of the surface of the first substrate (14) and / or the second substrate (20), and ii) grafting the ligand onto the adhesion coating.

[0238] Step i) can be performed before or after the grafting of the closing pattern (16), before or after the grafting of the nucleic acid (22).

[0239] Step ii) is preferably performed after deposition of the adhesive coating. Step ii) may be performed until conditions are changed to actuate the hydrogel to a swollen state, thereby trapping cells or organelles in a cage formed by the first wall (14) and the second wall (20) of the microfluidic device (10), and in the closed pattern (16) of the hydrogel in the swollen state.

[0240] The method for manufacturing a microfluidic device may further comprise one or more of the following steps:

[0241] 1) hybridizing a DNA comprising a sequence complementary to all or part of a constant sequence present in the grafted nucleic acid, in particular present in all or part of the grafted nucleic acid; in particular, one or more different DNAs comprising a sequence complementary to all or part of the constant sequence can be used;

[0242] 2) extending the hybridized DNA by polymerization (e.g., using Maxima, SuperScript RT, Phusion, or Q5 polymerase);

[0243] 3) connecting the grafted nucleic acid, in particular the grafted DNA, to one or another DNA sequence; and / or

[0244] 4) releasing all or part of the grafted nucleic acid from the surface of the first substrate or the second substrate by cleavage (eg by photocleavage or cleavage catalyzed by an endonuclease), which grafted nucleic acid may have been previously modified by hybridization, extension or ligation according to 1), 2) or 3).

[0245] In some embodiments, the hybridized DNA and the grafted nucleic acid together form a double-stranded DNA containing a restriction site for an endonuclease.

[0246] The method may also comprise the further step of immobilizing a structure capable of capturing cells or organelles.

[0247] This additional step is usually achieved by standard photolithography techniques.

[0248] The microfluidic devices of the present invention can be used in methods for sequencing cells or organelles, with the possibility of combining phenotypic information from optical imaging with omics information for single cells or organelles (or for, for example, two or more cells interacting), and this for thousands or tens of thousands of cells simultaneously.

[0249] Methods for performing cell or organelle analysis include:

[0250] a) providing a microfluidic device and a preparation of cells or organelles labeled with an emitted nucleic acid comprising an identification sequence (or its reverse complement) as can be obtained by or by the method of the invention for mapping individual cells or organelles;

[0251] b) optionally, associating all or part of the cells or organelles labeled with the emitted nucleic acid comprising the identification sequence (or its complement) in a compartment with a common marker nucleic acid sequence or with a plurality of different marker nucleic acid sequences;

[0252] c) injecting cells or organelles labeled with an emitted nucleic acid containing an identification sequence in the form of a suspension into a microfluidic device while the hydrogel is in a contracted state;

[0253] d) changing the conditions to actuate the hydrogel to a swollen state, thereby trapping cells or organelles in a cage formed by the first and second walls of the microfluidic device and the enclosed pattern of the hydrogel in the swollen state;

[0254] e) optionally analyzing the captured cells or organelles and / or their secreted molecules using optical imaging;

[0255] f) releasing the grafted nucleic acid from the surface of the first substrate or the second substrate of the microfluidic device, optionally in the cage;

[0256] g) optionally, lysing the trapped cells or organelles, thereby releasing the cellular or organelle nucleic acids in the cage;

[0257] h) associating the barcode of the compartment-specific nucleic acid with the released cellular or organelle nucleic acid and / or the emitted nucleic acid sequence, thereby forming a barcoded nucleic acid;

[0258] i) changing the conditions to actuate the hydrogel into the contracted state;

[0259] j) if not released in f), releasing the grafted nucleic acid from the first substrate or the second substrate of the microfluidic device;

[0260] k) recovering and sequencing the barcoded nucleic acid; and

[0261] l) Optionally mapping the barcoded sequencing data onto the data from optical imaging obtained in e).

[0262] According to one embodiment of the method, step b) and step e) are performed. In some aspects, step b) further comprises labeling the cells with a fluorescent marker, which is analyzed in step e).

[0263] In step c), the injection of cells or organelles labeled with an emitted nucleic acid containing an identification sequence (or its complementary sequence) in the form of a suspension into a microfluidic device under the condition that the hydrogel is in a contracted state is generally performed by setting the temperature, pressure or pH - depending on the properties of the actuable hydrogel - so that the hydrogel is in a contracted state. For example, if the microfluidic device contains a lower critical solution temperature (LCST) temperature-responsive hydrogel, the temperature of the microfluidic device is increased to above the lower critical solution temperature (LCST) to shrink the hydrogel. For temperature-responsive hydrogels containing or consisting of poly (N-isopropylacrylamide) (PNIPAM), the hydrogel fully expands at ≤28°C, fully shrinks at ≥36°C, and partially expands between these temperatures, allowing the cage to be fully opened at 37°C for cell or organelle loading (D'Eramo et al., Microsystems & Nanoengineering (2018) 4, 17069). For example, if the microfluidic device comprises an upper critical solution temperature (UCST) temperature-responsive hydrogel, the temperature of the microfluidic device is lowered below the upper critical solution temperature (UCST) to shrink the hydrogel. For a temperature-responsive hydrogel comprising or consisting of P(MA-AM-AMA), the hydrogel is completely shrunk at ≤10°C, completely expanded at ≥50°C, and partially expanded between these temperatures, allowing the cage to be fully opened at 10°C for cell or organelle loading. According to one embodiment, in step d), a single cell or a single organelle is trapped in a cage. According to another embodiment, two (or more) interacting cells are trapped in a cage, such as plasma cells and reporter cells; cytotoxic T cells (or CART cells) and target cells (e.g., tumor cells); T cells and antigen presenting cells.

[0264] In order to actuate the hydrogel to a swollen state, the temperature, pressure or pH is changed according to the properties of the actuable hydrogel so that the hydrogel swells and contacts the second substrate. For example, if the microfluidic device comprises a lower critical solution temperature (LCST) temperature-responsive hydrogel, the temperature of the microfluidic device is lowered to below the lower critical solution temperature (LCST) to swell the hydrogel. For temperature-responsive hydrogels comprising poly(N-isopropylacrylamide) (PNIPAM) or consisting thereof, the temperature can typically be set to ≤28°C, where the hydrogel is fully expanded (D'Eramo et al., Microsystems & Nanoengineering (2018) 4, 17069). For example, if the microfluidic device comprises an upper critical solution temperature (UCST) temperature-responsive hydrogel, the temperature of the microfluidic device is raised to above the upper critical solution temperature (UCST) to swell the hydrogel. For temperature-responsive hydrogels comprising or consisting of P(MA-AM-AMA), the hydrogel is fully expanded at ≥50°C.

[0265] The method may further comprise changing the surrounding conditions of the cell or organelle between step d) and step h). Changing the surrounding conditions comprises circulating an aqueous phase containing, for example, salts, detergents, proteins and / or nucleic acid sequences in the microfluidic device. Changing the surrounding conditions comprises exchanging molecules (such as salts) that pass through the hydrogel enclosing the cage by fully opening the cage (in the case where the cage also comprises a structure capable of capturing the cell or organelle) or partially opening the cage.

[0266] According to one embodiment, the method further comprises the following steps, for example after step e) and before step f), but not necessarily:

[0267] e1) binding one or more analytes secreted or released by the captured cells or organelles to ligands directly or indirectly grafted onto the surface of the first substrate (14) and / or onto the surface of the second substrate (20);

[0268] e2) detecting the analyte(s) bound to the grafted ligand by binding to a labeled secondary ligand or labeled ligand specific for the bound analyte(s).

[0269] According to a first embodiment, in step e2, detection is performed directly with one or more secondary ligands that are fluorescently labeled.

[0270] According to a second embodiment, in step e2, detection is carried out indirectly using one or more second ligands labeled by a ligand identification nucleic acid, which is specific for one or more analytes bound to the grafted ligand, wherein the sequence of the ligand identification nucleic acid allows identification of the ligand and the one or more analytes bound to the grafted ligand.

[0271] According to this second embodiment, the method may further comprise amplifying the sequence of said ligand identifying nucleic acid. The amplification preferably consists of linear amplification, more preferably by using at least one polymerase and at least one restriction enzyme or nicking enzyme.

[0272] According to this second embodiment of the method, in step h), the method may further comprise associating the barcode of the nucleic acid (22) with the ligand identification nucleic acid, thereby forming a barcoded nucleic acid.

[0273] According to one embodiment, the common marker DNA sequence or multiple different marker DNA sequences provided in step b) are used for DNA-toolbox reaction (or dynamic DNA reaction network) for phenotypic sorting of cells or organelles, thereby initiating the release of the grafted nucleic acid in step f) or step j). The principle of DNA-toolbox reaction is described in, for example, international patent applications WO2017141068 and WO2017141067.

[0274] According to one embodiment, in step g), the trapped cells or organelles are lysed by osmotic shock. This can be easily implemented by a person skilled in the art by circulating a hypotonic or hypertonic aqueous phase in a microfluidic device. For this operation, the cage can remain closed.

[0275] According to one embodiment, step h) comprises hybridizing the compartment-specific nucleic acid comprising the barcode to the released cell or organelle nucleic acid and / or to the emitted nucleic acid sequence by complementarity, which compartment-specific nucleic acid may still be grafted to the surface of the first substrate or the second substrate of the microfluidic device or released from the surface of the first substrate or the second substrate of the microfluidic device. In particular, when the compartment-specific nucleic acid comprising the barcode is DNA, step h) [or the method between step i) and step j)] may further comprise extending the DNA comprising the barcode hybridized to the released cell or organelle nucleic acid (or the marker emitted nucleic acid sequence) using a DNA polymerase to produce a complementary strand of the released cell or organelle nucleic acid (or the marker nucleic acid sequence) comprising the barcode. The nucleic acid may comprise, for example, a 3' region of the sequence oligo d(T) or oligo d(T)VN for hybridization to the poly(A) tail of an mRNA (for mRNA sequencing), a 3' region of a sequence complementary to a sequence of a specific RNA (for targeted RNA sequencing) or DNA (for targeted DNA sequencing), a 3' region of a random sequence such as d(N)6 (for RNA sequencing or DNA sequencing), a 3' region with three ribo(G) nucleotides for reverse transcriptase template switching (for RNA sequencing), or a 3' region complementary to a nucleotide sequence introduced by recombination, for example, after "tagmentation" catalyzed by Tn5 transposase. The latter can be used, for example, for genomic DNA sequencing, or for epigenomic analysis of DNA methylation (using Methyl-seq or bisulfite sequencing) or chromatin structure (using transposase accessible chromatin sequencing, ATAC-Seq), or for RNA sequencing after tagging of RNA-DNA duplexes formed after first-strand cDNA synthesis or double-stranded DNA formed on RNA released from cells or organelles after first-strand cDNA synthesis and second-strand cDNA synthesis.

[0276] According to another embodiment, the compartment-specific nucleic acid comprising the barcode is DNA and may be fully or partially double-stranded, and step h) comprises ligating the DNA comprising the barcode to DNA released by the cell or organelle. For example, the barcode may be ligated to genomic DNA, for example after restriction digestion (for genomic DNA sequencing or DNA methylation analysis), or after digestion with micrococcal nuclease (for metagenomic analysis using MNase-seq or ChIP-seq).

[0277] According to yet another embodiment, the compartment-specific nucleic acid comprising the barcode is DNA, and may be fully or partially double-stranded, and step h) comprises recombining the DNA comprising the barcode with DNA released by a cell or organelle. For example, the barcode can be recombined with genomic DNA for genomic DNA sequencing, or epigenomic analysis of DNA methylation (using Methyl-seq or bisulfite sequencing) or chromatin structure (using transposase accessible chromatin sequencing, ATAC-Seq). Alternatively, the nucleic acid comprising the barcode is recombined with an RNA-DNA duplex formed on RNA released by a cell or organelle after synthesis of the first-strand cDNA, or with a double-stranded DNA formed on RNA released by a cell or organelle after synthesis of the first-strand cDNA and the second-strand cDNA (for RNA sequencing). In a preferred embodiment, the oligonucleotide comprises a chimeric end (ME) sequence that is recombined with DNA catalyzed by the Tn5 transposase.

[0278] According to one embodiment, the method further comprises, between step d) and step h), releasing the compartment-specific nucleic acid comprising the barcode when cells or organelle material (e.g., surface molecules, secreted molecules, or cleavage products) are present in the cage, e.g., by proximity ligation assay or proximity extension assay.

[0279] Kits for mapping and sequencing individual cells or organelles

[0280] The present invention also relates to a kit for carrying out the above mapping and sequencing method, the kit comprising the components of the kit for labelling individual cells or organelles as defined above and the compartments as defined above.

[0281] The kit contains:

[0282] a) emitter nucleic acids, wherein each emitter nucleic acid comprises an amplification sequence, an identification sequence and a capture sequence;

[0283] b) acceptor nucleic acids, wherein each acceptor nucleic acid comprises i) an amplification sequence that matches all or part of the amplification sequence of the emitter nucleic acid set, or its complement, or ii) a capture sequence that matches all or part of the capture sequence of the emitter nucleic acid set, or its complement;

[0284] c) ligands for cellular targets or organelle targets;

[0285] d) Optionally, a nicking endonuclease and a polymerase with strand displacement activity.

[0286] In some embodiments, the collection of emitter nucleic acids is provided in the form of a group of emitter nucleic acids, wherein all emitter nucleic acids of the group comprise the same identification sequence. In this embodiment, the kit further comprises an endonuclease.

[0287] The present invention will be further described with reference to the following figures and examples. BRIEF DESCRIPTION OF THE DRAWINGS

[0288] Figure 1 : Flow cytometry fluorescence measurements of unstained tissue (negative control), tissue stained before tissue dissociation (pre-dissociation staining), and tissue stained after tissue dissociation (post-dissociation staining). The lower figure corresponds to labeling with ubiquitous fluorescent cell surface markers, including antibody anti-human CD98 and lectin PHA. The upper figure corresponds to labeling with ubiquitous cell surface markers carrying fluorescent and biotinylated oligonucleotides conjugated via streptavidin (ASO: antibody streptavidin oligonucleotide). Separation between stained fluorescent and unstained cells was observed, indicating resistance of staining to dissociation.

[0289] Figure 2 : The combination of enzymes and oligonucleotides present in the solution can be used to perform local amplification of barcoded nucleic acids, for example, under the action of a polymerase with strand displacement activity and a nicking endonuclease. A is the amplification sequence, B is the identification sequence, and C is the capture sequence. A and B are required for subsequent single cell analysis and library preparation. N contains a priming sequence at its 5' end containing a recognition site for a nicking endonuclease. are respectively complementary nucleic acids of A, B, C, N. Four different embodiments are shown, in which oligonucleotides called emitter nucleic acids are captured on the cell surface via antibodies ("r") specific for cell surface markers, however, other ligands binding to cell membranes can also be used instead of the antibodies.

[0290] 1. The 3' portion of the antibody-conjugated oligonucleotide (antibody "e") (referred to as the emitter) is directly self-primed for polymerization. After polymerization, a nicking endonuclease can create a nick, allowing a strand-displacing polymerase to prime and polymerize again, while displacing the strand complementary to the emitter oligonucleotide. The released nucleic acid can diffuse and hybridize to an available and complementary antibody-conjugated acceptor oligonucleotide ("r").

[0291] 2. The 3' portion of the antibody-conjugated oligonucleotide (antibody "e") (called emitter) consists of the free oligonucleotide Initiation for nicking and polymerization. The nicking endonuclease can produce a nick, thereby allowing the strand displacement polymerase to initiate and polymerize again, while releasing the complementary nucleic acid of the emitter oligonucleotide. The released nucleic acid can diffuse and hybridize to the available and complementary antibody-conjugated acceptor oligonucleotide ("r"). After polymerization, the nicking endonuclease can produce a nick, thereby allowing the strand displacement polymerase to initiate and polymerize again, while releasing a new emitter oligonucleotide.

[0292] 3. The 3' portion of the antibody-conjugated oligonucleotide (antibody "e") (referred to as the emitter) is directly self-primed for polymerization. After polymerization, a nicking endonuclease can create a nick, allowing the strand displacement polymerase to initiate and polymerize again, while releasing the complementary strand of the emitter oligonucleotide. The released nucleic acid can hybridize to the free partially complementary oligonucleotide, allowing a new polymerization and amplification cycle. The released nucleic acid can diffuse and hybridize to the free antibody-conjugated acceptor oligonucleotide ("r").

[0293] 4. The 3' portion of the antibody-conjugated oligonucleotide (antibody "e") (called the emitter) is directly self-primed for nicking and polymerization. The nicking endonuclease can create a nick, allowing the strand displacement polymerase to prime and polymerize again, while releasing the complementary strand of the emitter oligonucleotide. N' corresponds to the same sequence as N, where at least one thymine from the recognition site is replaced by uracil to avoid recognition and nicking by the nicking endonuclease. However, after polymerization, the strand complementary to N' will be The released nucleic acid can directly self-hybridize by forming a hairpin structure and allowing a second polymerization and nicking cycle. Each hairpin structure is composed of different nucleic acid sequences to avoid unwanted folding. The released nucleic acid from the second polymerization and nicking cycle can diffuse and hybridize to the free antibody-conjugated receptor oligonucleotide ("r").

[0294] Figure 3 : a. Measurement of double-stranded DNA production starting from 10 nM, 1 nM, 100 pM, 10 pM, 1 pM, 0.1 pM and 0 pM of emitter. The reaction mixture was prepared according to Table 2. Incubated at 37°C for 90 minutes and fluorescence measurements were performed using a thermal cycler (CFX384 Touch, Biorad) at 2 cycles per minute. b. For Figure 2 Amplification strategy for isothermal generation of the oligonucleotides presented in .1. A is the amplification sequence, B is the identification sequence, and C is the capture sequence. A and B are required for subsequent single cell analysis and library preparation. N is the recognition site for the nicking endonuclease. Q is the sequence that hybridizes to the quencher (represented as a black sphere). S is a spacer used to remove the biotin (represented as a square). and are complementary nucleic acids of A, B, C, N and Q, respectively. In step 1, the nucleic acid is released from the self-triggered emitter (SEQ ID NO: 2), as represented by step 2. In step 3, the released nucleic acid is hybridized to a fluorescent reporter ("QAS", SEQ ID NO: 4). The reporter partially hybridizes to a sequence carrying a quencher ( SEQ ID NO:5), thereby preventing the observation of fluorescence, in step 4, the sequence carrying the quencher is released by polymerization of the released nucleic acid on the reporter group, thereby causing the appearance of a fluorescent signal. c. Electrophoresis of amplification products and standards. 5 μl per lane, 4% agarose gel (Thermo Scientific R2802). Migrate at 120V for 30 minutes in 1xTAE (Dutscher 348605). 3 μl FastRuler low range DNA ladder (Thermo Scientific SM1233) per ladder. Prepare concentration standards with serial dilutions of double-stranded ABC oligonucleotides from 1 μM to 10 nM under the same conditions as described for the amplification products.

[0295] Figures 4 to 5 : HUVEC and HEPG2 cells were co-cultured on a 48-well plate. Each thumbnail represents the same observation field, but in a different observation channel and at two different times: T0 and T1 (40 minutes after T0). A. Bright field image showing co-culture of two cell lines. B. Al647 fluorescence channel (1 second exposure), showing anti-human CD146 antibody labeling with cell specificity for HUVEC. C. BV421 fluorescence channel (1 second exposure), showing anti-human CD326 antibody labeling with specificity for HEPG2 cells. The emitter sequence (SEQ ID NO: 2) is also conjugated with anti-human CD326 antibody. D. ATTO488 fluorescence channel (1 second exposure), showing the reporter group signal, which is conjugated with anti-human CD146 antibody and is therefore present on the surface of HUVEC cells. At T0, the co-culture was incubated at 37°C with the reaction mixture detailed in Table 3, allowing the self-triggered emitter (SEQ ID NO: 2) carried by the HEPG2 cells to release partially random nucleic acids. The fluorescent reporter group (SEQ ID NO:9) present at the surface of HUVEC cells partially hybridizes to the sequence (SEQ ID NO:5) carrying the quencher, thereby preventing fluorescence from being observed at T0. After diffusion and amplification, the released nucleic acid hybridizes to the fluorescent reporter group (SEQ ID NO:9). At T1, the sequence carrying the quencher is released by the polymerization of the released nucleic acid on the reporter group, thereby causing the appearance of the fluorescent signal. The white arrow points to the HUVEC cells, as shown in the Al647 fluorescence channel. At T0, there is no signal in the ATTO488 channel, indicating that all fluorescent reporter groups (SEQ ID NO:9) on the cell are partially hybridized to the sequence carrying the quencher (ID4). At T1, there is a signal in the ATTO488 channel, which is co-localized with the staining on the cell in the Al647 channel, indicating that the sequence carrying the quencher (SEQ ID NO:3) is replaced due to the release, amplification and diffusion of nucleic acids from the self-triggered emitter (SEQ ID NO:2).

[0296] Figure 6 : Schematic diagram of a closed pattern of a microfluidic device that can be used according to the present invention. The microfluidic device 10 comprises a plurality of closed patterns 16 arranged in a table. The closed pattern 16 represented is in the form of a square, but can equally be in the form of a rectangle, a circle or even a hexagon. The closed pattern 16 has a thickness e and a height h.

[0297] Figure 7 : Schematic diagram of a microfluidic device, wherein the pattern is made of an actuable hydrogel. The microfluidic device 10 includes a first wall 12, which includes a first substrate 14, and a plurality of closed patterns 16 are grafted on the first substrate. A second wall 18 facing the first wall 12 includes a second substrate 20. A plurality of nucleic acids 22 are grafted on the second substrate 20. The closed pattern 16 is made of an actuable hydrogel, which can swell between a contracted state and a swollen state, in which the closed pattern 16 contacts the second substrate 20. The microfluidic device 10 also includes an inlet 24 and an outlet 26, thereby allowing reactants to be introduced into the device 10 and removed from the device, respectively.

[0298] In scenario A, the closed pattern 16 is in a contracted state. The gap 28 between the closed pattern 14 and the second substrate 20 allows fluids and cells present inside the device to circulate freely inside the device 10.

[0299] When placed under certain physical and chemical conditions, the closed pattern 16 begins to absorb water and swell, thereby extending the closed pattern 16 until it contacts the second substrate 20 .

[0300] In solution B, the closed pattern 16 is in a swollen state, in contact with the second substrate 20. The device 10 thus comprises a plurality of cages 30, each of which is defined by side walls made of one of the closed patterns 16 and end walls constituted by a portion of the first substrate 14 and the second substrate 20.

[0301] Figure 8 : Schematic diagram of a microfluidic device, wherein the second substrate is made of an actuable hydrogel. The microfluidic device 10 includes a first wall 12, which includes a first substrate 14, and a plurality of closed patterns 16 are grafted on the first substrate. A second wall 18 facing the first wall 12 includes a second substrate 20. A plurality of nucleic acids 22 are grafted on the first substrate 14. The second substrate 20 is made of an actuable hydrogel, which can swell between a contracted state and a swollen state, in which the closed patterns 16 are in contact with the second substrate 20. The microfluidic device 10 also includes an inlet 24 and an outlet 26, thereby allowing reactants to be introduced into the device 10 and removed from the device, respectively.

[0302] In scenario A, the second substrate 20 is in a contracted state. The gap 28 between the closed pattern 14 and the second substrate 20 allows the fluid and cells present inside the device to circulate freely inside the device 10.

[0303] Under certain physical and chemical conditions, the second substrate 20 begins to absorb water and swell, and the thickness of the second substrate 20 increases until it contacts the closed pattern 16 .

[0304] In solution B, the second substrate 20 is in a swollen state, in contact with the closed pattern 16. The device 10 thus comprises a plurality of cages 30, each of which is defined by side walls made of one of the closed patterns 16 and end walls constituted by a portion of the first substrate 14 and the second substrate 20.

[0305] Example

[0306] Example 1: DNA Remaining Attached to Cells During Dissociation

[0307] As a proof of concept applicable to a cohort of biological samples, we demonstrated that we could maintain DNA nucleic acid coupling to cells during dissociation of tissue sections, independent of cell type, using antibodies, lectins, or cholesterol tags as ligands.

[0308] Cell culture

[0309] Jurkat human T lymphocytes were cultured in RPMI 1640 medium (Gibco 61870044) supplemented with 10% heat-inactivated fetal bovine serum (Gibco 10082147) and 1% penicillin-streptomycin (Gibco 15140122). TIB-152 and Ramos human B lymphocytes CRL-1923. Cells were seeded in 25 cm2 or 75 cm2 culture flasks at 37°C and 5% CO2 according to ATCC recommendations. Cells were diluted when 75% to 80% confluence was reached. After retrieval from cell culture, cells were finally cultured at 2.10 6 cells.mL -1 Resuspend in TBS1x at a concentration of 1.

[0310] Antibody and lectin conjugation

[0311] First, the purified antibody (Biolegend) and lectin (Eurobio Scientific) were conjugated to streptavidin using the streptavidin conjugation kit protocol (ab102921). The conjugated marker was then mixed with the biotinylated oligonucleotide in a ratio of 1:12 in 1x tris buffered saline (TBS, VWR CAYM600232-500) and stored in a room with a temperature control of 20°C to 25°C for more than 12 hours (overnight) in the dark. Biotinylated oligonucleotides were purchased from IDT at a concentration of 100 μM in IDTE buffer (pH 8.0) and desalted by standard. The sequence of the biotinylated fluorescent oligonucleotide is: / 56-FAM / CACAGGGTGATCAGGT / 3Bio / (SEQ ID NO:1). 56-FAM represents the fluorescein fluorescent dye attached to the 5' end of the oligonucleotide, and 3Bio represents the biotin attached to the 3' end of the oligonucleotide.

[0312] Tissue dissociation

[0313] About 2 g of fresh colon sample was cut into pieces of approximately mm 2 The tissue was washed three times in 10 ml of 1x phosphate buffered saline (PBS, Gibco 10010023) before staining, followed by washing three times in a cell staining buffer (Biolegend 420201) with 400 μg / ml of DSS (SigmaD8906) and 5mM EDTA (Sigma 03690). The tissue was stained with 1 μg to 10 μg of an antibody or lectin conjugated to a fluorophore or fluorescent oligonucleotide in 500 μl of a cell staining buffer (Biolegend 420201) at 4 ° C for 30 minutes. The small pieces were then washed in 10 ml of 1x phosphate buffered saline and then dissociated using a gentleMACS Octo dissociator and a tumor dissociation kit (Miltenyi Biotec 130-095-929). After dissociation, cells were filtered at 40 μm, washed with 10 ml of tris-buffered saline (TBS, VWRCAYM600232-500), and resuspended in 1 ml of TBS. Optionally, cells were stained with DAPI to distinguish live cells from dead cells.

[0314] Cell staining

[0315] 200,000 cells are resuspended in 100 μL cell staining buffer (Biolegend 420201) containing 400 μg / ml of DSS (Sigma D8906) and 5mM EDTA (Sigma03690). The cells are incubated in the dark at 4 ° C for 10 minutes with 5 μL of Fc receptor blocking solution (Biolegend 422301), followed by the addition of 0.2 μg to 2 μg of antibodies or lectins conjugated with fluorophores or fluorescent oligonucleotides or an equal amount of cholesterol-modified oligonucleotides. The cells are incubated in the dark at 4 ° C for 30 minutes, then rinsed twice in the aforementioned cell staining buffer mixture, and rinsed twice in Tris buffered saline (TBS, VWR CAYM600232-500). For each washing, the cells are centrifuged at 130 rcf and 4 ° C for 5 minutes, the supernatant beyond 50 μl is removed, and then 200 μl of clean buffer is added. After the final wash, cells were resuspended in 200 μl TBS.

[0316] Cell staining is usually performed after tissue dissociation, however in order to label cells according to their initial location in the tissue, staining needs to be performed before dissociation.

[0317] We selected universal external cell markers to label every cell of the tissue without the need for permeabilization.

[0318] We first demonstrated marker non-specificity using flow cytometry (Guava easyCyte 12HT) and the absence of marker exchange after staining Jurkat and Ramos cell lines. Universal cell markers were selected from anti-human CD98 (BioLegend 315603, 315602), anti-human CD298 (BioLegend 341709) or anti-human β2-microglobulin (BioLegend 316317, 316302), lectin jacalin, lectin LCA, lectin PHA-E and cholesterol modification at the 3' end of the oligonucleotide (3CholTeg at IDT, HPLC purification), which replaced the biotin modification.

[0319] We stained each population with one of the markers, then mixed a portion of each stained population together for 30 minutes and analyzed them by flow cytometry. It seems that regardless of the type of marker, we can still distinguish each population after mixing, indicating that there is no cross contamination after staining (data not shown). When using oligos with cholesterol modifications, the separation is not as important as with antibodies or lectins, but it still exists.

[0320] We also demonstrated that by mixing populations stained with markers conjugated to fluorescent oligonucleotides and populations stained with markers conjugated to non-fluorescent oligonucleotides, antibody-conjugated oligonucleotides do not exchange their oligonucleotides via biotin-streptavidin linkage (data not shown).

[0321] Finally, we demonstrated the resistance of selected cell markers to tissue dissociation. Each time, we compared unstained tissue to stained tissue before and after dissociation, and we assessed the presence of staining by flow cytometry (Guava easyCyte12HT).

[0322] Labeling can be partially maintained during tissue dissociation by antibodies or lectins, using fluorophores or conjugating to fluorescent oligonucleotides ( Figure 1 ). The difference in staining between pre- and post-dissociation conditions could be explained by the inability of the marker to completely stain the interior of the tissue block.

[0323] In parallel, we demonstrated that, by methods similar to the Cite-seq approach (Stoeckius et al., Nat Methods. 2017 Sep;14(9):865-868), we could recover both transcriptome information and marker nucleic acid information associated with the same cells.

[0324] Example 2: Isothermal Amplification of Emitter Nucleic Acids

[0325] We also tested several isothermal amplifications with the goal of obtaining more than a thousand-fold amplification of the oligonucleotides using similar orders of magnitude of reagents and nucleic acids to be used on the tissues. Figure 2 An example of a process for such amplification is described in .

[0326] Oligonucleotides

[0327] Oligonucleotides were designed in silico and checked using RNASructure and PrimerBlast to limit unwanted hairpins, homodimers, or heterodimer structures. Oligonucleotides were purchased from IDT at 100 μM in IDTE buffer (pH 8.0) with standard desalting. The / iBiodT / modification represents internal biotin, the / 56-FAM / modification represents 5' fluorescein, the / 3Bio / modification represents 3' biotin, the / 3IABkFQ / modification represents 3' quencher, the absorption spectrum ranges from 420 nm to 620 nm, the peak absorbance is at 531 nm, and the / 5ATTO488N / modification represents 5' ATTO 488 fluorophore.

[0328] Table 1: Examples of oligonucleotide designs for isothermal amplification and reporting

[0329]

[0330] Reaction mixture assembly

[0331] All reactions were incubated in a thermal cycler (CFX384 Touch, Biorad) at 37°C for 90 minutes, and SYBR fluorescence was measured every 30 seconds. The reaction mixture was prepared according to Table 2.

[0332] Table 2: Reaction mixture .

[0333]

[0334]

[0335] Under these conditions, we found that emitter oligonucleotides could generate over a million sequences starting from concentrations as low as 0.1 pM (Figure 3).

[0336] After extraction of DNA from agarose gel electrophoresis (similar to that shown in Figure 3c), the identity of the amplification was confirmed by Sanger sequencing (LightRun format Eurofins, using primers (SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8).

[0337] The inventors have also tested other polymerases (bst, bsu, phi29), nicking endonucleases (Nt.AlwI, Nb.BtsI) and used different buffers (NEB Cutsmart). The inventors have also designed and tested other oligonucleotide designs based on the same amplification strategy and using different amplification strategies (such as Figure 2 The results show that these embodiments can also be performed correctly.

[0338] Example 3: Isothermal amplification of emitter nucleic acids based on 2D layers of living cells and capture on receptor nucleic acids .

[0339] The inventors subsequently demonstrated the ability to generate and capture stochastic barcodes directly on 2D layers of living cells.

[0340] Cell culture

[0341] HEPG2 (ATCC HB-8065) ​​was cultured in DMEM (41965039) containing 10% heat-inactivated fetal bovine serum (Gibco 10082147) and 1% penicillin-streptomycin (Gibco 15140122). Cells were seeded in 25 cm or 75 cm culture flasks at 37°C, 5% CO2 according to ATCC recommendations. Cells were subcultured when 75% to 80% confluence was reached.

[0342] HUVEC (Lonza C2519A) cells were cultured in endothelial cell growth medium (Promocel C-22010) and 1% penicillin-streptomycin (Gibco 15140122). Cells were seeded in 12.5 cm or 25 cm culture flasks at 37°C, 5% CO2 according to Lonza recommendations. Half of the medium was replaced every 48 hours, and cells were subcultured when 75% to 80% confluence was reached.

[0343] HUVECs were then subcultured in 250 μl of the above medium in a 48-well plate. After 48 hours, half of the medium was changed and HEPG2, 0.3%, was added to 25 cm2 of culture per well. After 48 to 72 hours, the co-cultures were ready to be stained.

[0344] Antibody conjugation

[0345] Purified anti-human CD146 (Biolegend361002) and purified anti-human CD326 (Biolegend 324202) were conjugated to streptavidin using a streptavidin conjugation kit (Abcam 102921). The conjugated antibodies were then mixed with biotinylated oligonucleotides in a 1:12 ratio in 1x tris buffered saline (TBS, VWR CAYM600232-500) and stored in a room controlled at a temperature between 20°C and 25°C for more than 12 hours (overnight) in the dark. Purified anti-human CD146 was conjugated to a sequence consisting of SED ID NO:8, and purified anti-human CD146 was conjugated to a sequence consisting of SEQ ID NO:1.

[0346] SEQ ID NO:9 is similar to SEQ ID NO:4 from the previous example, however the fluorescein modification at the 5' end of the oligonucleotide was replaced with a modified ATTO 488 fluorophore that is less sensitive to photobleaching and the spacer sequence between the biotin modification and the PCR primer called A has been removed (not necessary for this method, data not shown).

[0347] Cell staining

[0348] Wash the cells in the wells of 48-well plates with 1 ml cell staining buffer (Biolegend 420201). Add 20 μl of each antibody-conjugated oligonucleotide (0.1 μg / μl antibody), 1 μl of Alexa Fluor 647 (Al647) anti-human CD146 antibody (Biolegend 361013) and 2 μl of Brilliant Violet 421 (BV421) anti-human CD326 (Biolegend 324219) in a total of 200 μl cell staining buffer to the cells. Incubate the cells at 4 ° C for 30 minutes in the dark. Remove the antibody mixture and then add 1 ml of cell staining buffer.

[0349] Anti-human CD146 antibodies are specific for endothelial cells (including HUVEC cells), while anti-human CD326 antibodies are specific for epithelial cells (including HEPG2 cells). This means that HUVEC cells are stained with the Al647 fluorophore and reporter sequence (SEQ ID NO: 9), while HEPG2 cells are stained with the BV421 fluorophore and emitter sequence (SEQ ID NO: 2).

[0350] Reaction mixture assembly

[0351] Prepare the reaction mixture according to Table 3 and add it to each well after removing the cell staining buffer.

[0352] Table 3: Reaction mixture

[0353]

[0354]

[0355] The plates were covered and incubated under an inverted Nikon Ti-2 microscope equipped with a 10x objective (MRD70170) and filter wheel (TI2-P-FWB-E), quad-band dichroic and emission filters (Semrock, FF409 / 493 / 573 / 632-Di03-25x36 and FF01-432 / 515 / 595 / 730-25), a fluorescence source (Lumencor SPECTRA X) and a heating stage (Tokai Hit TP-TIZH26) set at 40°C to achieve a temperature of 37°C at the location of the cells.

[0356] During the 2 hour incubation, 5 / 5 stitched images were taken in each well every 10 minutes in the bright field, BV421, ATTO 488 and Al647 channels.

[0357] Thus, HUVEC cells were observed in the Al647 channel, HEPG2 was observed in the BV421 channel, and the reporter signal was observed in the ATTO488 channel.

[0358] The fluorescent reporter group (SEQ ID NO: 9) present at the surface of HUVEC cells partially hybridizes to the sequence (SEQ ID NO: 5) carrying the quencher, thereby preventing the observation of fluorescence. The self-triggered emitter (SEQ ID NO: 2) carried by the HEPG2 cells releases nucleic acids. After diffusion and amplification, the released nucleic acids hybridize to the fluorescent reporter group (SEQ ID NO: 9). Then, the sequence carrying the quencher is released by the polymerization of the released nucleic acids on the reporter group, thereby causing the appearance of the fluorescent signal.

[0359] 40 minutes after the start of incubation, the inventors observed the appearance of a signal in ATTO488, co-localizing with HUVEC staining in the A1647 channel ( Figure 5 ).

[0360] Example 4: Fresh tissue staining and dissociation

[0361] Purified anti-human β2-microglobulin antibody (Biolegend 316302) was conjugated to streptavidin using a streptavidin conjugation kit (Abcam 102921). The conjugated antibody was then mixed with biotinylated oligonucleotides in a 1:12 ratio in 1xTris buffered saline (TBS, VWRCAYM600232-500) and stored in a room controlled at a temperature between 20°C and 25°C for more than 12 hours (overnight) in the dark. After conjugation with streptavidin, the anti-human β2-microglobulin antibody was mixed with SEQ ID NO: 1 in one tube and with SEQ ID NO: 10 in another tube.

[0362] The tissue slides were washed in cell staining buffer (Biolegend 420201) and then incubated with a mixture of 0.5 μg / ml of anti-human β2-microglobulin antibody conjugated to SEQ ID NO: 1 and 5 μg / ml of anti-human β2-microglobulin antibody conjugated to SEQ ID NO: 10 in cell staining buffer at 4° C. for 15 to 20 minutes. The slides were then washed with cell staining buffer.

[0363] Prepare the reaction mixture according to Table 4 and add it to the tissue slide after removing the cell staining buffer. The volume can be adjusted to cover the surface of the tissue, taking into account the final concentration.

[0364] Table 4: Reaction mixture

[0365]

[0366] The tissue slides were placed in a closed environment to avoid evaporation and incubated at 37 °C for 1 h. The strategy used to amplify and capture emitter nucleic acids is described in detail. Figure 2 .1 in.

[0367] After washing in HBSS (Thermo 14175053) + 5% FBS (Thermo 16140071), the biopsies were cut as small as possible (approximately 1 mm).

[0368] Then the sample is transferred to a test tube containing 200 μL of 20mg / mL collagenase I (final: 2mg / mL, Sigma C0130), 5 μL of 10mg / mL DNase I (final: 25 μg / mL, Sigma11284932001), 80 μL of 50mg / mL hyaluronidase (final: 2mg / mL, Sigma H3506). The final volume is adjusted to 2mL with HBSS. After steady stirring for 50 minutes at 37°C and regular up and down pipetting, the digested sample is filtered with a cell strainer (100 μm) and washed with TBS1X (Thermo 14190169) containing 1% HS (Thermo 26050088) and 2mM EDTA (Thermo 15575020). The cells are resuspended in TBS1X.

[0369] Example 5: Spatially resolved scRNA-seq in microcages

[0370] To obtain spatially resolved scRNA-seq by using thermoactivated cages, single cell isolation, barcoding and sequencing were performed in a chip using resuspended cells from Example 4 of the present invention.

[0371] The overall approach is as follows.

[0372] Synthesis of thermoactive hydrogels

[0373] The ene-functionalized poly(N-isopropylacrylamide) was synthesized following the procedure described in the supplementary information of the following literature: D'Eramo L.; et al., Microsystems & Nanoengineering, 2018, 4, 17069, doi: 10.1038.

[0374] The swelling properties of the resulting polymers were evaluated (as a function of temperature) in various aqueous solutions: pure water, phosphate buffer (pH 2 and pH 9). Figure 7 Given in.

[0375] Preparation of the first substrate

[0376] A first substrate made of polydimethylsiloxane (PDMS) containing microstructures and cavities is prepared by standard soft lithography techniques. The height of the structures and cavities depends on the target and can be a few tenths of a micron up to 100 microns high.

[0377] Functionalization of the first substrate

[0378] After cleaning with isopropanol, the PDMS substrate was exposed to oxygen plasma for 50 seconds. Immediately after surface activation, an anhydrous toluene solution with 3% by volume of mercaptopropyltrimethoxysilane (ABCR Gelest) was contacted with the substrate in a reactor under nitrogen for 3 hours. After the thiol modification of the surface, the substrate was rinsed with toluene and finally dried with a nitrogen stream.

[0379] Photopatterning the hydrogel film onto the first substrate

[0380] The preformed functionalized pNIPAM (ene-reactive type) was spin-coated on a thiol-modified and microstructured PDMS substrate with a dithiol crosslinker. A few 100 μL of a butanol and methanol solution (V / V=1 / 1) containing a functionalized pNIPAM concentration between 3% and 15% by weight and a dithioerythritol (purchased from Sigma Aldrich, CAS No. 3483-12-3) crosslinker concentration between 3% and 10% by weight was deposited onto the substrate. The conditions for spin coating were fixed to an angular velocity varying between 500 rpm and 3000 rpm, and a spin coating time of 30 seconds. The unfolded film was heated and dried in a 90°C oven for 5 minutes. The resulting layer thickness varied from a few tenths of a micron to 15 microns.

[0381] A chrome mask showing a large number of microstructured cages was aligned with the design of the chamber and placed under a UV lamp for deep UV exposure (8 watts, 250 nm wavelength). After exposure, free polymer chains were rinsed by washing the substrate in an ultrapure water bath for 5 minutes. The hydrogel-patterned substrate was dried with a stream of nitrogen.

[0382] Preparation of the second substrate

[0383] The second substrate used was a glass slide dotted with DNA strands (purchased from Agilent, called Agilent Microarray Format).

[0384] Presenting up to a million unique spots with different DNA strands grafted onto them, the substrate provides a different barcode on each spot. Each spot contains millions of DNA strands, and each spot has a different barcode.

[0385] The positioning system is integrated into the design of the array. Among the many unique spots, some of them carry specific sequences (2 or more) for capturing fluorescently labeled DNA oligonucleotides by hybridization. They are placed to form a variety of shapes including triangles, squares and circles.

[0386] Closing the device

[0387] The bonding between the first and second substrates was achieved by treating with O2 plasma for 50 seconds. A protective layer was applied on the area of ​​interest to avoid activation of the oxygen plasma in this area. After termination of the exposure, the PDMS substrate was placed on top of the DNA array so that the area of ​​interest was facing the hydrogel structure. A curing step was performed by storing the chip in an oven at 70°C for at least 30 minutes.

[0388] Preparation of chips for specific capture: total scRNA-seq

[0389] Oligonucleotides were designed in silico and purchased from IDT Corporation at concentrations ranging from 25 μM to 100 μM in IDTE buffer (pH 8.0) after standard desalting.

[0390] A solution of 100 mM potassium acetate, 30 mM HEPES (pH 7.5) and 10 μM oligonucleotides Q, R and S was injected into the interior of the microfluidic chamber at 40°C (cage open) to hybridize additional capture sequences to the immobilized DNA strands and perform a localization step. The flow was stopped and the chip with mixed oligonucleotides was heated above 60°C for 2 minutes, then incubated at room temperature for 10 minutes and washed with 1x SSC solution (Thermo Scientific #15413549) at 40°C.

[0391] Oligonucleotides Q, R and S have the following sequences:

[0392] Q:Pre_BclI_P5:CATGCTTGATCAGACCACCGAGATCTAC(SEQ ID NO:12)

[0393] R: Phos_Rd1_Nxt_UMI12_PolydT30VN:

[0394] 5Phos / TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN(SEQ ID NO:13)

[0395] S: Fluo_4.2_3Cy5Sp: CATACTCGGTCTGCG / 3Cy5Sp / (SEQ ID NO: 14).

[0396] Bright field and fluorescence imaging of the main chamber (excitation at 650nm and emission at 670nm) is performed. The information identification of DNA array spots and cages is performed. This identification is based on the superposition of the two images. The bright field image allows the identification of cages. The fluorescence image enables the identification of certain spots on which the fluorescent DNA probe has previously hybridized. The relative position of these circles defines a unique position on the chip, allowing the original organization of the DNA array to be mapped onto the superimposed image. Finally, thanks to this identification, we can associate a spot-specific barcode with each cage.

[0397] Primer synthesis .

[0398] A mixture containing Sulfolobus DNA polymerase IV (NEB #M0327S) and Hi-T4 ligase (NEB #M2622S) in Thermopol 1x (NEB #B9004S) supplemented with 1 mM ATP (NEB #P0756S) was injected at 40°C and then incubated inside the chamber for 2 hours at 50°C to polymerize and ligate the barcoded primers. The internal volume was then rinsed with 1x SSC solution (ThermoScientific #15413549) at 40°C.

[0399] Single cell capture

[0400] Prepare a cell suspension at a concentration of 10 million cells / ml with 1% BSA in TBS. Inject cells into the chip at 100 μl / h; heat the chip at 37°C to open the cages. Once the cells circulate around and over the cages, stop the flow and lower the temperature to 20°C to close the cages. Trapped cells inside the cages.

[0401] For lysis, 0.2% SDS (Sigma 71736) in PBS was injected into the chamber through an additional inlet not blocked by the swollen hydrogel cage.

[0402] When the aqueous phase surrounding the cages was changed with PBS, the cellular RNA strands subsequently hybridized to the grafted capture sequences.

[0403] After 10 minutes of stopped flow, a cleaning step was performed by opening the cage (raising the temperature to 37°C) and flowing PBS in the chamber.

[0404] Barcoded cDNA synthesis

[0405] The cleaning step was performed by opening the cage and flowing RT buffer (ThermoScientific #EP0742) equivalent to 20 volumes of the chamber interior volume through the chamber for 3 minutes at 37°C.

[0406] After cleaning, a mixture containing 10 U / μl of reverse transcriptase (Thermo Scientific #EP0742), 0.5 mM dNTP (NEB #N0447S) and 1 U / μl of RNase inhibitor (Thermo Scientific #11581505) in 1x RT buffer was injected into the chamber, and then the flow was fixed and the captured strand was reverse transcribed at 50°C for 2 hours. The enzyme was immediately rinsed with 1x SSC solution to stop reverse transcription.

[0407] A second mixture containing 2 U / μl of Exonuclease I in 1x Exonuclease I reaction buffer (NEB #M0293S) was injected and incubated for 30 minutes at 37° C. The enzyme was immediately washed with 1x SSC solution to stop the reaction.

[0408] DNase / RNase free distilled water (Invitrogen #10977023) was poured into the chamber and heated to 98°C to dehybridize the synthesized cDNA. The internal volume was then collected by flowing additional water.

[0409] 10 μL of NEB2 buffer (NEB #M0212L) and 10 μL of 10 μM Oligo T were added to 65 uL of recovered sample.

[0410] The solution was incubated at 95°C for 2 minutes and immediately transferred to ice. Then, 8 μL of 10 nM dNTP and 7 μL of Klenow exo- (NEB #M0212L) were added.

[0411] The mixture was placed in a thermal cycler precooled at 4°C, and the temperature was slowly raised to 37°C and maintained for 30 minutes to allow for second-strand synthesis.

[0412] The cDNA was then purified using SPRIselect magnetic beads (Beckman #B23317) following the manufacturer's instructions.

[0413] The purified samples were then subjected to 15 cycles of a 2-step PCR amplification with a 30 second extension using primers U and V and Q5 High Fidelity DNA Polymerase (NEB #M0491).

[0414] Oligonucleotides U and V have the following sequences:

[0415] U:P5:AATGATACGGCGACCACCGAGATCTACAC (SEQ ID NO:15)

[0416] V:P7_i05_Rd2_Nxt:

[0417] CAAGCAGAAGACGGCATACGAGATCCAGGAAGGTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG (SEQ ID NO: 16).

[0418] PCR products were purified and quantified using SPRIselect magnetic beads (Beckman #B23317) and then sequenced using the Illumina sequencing platform.

[0419] Demultiplexing of sequencing information was performed by retrieving for each read the barcodes from positions 1 to 15 of the Index1 read, the UMIs from positions 1 to 12 of the Read1 read, and the RNA transcript starting from position 1 of the Read2 read.

[0420] By replacing 10% of oligonucleotide Q with a similar oligonucleotide, but carrying the capture sequence of the emitter nucleic acid (SEQ ID NO: 3) instead of a polyT tail at the 3' end, upon cell lysis in a thermoactivated cage, the emitter nucleic acid hitherto present on the cell surface hybridizes to the cage-specific primer and associates with the cage barcode on the mRNA after DNA synthesis.

[0421] A sub-portion of the cDNA solution was amplified using a complementary primer to U, which is V containing the amplification sequence of the emitter nucleic acid (represented by SEQ ID NO: 11) at its 3' end.

[0422] After sequencing, the identification sequence of the emitter nucleic acid of a cell can be linked to the mRNA transcript of the same cell thanks to the cage barcode. The presence of the same identification sequence and their relative amounts are used to reconstruct the cell neighborhood.

[0423] Example 6: Spatially resolved scRNA-seq on the Drop-seq platform

[0424] To obtain spatially resolved scRNA-seq, Drop-seq was performed as described and modified in (Macosko, EZ et al. Cell 161, 1202–1214 (2015)) using resuspended cells from Example 4. 10% of the oligonucleotides on the hydrogel beads carried the capture sequence of the emitter nucleic acid (SEQ ID NO: 3) at their 3' end replacing the polyT tail. The emitter nucleic acid was thus associated with the same droplet barcode as the mRNA.

[0425] cDNA was isolated and amplified as described and modified by Stoeckius, M et al. Simultaneous epitope and transcriptome measurement in single cells. Nat Methods 14, 865–868 (2017). The barcoded emitter nucleic acid was amplified using a complementary primer containing an amplified sequence of the emitter nucleic acid at its 3' end (represented by SEQ ID NO: 11). After sequencing, the identification sequence of the emitter nucleic acid of the cell can be linked to the mRNA transcript of the same cell due to the cage barcode. The presence of the same identification sequence and their relative amounts are used to reconstruct the cell neighborhood.

Claims

1. A method for labeling individual cells or organelles in a biological sample with an identifying nucleic acid sequence, the method comprising: a) providing a first nucleic acid collection ("emitter nucleic acids"), wherein each nucleic acid molecule comprises an amplification sequence, an identification sequence and a capture sequence; b) providing a second nucleic acid set ("receptor nucleic acids"), wherein each receptor nucleic acid is covalently or non-covalently coupled to a ligand of a cellular target or an organelle target, wherein the receptor nucleic acids comprise i) an amplification sequence that matches all or part of the amplification sequence of the emitter nucleic acid set, or a complementary sequence thereof, or ii) a capture sequence that matches all or part of the capture sequence of the emitter nucleic acid set, or a complementary sequence thereof; c) contacting the emitter nucleic acid set and the receptor nucleic acid set with a biological sample in a solution so as to label individual cells or organelles within the biological sample with at least the receptor nucleic acids; d) releasing a plurality of nucleic acid molecules which are copies of a region of the emitter nucleic acid comprising the amplification sequence, the identification sequence and the capture sequence or their reverse complements ("emitted nucleic acids") and hybridizing the emitted nucleic acids with receptor nucleic acids; e) dissociating the biological sample and recovering individualized cells or organelles, wherein at least a subpopulation of the individualized cells or organelles are labeled with the emitted nucleic acid.

2. The method of claim 1, wherein each emitter nucleic acid is bound to a ligand of a cellular target or an organelle target.

3. The method according to claim 2, wherein in step c), the biological sample is washed after contacting with the emitter nucleic acid set and the receptor nucleic acid set.

4. The method according to claims 1 to 3, wherein the emitter nucleic acid additionally comprises a sequence complementary to the nicking site and in step c), the generation of the emitting nucleic acid is carried out by isothermal amplification via nicking and polymerization catalyzed by a nicking endonuclease and a polymerase with strand displacement activity. 5 . The method according to claim 1 , wherein the set of emitter nucleic acids is provided in the form of a group of emitter nucleic acids, wherein all emitter nucleic acids of a group comprise the same identification sequence.

6. The method of claim 5, wherein the group of emitter nucleic acids comprises: (a) concatemers of emitter nucleic acids generated by rolling circle replication, wherein each concatemer comprises the same emitter nucleic acid; or (b) Beads carrying emitter nucleic acids containing the same identification sequence.

7. The method of claim 5 or 6, wherein in step d), the emitter nucleic acid of a population is cleaved with a restriction endonuclease to release multiple copies of the emitted nucleic acid.

8. The method according to any one of claims 1 to 7, wherein the receptor nucleic acid further comprises a restriction site or a cleavage site.

9. The method according to any one of claims 1 to 8, wherein the cellular target or organelle target is a target that is ubiquitously present at the surface or inside of all or most of the cells or any organelle of the cells in the biological sample.

10. The method according to any one of claims 1 to 9, wherein an image of the biological sample is taken by microscopy before step d) or before step e).

11. A method for mapping and sequencing individual cells or organelles of a biological sample, the method comprising: a) providing an individualized cell as obtainable by a method according to any one of claims 1 to 10, labeled with (i) a nucleic acid comprising an amplification sequence, an identification sequence and a capture sequence, or (ii) the reverse complement of (i); b) trapping the individualized cells or organelles labeled with the nucleic acid or its reverse complement in compartments, wherein the compartments comprise compartment-specific nucleic acids and at least one of the following sequences for nucleic acid labeling and further sequencing: a hybridization site, a ligation site, or a recombination site; c) analyzing the captured cells, organelles and / or their secreted molecules, optionally using optical detection; d) lysing the captured cells, or cells and organelles, thereby releasing nucleic acids from the cells or organelles in the compartment; e) associating i) a compartment-specific sequence with ii) said nucleic acid released from said cell or organelle in said compartment and iii) said nucleic acid comprising said amplification sequence, said identification sequence and said capture sequence or their reverse complements; f) recovering the nucleic acid produced in step e) from the compartment and sequencing the recovered nucleic acid; as well as g) defining nucleic acids comprising the same compartment-specific sequence as originating from the same single cell, and mapping the original position of the single cell on the biological sample based on the identification sequence or its reverse complement sequence contained in the nucleic acid generated in step e), thereby combining the mapping and sequencing information of the individual cells of the biological sample; h) mapping the initial position of the single cell on the biological sample by determining the relative proportion of the same identification sequence or its reverse complement contained in the nucleic acid generated in step e) to estimate the distance between cells according to the principle of triangulation; as well as i) Optionally, mapping said sequencing information back onto microscopy-derived images of said biological sample taken prior to dissociation.

12. The method for mapping and sequencing of claim 11, wherein the compartment is a droplet, a hydrogel matrix, a microfabricated chamber separated by pneumatic valves, a microfabricated well, an actuatable hydrogel cage, or a microplate well.

13. The method for mapping and sequencing according to any one of claims 11 to 12, wherein the compartment-specific nucleic acid contained in the compartment is DNA.

14. The method for mapping and sequencing according to any one of claims 11 to 13, wherein step e) comprises any of the following: i) hybridizing the compartment-specific nucleic acid to the nucleic acid released from the cell or organelle by complementarity; ii) hybridizing the compartment-specific nucleic acid to nucleic acid released from the cell or organelle by complementarity and extending the compartment-specific nucleic acid hybridized to the released nucleic acid using a DNA polymerase to produce a complementary strand of the released nucleic acid with an associated compartment-specific sequence; iii) hybridizing the compartment-specific nucleic acid to the 3' end of a cDNA produced by reverse transcription of RNA from the cell or organelle by complementarity and extending the cDNA hybridized to the compartment-specific nucleic acid using a DNA polymerase to generate a complementary strand of the compartment-specific nucleic acid with an associated compartment-specific sequence; iv) ligating said compartment-specific nucleic acid to said DNA present in said compartment; or v) Recombining said compartment-specific nucleic acid with said DNA present in said compartment.

15. The method for mapping and sequencing according to any one of claims 11 to 14, wherein: - said compartment-specific nucleic acid comprises a primer sequence complementary to all or part of said amplification sequence or capture sequence present in said nucleic acid comprising said amplification sequence, said identification sequence and said capture sequence or in a reverse complementary nucleic acid thereof; -Step e) further comprises hybridizing the compartment-specific nucleic acid to all or part of the amplification sequence or capture sequence present in the nucleic acid comprising the amplification sequence, the identification sequence and the capture sequence or its reverse complementary nucleic acid, and extending one or both hybridized DNA chains using a DNA polymerase to produce a DNA molecule comprising both the identification sequence or its reverse complementary sequence and the compartment-specific sequence or its complementary sequence, or alternatively, instead of the hybridization and extension steps, step e) further comprises connecting the compartment-specific nucleic acid to all or part of the amplification sequence or capture sequence present in the nucleic acid, or recombining the compartment-specific nucleic acid with all or part of the amplification sequence or capture sequence present in the nucleic acid.

16. A kit, comprising: a) emitter nucleic acids, wherein each emitter nucleic acid comprises an amplification sequence, an identification sequence and a capture sequence; b) acceptor nucleic acids, wherein each acceptor nucleic acid comprises i) an amplification sequence that matches all or part of the amplification sequence of the emitter nucleic acid set, or a complementary sequence thereof, or ii) a capture sequence that matches all or part of the capture sequence of the emitter nucleic acid set, or a complementary sequence thereof; c) ligands for cellular targets or organelle targets; d) Optionally, a nicking endonuclease and a polymerase with strand displacement activity.

Images