Application of OsST1 gene in regulating salt tolerance in rice

Abstract

The present invention discloses the use of the OsST1 gene in regulating rice salt tolerance. This invention belongs to the field of plant genetic engineering technology. The invention provides the use of the OsST1 gene in regulating rice salt tolerance, demonstrating for the first time the role of the rice OsST1 gene in rice salt tolerance. Research has shown that overexpressing the OsST1 gene can improve the salt tolerance of rice plants and their survival rate under salt stress, demonstrating that the OsST1 gene has a role in regulating plant salt tolerance and addresses the adverse effects of soil salinization on rice growth in practical applications. Furthermore, the verification of the gene's biological function is of great significance for research into the molecular mechanism of rice salt tolerance.

Description

Technical Field

[0001] The present invention relates to the technical field of plant genetic engineering, and more particularly to the application of OsST1 gene in regulating the salt tolerance of rice. Background Art

[0002] Soil salinization is one of the major hazards limiting crop growth and production worldwide. Statistics show that the global area of ​​salinized land is expanding annually, resulting in a reduction in arable land and becoming a key factor in the food crisis. With the growing population and limited arable land, coupled with inappropriate irrigation practices, secondary soil salinization has exacerbated soil salinization. Rice is one of my country's most important food crops and the preferred crop for improving coastal tidal flats and saline-alkali soils. However, rice growth is sensitive to salt stress, and soil salinization can stunt rice growth and reduce yields. High salt concentrations impair rice roots' ability to absorb water and nutrients, impacting rice growth, development, and yield. Furthermore, soil salinization requires increased irrigation water to reduce soil salinity, which can increase irrigation costs and water resource consumption.

[0003] Therefore, exploring rice salt-tolerance genes and analyzing the genetic and molecular mechanisms of rice salt tolerance can provide a good theoretical basis for breeding new salt-tolerant rice varieties. At the same time, it has far-reaching significance for global food security, sustainable agricultural development, sustainable utilization of land resources, and improvement of the ecological environment. However, at this stage, there are relatively few studies on rice salt-tolerance genes. The inventor's research team has been engaged in the mining of functional genes related to abiotic stress in rice. Through analysis using bioinformatics and other means, a gene with unknown function, OsST1, was obtained. Therefore, how to explore the functions of many unknown genes, develop rice salt-tolerance genes, and apply them in the selection and breeding of rice salt-tolerant varieties is a technical problem that those skilled in the art urgently need to solve. Summary of the Invention

[0004] In view of this, the present invention provides the application of the OsST1 gene in regulating the salt tolerance of rice. Through research, it was found that overexpressing the OsST1 gene can improve the salt tolerance of rice plants and increase their survival rate under salt stress. This shows that the OsST1 gene has a positive effect on regulating the salt tolerance of rice, which is beneficial to solving the adverse effects of soil salinization on rice growth in practical applications.

[0005] In order to achieve the above object, the present invention adopts the following technical solutions:

[0006] Application of the OsST1 gene, wherein the application is any one of the following:

[0007] (1) Application in regulating rice salt tolerance;

[0008] (2) as a biological indicator for salt tolerance testing;

[0009] (3) Application in breeding of salt-tolerant rice varieties;

[0010] The nucleotide sequence of the OsST1 gene is shown in SEQ ID No. 1.

[0011] Another object of the present invention is to provide: an application of the protein encoded by the OsST1 gene, wherein the application is any one of the following:

[0012] (1) Application in regulating rice salt tolerance;

[0013] (2) as a biological indicator for salt tolerance testing;

[0014] (3) Application in the breeding of salt-tolerant rice varieties.

[0015] Preferably, the amino acid sequence of the protein encoded by the OsST1 gene is shown as SEQ ID No. 2.

[0016] Another object of the present invention is to provide an overexpression vector pCAMBIA1300-GFP-OsST1 comprising the above-mentioned OsST1 gene.

[0017] Another object of the present invention is to provide: a recombinant engineered bacterium comprising the above-mentioned overexpression vector pCAMBIA1300-GFP-OsST1.

[0018] Another object of the present invention is to provide the use of the above-mentioned overexpression vector pCAMBIA1300-GFP-OsST1 or the above-mentioned engineered bacteria in improving the salt tolerance of rice or breeding salt-tolerant rice varieties.

[0019] Another object of the present invention is to provide a method for improving the salt tolerance of rice, by overexpressing the OsST1 gene, thereby improving the tolerance of rice to salt stress.

[0020] It can be seen from the above technical solutions that compared with the prior art, the present invention has the following beneficial effects:

[0021] This invention discloses the use of the OsST1 gene in regulating salt tolerance in rice. This discovery, published for the first time, reveals the OsST1 gene as a salt-tolerance regulator in rice, furthering the annotation of its function. Overexpression of the OsST1 gene improves rice tolerance to salt stress, demonstrating that the gene positively regulates high-salt stress in rice. This approach addresses the adverse effects of salinized soil on rice growth in practical applications, providing both social and economic benefits. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are merely embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying any creative work.

[0023] Figure 1 Figure 1: Linearized pCAMBIA1300-GFP vector map.

[0024] Figure 2 Figure 2: OsST1 protein expression levels in three homozygous transgenic lines OE-1, OE-2, and OE-5 and wild-type plants.

[0025] Figure 3 Figure 2: Salt tolerance assessment of OsST1 overexpressing plants. A: Growth of plants after treatment with 150 mM NaCl. B: Survival statistics of rice seedlings after 6 days of recovery.

[0026] Among them, Nip represents the wild-type Nipponbare, OE-1, OE-2, and OE5 represent OsST1-overexpressing plants; one star indicates a significant difference compared with the control, and two stars indicate a very significant difference compared with the control. DETAILED DESCRIPTION

[0027] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0028] The nucleotide sequence of the OsST1 gene is shown in SEQ ID No. 1:

[0029] ATGGTACTACCAGACTCCGTCCCTGAGAACCTGAAGGCCATTGACATTGTTGTCAACCATGAGAATGGAAAGAACTGTTCCATCAGAGTGAGGCTTGAGGCCATTGACAAGCTCAGGCTAGCTTGGAACACTAGCGTGCAGCCGGTGGCGGCCCCGCTGCTCCTCCGCATGAAGTCCGGCAAGGGCGCCCACCGCAGCGAGAACATCTTCTGGGAGACCACCATGGAGTCCACCATCTTCCTCGTCGACGACAACTCCTCCTCCTCCTGCGCCGGCGGCGGCGACGATGATTACCACTACCTCGACGCCTGCTTCCTCTGCAAGCGGGACATCACTTCAACCGCCACATCTTCATGTACAAGTACGGGGAACGTGGCGTTCTGCTGCGACGACTGCAGGCAGGACAAGATGGACATGGACTCCGCGCTCGCCGCCGTCAAGCGCCGCCACCGCACGCTGCAACGCAGCAGCAGGGACAGGTCGTCCTCCTCCTCGTCGGCGCCGGCGGAGGCACAGTGCGCCGACAACGAGGCGGGCCTCTTTGCGGTGATCCCCCGCCGCCCCACCGTCTCTGACCTCACCACCCACGCTGCTCCCGCCGTGTCTGGCTAG, SEQ ID No.1.

[0030] The amino acid sequence encoded by the OsST1 gene is shown in SEQ ID No.2:

[0031] MVLPDSVPENLKAIDIVVNHENGKNCSIRVRLEAIDKLRLAWNTSVQPVAAPLLLRMKSGKGAHRSENIFWETTMESTIFLVDDNSSSSCAGGGDDDYHYLDACFLCKRDITSTATSSCTSTGNVAFCCDDCRQDKMDMDSALAAVKRRHRTLQRSSRDRSSSSSSAPAEAQCADNEAGLFAVIPRRPTVSDLTTHAAPAVSG*, SEQ ID No.2.

[0032] Example 1

[0033] 1) Obtaining total RNA

[0034] Total RNA was extracted from the ears of japonica rice variety Nipponbare (stored at the Rice Research Institute of Guangdong Academy of Agricultural Sciences) using a plant RNA extraction kit (Magen). The purity and concentration of the RNA were detected using a NANODROP 2000C (Thermo SCIENTIFIC).

[0035] 2) Acquisition of total cDNA

[0036] 1 μg of high-quality RNA was reverse transcribed to obtain cDNA, and the reverse transcriptase was PrimeScript (TAKARA).

[0037] 3) Obtaining the full-length cDNA of the target gene

[0038] Design specific amplification primers based on the target gene, and use KOD FX polymerase (ToYoBo) to amplify the target gene using cDNA as a template. The specific amplification primer sequences are as follows:

[0039] F: 5'-CTGATTAACAGGGATCCCCCATGGTACTACCAGACTCC-3', SEQ ID No. 3;

[0040] R: 5'-TCGAGACTAGTGGTACCCCCGCCAGACACGGCGGGAGC-3', SEQ ID No. 4;

[0041] The amplification system was as follows: 0.5 μL cDNA (200 ng cDNA content), 0.5 μL F primer (10 pmol / L), 0.5 μL R primer (10 pmol / L), 2 μL 2 mM dNTPs, 15 μL 2* Buffer, 0.5 μL KOD enzyme (1.0 U / μL), and water added to 30 μL. The reaction procedure was: 98°C for 3 min; 35 cycles of 98°C for 30 sec, 60°C for 25 sec, and 68°C for 30 sec; and 68°C for 10 min.

[0042] 4) Construction of overexpression vector

[0043] The pCAMBIA1300-GFP vector was linearized with restriction endonuclease SmaⅠ (TAKARA). (The pCAMBIA1300-GFP vector was modified from the pCAMBIA1300 vector and contains the maize Ubiquitin promoter and GFP tag. It was preserved by the Rice Research Institute of Guangdong Academy of Agricultural Sciences. The vector map is shown in Figure 1The vector digestion products and PCR products were purified and recovered, then recombined using a recombination kit (Novozymes). The recombination system was as follows: target fragment (0.04 × insert base pair number) ng, vector fragment (0.02 × cloning vector base pair number) ng, 2 μL of 5X buffer, 1 μL of Exnase II, and water was added to make up to 10 μL. Recombination was incubated at 37°C for 30 min. The entire ligation product was transformed into Escherichia coli DH5α using CaCl2 and plated onto LB solid medium (containing kanamycin resistance at 50 mg / L kanamycin). The cells were cultured overnight at 37°C, and plasmids from 10 single colonies were extracted and identified by colony PCR. Two positive clones were selected for sequencing. The resulting overexpression vector, pCAMBIA1300-GFP-OsST1, containing the OsST1 target gene was obtained.

[0044] Example 2

[0045] 1) Obtaining OsST1 overexpressing plants

[0046] The overexpression vector pCAMBIA1300-GFP-OsST1 constructed above was transformed into the japonica rice variety Nipponbare using Agrobacterium tumefaciens EHA105-mediated genetic transformation. T0-generation transgenic seedlings were obtained through selective culture, differentiation, rooting, and hardening. (Genetic transformation material was obtained through a contract with Wuhan Boyuan Biotechnology Co., Ltd.)

[0047] DNA from the transgenic seedlings was extracted using a plant DNA extraction kit (Magen), and PCR was performed to amplify the GFP fragment. The specific amplification primer sequences are as follows:

[0048] F: 5'-CAAGCTGACCCTGAAGTTCA-3', SEQ ID No. 5;

[0049] R: 5'-ATGTGATCGCGCTTCTCGTT-3', SEQ ID No. 6;

[0050] The amplification system was as follows: 1 μL DNA (DNA content: 200 ng), 0.5 μL F primer (10 pmol / L), 0.5 μL R primer (10 pmol / L), 10 μL 2*Taq Mix, and water to 20 μL. The reaction procedure was: 95°C for 3 min; 30 cycles of 95°C for 30 sec, 52°C for 25 sec, and 72°C for 30 sec; and 72°C for 10 min.

[0051] The 20 positive transgenic seedlings were propagated to obtain T1 and T2 generations. If all T2 generation plants tested were transgenic, the strain was confirmed to be homozygous. Three homozygous transgenic lines (OE-1, OE-2, and OE-5) were selected for Western Blot analysis (using Nipponbare as a control) and further cultivated to obtain T3 generation plants, which were used for subsequent experimental analysis.

[0052] 2) Detection of OsST1 overexpression effect

[0053] Western Blot analysis of the overexpression effect of the OsST1 gene in transgenic plants was performed as follows:

[0054] A: Total protein was extracted from four-leaf rice leaves using the following extract: 0.1 M Tris-HCl (pH 8.0), 10% glycerol, 3.3% SDS, and 0.05% β-mercaptoethanol. The extracted total protein was stored at -80°C.

[0055] B: 20 ​​μL of protein sample was separated by SDS-PAGE gel electrophoresis, incubated with GFP antibody (Trans Company) and then detected by Western Blot.

[0056] Results: The expression levels of OsST1 protein in three homozygous transgenic lines and wild-type Nipponbare rice plants were as follows: Figure 2 As shown, all three strains accumulated OsST1-GFP fusion protein, while the wild-type plants did not show the target band. This result indicated that all three strains achieved the effect of overexpression of OsST1.

[0057] Example 3

[0058] Identification of salt-tolerance phenotype in plants overexpressing OsST1

[0059] Seeds of the three homozygous T3 lines (OE-1, OE-2, and OE-5) and wild-type Nipponbare rice from Example 2 were broken from dormancy at 49°C, soaked, and germinated. When they reached the three-leaf, one-heart stage under natural conditions, seedlings of wild-type Nipponbare and homozygous OsST1-overexpressing transgenic plants were transferred to a 150 mM NaCl solution for 8 days and then recovered under normal conditions for 6 days. Photos were taken and survival rates were calculated. Three biological replicates were performed for each material.

[0060] Result analysis: The results before and after treatment are shown in Figure 3 Middle A, after treatment with 150 mM NaCl, the growth status of the overexpression plants was significantly better than that of the control group Nipponbare.

[0061] Survival results are shown in Figure 3Middle B, after treatment with 150 mM NaCl, the average survival rates were: Nip: 8.3%; OE-1: 29.2%; OE-2: 45.8%; OE-5: 33.3%.

[0062] According to the above embodiments, the present invention obtains a gene OsST1 that plays an important role in the salt stress response process; we successfully transformed the OsST1 overexpression vector into rice through Agrobacterium-mediated transformation to obtain homozygous T3 generation transgenic rice plants; we found that under salt stress conditions, the survival rate of OsST1 overexpressing plants was significantly higher than that of wild-type Nipponbare; the above results indicate that the gene OsST1 in rice can improve rice's tolerance to salt stress.

[0063] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.

[0064] The above description of the disclosed embodiments is intended to enable one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be readily apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention is not limited to the embodiments shown herein but is intended to conform to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. The application of OsST1 gene is characterized by: The application is any of the following: (1) Application of overexpression of OsST1 gene in improving salt tolerance of rice; (2) Application in the breeding of salt-tolerant rice varieties; The nucleotide sequence of the OsST1 gene is shown in SEQ ID No.

1.

2. Use of the protein encoded by the OsST1 gene, characterized in that: The application is any of the following: (1) Application of overexpression of OsST1 gene in improving salt tolerance of rice; (2) Application in the breeding of salt-tolerant rice varieties; The amino acid sequence of the protein encoded by the OsST1 gene is shown in SEQ ID No.

2.

3. Use of the overexpression vector pCAMBIA1300-GFP-OsST1 comprising the OsST1 gene of claim 1 or an engineered bacterium comprising the OsST1 gene of claim 1 in improving the salt tolerance of rice or in breeding salt-tolerant rice varieties.

4. A method for improving salt tolerance of rice, characterized in that: The tolerance of rice to salt stress is improved by overexpressing the OsST1 gene; the nucleotide sequence of the OsST1 gene is shown in SEQ ID No. 1.

Images