Use of erk5 gene as a target in preparation of a drug for preventing or treating white matter damage
By knocking down ERK5 gene expression, a drug was prepared for the treatment of white matter injury, which solved the problem of the unknown biological function of ERK5 gene in white matter injury and achieved the effect of alleviating microglial cell damage and reducing neuroinflammation.
Patent Information
- Application Number
- CN202411728115.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-28
- Publication Date
- 2026-06-26
- Estimated Expiration
- 2044-11-28
AI Technical Summary
In the current technology, the biological function and clinical significance of the ERK5 gene in white matter injury are unknown, and there is a lack of effective prevention or treatment strategies.
Using the ERK5 gene as a target, drugs can be prepared to prevent or treat white matter damage, including ischemic white matter injury, inflammatory demyelinating diseases of the central nervous system, and poisoning-related leukoencephalopathy, by knocking down the expression of small interfering RNA or recombinant adenovirus AAV-ERK5.
Knockdown of the ERK5 gene alleviates oxidative stress in microglia and mitochondrial damage in white matter injury, reduces neuroinflammatory response, and decreases the severity of white matter injury, demonstrating good clinical application value.
Smart Images

Figure HDA0005159674940000011 
Figure HDA0005159674940000012 
Figure HDA0005159674940000013
Abstract
Description
Technical Field
[0001] This invention relates to the field of drug treatment for white matter injury, specifically to the application of the ERK5 gene as a target in the preparation of drugs for the prevention or treatment of white matter injury. Background Technology
[0002] The white matter of the brain is mainly composed of nerve fibers, axons, myelin sheaths, and glial cells. White matter lesions (WMLs) are defined as a clinical syndrome characterized by scattered punctate or confluent patchy changes widely distributed in the subcortical white matter, periventricular region, and centrum semiovale of the brain, which can be observed on imaging. Based on different etiologies and pathophysiological processes, white matter lesions can be classified into leukoaraiosis, age-related leukoencephalopathy, toxic leukoencephalopathy, and subcortical arteriosclerotic encephalopathy. Its main pathological feature is the destruction, loss, or impaired formation of myelin sheaths in central nervous fibers. Demyelination changes are present in the common pathological stages of various diseases, including multiple sclerosis (MS), Alzheimer's disease (AD), vascular cognitive impairment, and dementia (VCID), and are closely related to glial cells (microglia, oligodendrocytes, and astrocytes). The pathogenesis of white matter injury (WML) mainly involves hypoperfusion damage, blood-brain barrier injury, immune inflammatory response, endothelial dysfunction, and oxidative stress. In recent years, with the development of medical imaging technology, the detection rate of WML has been increasing, with surveys showing a prevalence exceeding 30% in people over 60 years of age. The intracranial distribution of white matter varies, leading to significant differences in clinical manifestations: periventricular white matter lesions often present as cap-shaped, linear, or crescent-shaped lesions. Smaller cap-shaped or punctate lesions may be asymptomatic and progress slowly; deep white matter lesions often present as punctate, patchy, or large confluent areas. These lesions progress rapidly, leading to cognitive impairment, abnormal emotional fluctuations, gait instability, urinary incontinence, and other clinical manifestations, causing serious socioeconomic and family problems in daily life.
[0003] Extracellular signal-regulated kinase 5 (ERK5) is a unique MAPK pathway that has been less studied compared to other common MAPK cascades such as ERK1 / 2, JNK, and p38. ERK5 was initially thought to be activated by stress-related stimuli, similar to other stress-activated protein kinases. However, it is now clear that the ERK5 cascade can also be activated by mitogens, confirming its central role in many stress- and mitosis-induced cellular processes.
[0004] Previous research on ERK5 has primarily focused on its role in tumors. It belongs to the MAPK signaling pathway, along with BRAF (a serine / threonine protein kinase closely related to tumorigenesis and development), and is closely associated with processes such as cancer cell proliferation and survival. Statistics show that the MAPK7 gene, which edits ERK5, is amplified in 50% of liver cancer patients. ERK5 is highly expressed in breast and prostate cancers, and related studies have shown that patients with high ERK5 expression have a survival time 20 months shorter than those with low expression. However, the biological function and clinical significance of the ERK5 gene in white matter injury remain unknown.
[0005] Therefore, exploring the disease prediction role of the ERK5 gene in white matter injury is crucial for developing treatment strategies for white matter injury. Summary of the Invention
[0006] The purpose of this invention is to overcome the shortcomings of existing technologies and provide an application of the ERK5 gene as a target in the preparation of drugs or agents for the prevention or treatment of white matter injury. To achieve the above objective, the technical solution designed by this invention is as follows:
[0007] This invention provides an application of the ERK5 gene as a target in the preparation of drugs for the prevention or treatment of white matter damage in the brain.
[0008] Furthermore, the diseases related to white matter injury include, but are not limited to, ischemic white matter injury, inflammatory demyelinating diseases of the central nervous system, and poisoning-related leukoencephalopathy.
[0009] Furthermore, the ischemic white matter injury includes, but is not limited to, white matter injury caused by acute ischemic stroke, white matter injury caused by chronic hypoperfusion, cerebral small vessel disease, and cerebral ischemic foci.
[0010] The inflammatory demyelinating diseases of the central nervous system include, but are not limited to, multiple sclerosis, neuromyelitis optica, and acute disseminated encephalomyelitis;
[0011] The poisoning-related leukoencephalopathy includes, but is not limited to, carbon monoxide poisoning, chemotherapy drugs, radiation, and drug-related leukoencephalopathy.
[0012] The infection-associated leukoencephalopathy includes, but is not limited to, Lyme disease, progressive multifocal leukoencephalopathy (PML), and human immunodeficiency virus (HIV)-related leukoencephalopathy.
[0013] The present invention also provides the use of an agent that knocks down ERK5 gene expression in the preparation of articles for the prevention or treatment of white matter damage.
[0014] Furthermore, the agent is small interfering RNA or recombinant adenovirus AAV-ERK5 or an inhibitor.
[0015] The present invention also provides a small interfering RNA for knocking down ERK5 gene expression, wherein the small interfering RNA has a nucleotide sequence complementary to that of the ERK5 gene.
[0016] Furthermore, the nucleotide sequence of the small interfering RNA (si-ERK5) is CCUUACCAGGGAGCGCAUUAATT, as shown in SEQ ID NO:1.
[0017] The present invention also provides the application of the above-mentioned small interfering RNA in the preparation of a medicine for the prevention or treatment of white matter damage in the brain.
[0018] The present invention also provides a drug for treating white matter injury of the brain, characterized in that: the active ingredient of the drug includes the small interfering RNA mentioned above.
[0019] Furthermore, the dosage form of the drug is an injection.
[0020] The present invention also provides a recombinant adenovirus AAV-ERK5 for knocking down ERK5 gene expression, wherein the recombinant adenovirus AAV-ERK5 is an adenovirus AAV genome with mir30 shRNA inserted therein, wherein the nucleotide sequence of mir30 shRNA is CCTTACCAGGGAGCGCATTAA, as shown in SEQ ID NO:2.
[0021] The specific method for constructing the above-mentioned recombinant adenovirus AAV-ERK5 is as follows:
[0022] Step 1, Interference Target Design and Sequence Synthesis: Based on the general principles of mir30 shRNA design and the transcript of the ERK5 gene, the target was designed and the sequence was synthesized: CCTTACCAGGGAGCGCATTAA.
[0023] Step 2: Preparation of linearized expression vector: The expression vector pAAV-CBG-DIO-EGFP-miR30shRNA-WPRE was digested with restriction endonucleases. The digestion products were analyzed by agarose gel electrophoresis to detect the digestion efficiency.
[0024] Step 3: The target fragment is ligated into the expression vector and transformed into DH5α competent cells.
[0025] Step 4: Pick the transformants that have grown on the plate and resuspend them in 10 μl of LB medium. Take 1 μl as a template for colony PCR identification.
[0026] Step 5: Verify the positive clones obtained from colony identification by sequencing. Perform high-purity plasmid mini-prep on the verified positive clones.
[0027] This invention also provides the application of a kit for detecting ERK5 gene expression in the preparation of products that assist in the detection or assessment of white matter lesions.
[0028] The beneficial effects of this invention are:
[0029] This invention creatively discovers the application of the ERK5 gene in early warning and drug preparation for white matter injury under various pathological conditions. The ERK5 gene is highly expressed in microglia in the demyelinated regions of white matter injury, and can be used for early warning of white matter injury. Knockdown of the ERK5 gene alleviates oxidative stress, ferroptosis, and mitochondrial damage in microglia during white matter injury, thus enabling its application in drug preparation for white matter injury, demonstrating significant clinical value. Attached Figure Description
[0030] Figure 1 This is a statistical plot showing the positive area of ERK5 expression in different brain white matter injury models.
[0031] Figure 2 This is a correlation analysis diagram showing the relationship between the area of ERK5 positivity and the degree of demyelination.
[0032] Figure 3 Statistical graphs of ERK5-positive cells in LPC, BCAS, and MCAO models.
[0033] Figure 4 Statistical graphs of ERK5 and pERK5 expression.
[0034] Figure 5 Statistical graph of fluorescence intensity of mitoSOX, FerroOrgance, and lipid ROS
[0035] Figure 6 This is a statistical chart showing the degree of white matter damage.
[0036] Figure 7 This is a statistical chart showing the activation level of microglia.
[0037] Figure 8 The graph shows the fluorescence intensity statistics of 8-OHdG and 4-HNE. Detailed Implementation
[0038] The present invention will now be described in further detail with reference to specific embodiments, so that those skilled in the art can understand it.
[0039] Example 1: ERK5 expression is upregulated in white matter lesions, and EKR5 expression is correlated with white matter lesions.
[0040] 1. In this embodiment, a mouse model of white matter injury was established using bilateral common carotid artery stenosis surgery. The specific method is as follows:
[0041] After anesthetizing mice with isoflurane, the skin was incised along the midline of the neck, the thyroid gland was dissected, and the trachea and bilateral common carotid arteries were exposed. A miniature spring with an inner diameter of 0.18 mm, a segmental distance of 0.50 mm, and a total length of 2.5 mm was wrapped around both sides of the common carotid arteries. The incision was closed, the skin was sutured, and a 40% decrease in cerebral blood flow was observed, indicating successful establishment of the BCAS mouse model. One month was selected as the observation time point for white matter injury.
[0042] 2. In this embodiment, a mouse model of ischemic white matter injury caused by middle cerebral artery occlusion (MCAO) was established using a middle cerebral artery occlusion (MCAO) procedure. The specific method is as follows:
[0043] After anesthetizing mice with isoflurane, the thyroid gland was dissected, exposing the trachea and both common carotid arteries. A silicone suture with an inner diameter of 0.18 mm was inserted into the internal carotid artery through a distal incision in the right external carotid artery. The incision was closed, and the skin was sutured. A decrease in cerebral blood flow of 80% was considered a successful establishment of the MCAO mouse model. The 14-day period was selected as the observation time point for white matter damage caused by middle cerebral artery embolism.
[0044] 3. In this embodiment, a mouse model of focal white matter injury was established by injecting lysophosphatidylcholine (LPC) into the corpus callosum. The specific method is as follows:
[0045] Mice were anesthetized with isoflurane and mounted on a stereotactic frame. Demyelination of the corpus callosum was induced by stereotactic injection of 2 μL of 1% LPC in PBS at a rate of 0.5 μL / min. The first injection site was 1.0 mm lateral to the fontanelle and 0.3 mm anterior to the anterior fontanelle, with a depth of 2.0 mm. The second injection site was 1.0 mm lateral to the fontanelle and 0.8 mm anterior to the anterior fontanelle, with a depth of 2.2 mm. After injection, the needles were held in place at each site for 10 minutes to minimize backflow. Mice in the Sham group received a stereotactic injection of the same volume of PBS at the same sites. Focal white matter injury was observed over a period of 10 days.
[0046] White matter damage is accompanied by significant demyelination. dMBP, the damaged myelin basic protein, is highly expressed in areas of white matter damage. Frozen brain sections from mice 1 month after BCAS modeling, 14 days after MCAO modeling, and 10 days after LPC modeling were used for immunofluorescence staining with dMBP and ERK5 antibodies; the specific steps are as follows:
[0047] Frozen sections were thawed at room temperature and washed with phosphate buffer for 5 min. Then, the membrane was perforated with Triton X-100 immunofluorescence perforation buffer at room temperature for 15 min. Subsequently, the specimens were blocked with immunofluorescence rapid blocking buffer at room temperature for 15 min. The antibody was diluted with primary antibody dilution buffer, and 10 μL of dilution buffer was added to each sample. The samples were incubated at 4°C for 12 hours, then incubated with secondary antibody at room temperature in the dark for one hour. Finally, the slides were mounted, and the positive areas of ERK5 and dMBP were observed and counted.
[0048] like Figure 1 The results showed that at 1 month after BCAS modeling, 14 days after MCAO modeling, and 10 days after LPC modeling, the positive area of ERK5 in the demyelinated region of brain white matter injury was significantly increased.
[0049] like Figure 2 The results showed that the area of ERK5 was correlated with the demyelination region (LPC model and MCAO model) and the white matter damage score (BCAS model).
[0050] This indicates that ERK5 expression is upregulated in white matter lesions and that EKR5 expression is correlated with white matter lesions, suggesting that ERK5 may be indicative of white matter lesions under different pathological conditions.
[0051] Example 2: ERK5 is mainly expressed in microglia in areas of white matter injury.
[0052] Demyelination is closely related to glial cells. Microglia are immune-active cells; during ischemic injury, they can be activated early, releasing inflammatory factors and causing persistent neuroinflammatory responses that lead to damage to white matter neurons. Oligodendrocytes in the CNS play a role in surrounding axons and forming myelin sheaths; during ischemic injury, a large number of oligodendrocytes undergo apoptosis and are highly susceptible to destruction by inflammatory factors, causing white matter demyelination. Astrocytes, on the other hand, are closely related to the formation of the blood-brain barrier and neuronal synapse formation. The specific steps are as follows:
[0053] Immunofluorescence staining of mouse brain tissue sections was performed using oligodendrocyte protein Olig2 (a marker of primary and mature oligodendrocytes), glial fibrillary acidic protein GFAP (a marker of astrocytes), IBA1 (a marker of microglia), antineurofilament NF (a marker of myelin neurons), and ERK5 antibody, respectively.
[0054] like Figure 3 The results showed that the proportion of ERK5+IBA1+ cells was significantly increased compared with astrocytes, oligodendrocytes, and myelinated neurons. This indicates that ERK5 is mainly expressed in microglia in areas of white matter injury.
[0055] Further, the expression of ERK5 in microglia was observed in vitro.
[0056] First, an in vitro model of white matter lesions in the brain is constructed. The specific steps are as follows:
[0057] Brain tissue from suckling mice was dissected, minced, digested, and cultured for 14 days in a 37°C incubator containing 5% CO2. Primary microglia were collected. Primary microglia without any treatment were designated as the Sham group, while those stimulated with 10 μg / ml of exogenous myelin were designated as the myelin group. This simulated the white matter injury environment in vitro.
[0058] Then, proteins were extracted from microglia for Western blotting analysis. The specific steps are as follows:
[0059] Place the electrophoresis gel in the electrophoresis tank, add electrophoresis buffer until the buffer level is above the sample wells on the inside of the two glass plates, load the sample, and perform electrophoresis. After electrophoresis, construct an electrotransfer clip according to the transfer structure of "sponge pad-filter paper-gel-PVDF membrane-filter paper-sponge pad". Place the electrotransfer clip into the transfer tank filled with transfer buffer, and transfer the membrane in a foam box filled with ice water. After transfer, remove the NC membrane, wash it once in TBST, and then block it with general blocking buffer for 15-30 min. After blocking, wash three times with TBST for 5 min each time, then place it in an antibody incubation box containing primary antibody, label it, and incubate it stably on a pendulum shaker at 4℃ overnight. After incubation, wash three times with TBST for 5 min each time, then place it in an antibody incubation box containing secondary antibody, label it, and react at room temperature for 1 h. After incubation, wash three times with TBST for 5 min each time, and then add ECL exposure buffer to the gel system for color development.
[0060] like Figure 4 The results showed that ERK5 expression was increased in microglia stimulated by exogenous myelin fragments, and the expression of the activated form of ERK5 (phosphorylated ERK5, pERK5) was also significantly increased.
[0061] The results indicate that ERK5 is highly expressed in microglia in the demyelinated regions of brain white matter injury. This suggests that ERK5 may be involved in the neurological damage process induced by microglia in brain white matter injury.
[0062] Example 3: Knocking down ERK5 alleviates mitochondrial damage, ferroptosis, and oxidative stress in microglia during white matter injury.
[0063] Studies have shown that increased mitochondrial complex I activity in microglia is closely related to the development and progression of chronic neuroinflammation. Increased CI activity leads to increased ROS production in microglia, thereby exacerbating neuroinflammation and related neurotoxic damage. Furthermore, ferroptosis stimulation also triggers inflammatory responses in microglia, thus participating in demyelinating lesions. mitoSOX is a commonly used cellular fluorescent probe and a live-cell permeable dye. It can be used to detect changes in intracellular reactive oxygen species (ROS) levels. FerroOrange is a ferrous ion probe that can be used to detect changes in intracellular ferrous iron levels. Lipid ROS is a probe for detecting lipid free radicals and can reflect mitochondrial damage.
[0064] Small interfering RNA (siRNA) is a double-stranded RNA with a length between 20 and 25 nucleotides. It has many biological applications and is currently mainly used to interfere with RNA to regulate gene expression (knockdown). Essentially, siRNA specifically binds to and degrades the corresponding mRNA, thereby blocking the continued translation of mRNA.
[0065] Therefore, the nucleotide sequence of the small interfering RNA (i.e., si-ERK5) was designed as CCUUACCAGGGAGCGCAUUAATT, as shown in SEQ ID NO:1; the specific method for knocking down ERK5 using this small interfering RNA is as follows:
[0066] Step 1: Prepare Reagent 1: Prepare 3.75 μL of transfection reagent lipo3000 and 1.25 μL of culture medium opti-men12. Mix well and incubate at room temperature for 5 minutes. This is Reagent 1 (volume is 125 μL).
[0067] Step 2, Prepare Reagent 2: Prepare si-ERK5 or si-NC 5μL (control RNA) and 120μL of Opti-Men culture medium. After mixing, incubate at room temperature for 5 minutes to obtain si-ERK5 reagent (volume 125μL) or si-NC reagent (volume 125μL).
[0068] Step 3: Prepare the transfection system (si-NC system or si-ERK5 system): Add reagent 2 to reagent 1 and mix well, then incubate at 37°C for 15 minutes to obtain the si-NC system and si-ERK5 system respectively.
[0069] Step 4, transfection: myelin + si-NC group: primary microglia that have been stimulated with exogenous myelin (6-well plate) were removed, and 250 μL of the negative control si-NC system and 1750 μL of 10% FBS high glucose were added to each well.
[0070] myelin+si-ERK5 group: Primary microglia cells (6-well plates) that had been stimulated with exogenous myelin were removed, and 250 μL of si-RNA system and 1750 μL of 10% FBS high glucose knockdown of ERK5 expression were added.
[0071] The fluorescence intensity of mitoSOX, FerroOrgance, and lipid ROS in microglia of each group was detected by flow cytometry.
[0072] like Figure 5 The results showed that, compared with the Sham group, myelin group, and myelin+si-NC group, the myelin+si-ERK5 group had significantly lower mean fluorescence intensities of mitoSOX, FerroOrgance, and lipid ROS. This suggests that ERK5 knockdown may help alleviate mitochondrial damage, ferroptosis, and oxidative stress in microglia during white matter injury.
[0073] Example 4: Construction of recombinant adenovirus AAV-ERK5 for knocking down ERK5 gene expression
[0074] The recombinant adenovirus AAV-ERK5 used to knock down ERK5 gene expression is an adenovirus AAV with mir30 shRNA inserted into its genome. The nucleotide sequence of mir30 shRNA is CCTTACCAGGGAGCGCATTAA, as shown in SEQ ID NO:2.
[0075] The specific method for constructing the above-mentioned recombinant adenovirus AAV-ERK5 is as follows:
[0076] Step 1: Interference target design and sequence synthesis: Based on the general principles of mir30 shRNA design and the transcript of the ERK5 gene, the target was designed and the sequence was synthesized: CCTTACCAGGGAGCGCATTAA.
[0077] Step 2: Preparation of linearized expression vector: The expression vector pAAV-CBG-DIO-EGFP-miR30shRNA-WPRE was digested with restriction endonucleases. The digestion products were analyzed by agarose gel electrophoresis to detect the digestion efficiency.
[0078] Step 3: The target fragment is ligated into the expression vector and transformed into DH5α competent cells.
[0079] Step 4: Pick the transformants that have grown on the plate and resuspend them in 10 μl of LB medium. Take 1 μl as a template for colony PCR identification.
[0080] Step 5: The positive clones obtained from colony identification are sequenced for verification. The correct positive clones are then subjected to high-purity plasmid extraction to obtain recombinant adenovirus AAV-ERK5.
[0081] Example 5: Recombinant adenovirus AAV-ERK5 knockdown of the ERK5 gene alleviates white matter damage.
[0082] Specifically, two weeks prior to the BCAS procedure, in Cx3cr1 CreER Mice were injected bilaterally into the callosities with 1 μl of AAV (coordinates: midline ± 1.0 mm; 1.0 mm anterior to the anterior fontanelle; 2.2 mm depth). The final viral load was 1.0E + 10 vg per mouse. Specifically:
[0083] BCAS-AAV-NC group: BCAS mice were injected with negative control AAV-NC;
[0084] BCAS-AAV-ERK5 group: BCAS mice were injected with recombinant adenovirus AAV-ERK5 to knock down the ERK5 gene in mice.
[0085] LFB staining was used to assess the severity of white matter damage in the brain.
[0086] like Figure 6 The results showed that, compared with the BCAS-AAV-NC group, the white matter damage score of the BCAS-AAV-ERK5 group was significantly reduced. This suggests that knocking down the ERK5 gene may help alleviate white matter damage.
[0087] Example 6: Recombinant adenovirus AAV-ERK5 knockdown of the ERK5 gene alleviates neuroinflammatory response in white matter injury.
[0088] Neuroinflammatory responses are considered a crucial pathological mechanism leading to white matter lesions in the brain. Neuroinflammation is a fundamental immune response characterized by enhanced glial cell activation, secretion of pro-inflammatory cytokines, increased blood-brain barrier permeability, and peripheral leukocyte invasion, thereby protecting the body from endogenous and exogenous damage. Microglia are innate immune cells of the central nervous system, and their activation can mediate neuroinflammatory responses.
[0089] Immunofluorescence staining was used to perform stereoscopic analysis of microglia (Iba-1) in the damaged white matter region of mice to assess the activation status of microglia.
[0090] like Figure 7The results showed that, compared with the BCAS-AAV-NC group, the BCAS-AAV-ERK5 white matter injury group exhibited reduced microglycemic aggregation, decreased cell body area, and significantly decreased roundness in the white matter region of BCAS mice, indicating that microglycemic activation was significantly reduced after ERK5 gene knockdown. This suggests that, in the context of white matter injury, ERK5 gene knockdown can reduce microglycemic activation, thereby alleviating neuroinflammation.
[0091] Example 7: Recombinant adenovirus AAV-ERK5 knockdown of the ERK5 gene alleviates oxidative stress and ferroptosis in white matter injury.
[0092] 8-Hydroxyguanosine (8-OHdG) is a ROS-induced DNA purine residue modification, a sensitive indicator of oxidative DNA damage, and a commonly used biomarker of oxidative stress. 4-Hydroxynonenal (4-HNE) is an important marker of lipid peroxidation in ferroptosis, accumulating in large quantities during the process. Immunofluorescence staining of brain tissue sections from Iba-1 mice was used to detect oxidative stress and ferroptosis levels.
[0093] Immunofluorescence staining was performed on brain tissue sections from 8-OHdG, 4-HNE, and Iba-1 mice to detect oxidative stress and ferroptosis levels in microglia.
[0094] like Figure 8 The results showed that, compared with the BCAS-AAV-NC group, the fluorescence intensity of 8-OHdG and 4-HNE was significantly reduced in the BCAS-AAV-ERK5 group. This indicates that knocking down the ERK5 gene helps alleviate oxidative stress and ferroptosis in brain white matter injury.
[0095] All other parts not described in detail are existing technologies. Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. The use of a recombinant adenovirus AAV-ERK5 in the preparation of a drug for the prevention or treatment of cerebral small vessel disease caused by hypoperfusion, characterized in that: The recombinant adenovirus AAV-ERK5 is an adenovirus AAV genome with mir30shRNA inserted, wherein the nucleotide sequence of mir30shRNA is CCTTACCAGGGAGCGCATTAA.
2. The application of a small interfering RNA in the preparation of a drug for the prevention or treatment of white matter injury, characterized in that: The nucleotide sequence of the small interfering RNA is CCUUACCAGGGAGCGCAUUAATT.