An InDel molecular marker associated with growth traits in Haimen goats and its application

Abstract

This invention discloses an InDel molecular marker associated with growth traits in Haimen goats and its applications, belonging to the fields of biotechnology and livestock breeding. The InDel molecular marker is a 58bp ins mutation located at position 67616252bp in the genomic sequence of the PPP1R13B gene. This invention uses Haimen goat blood genomic DNA as a template and a direct sequencing method of PCR products to determine genotype. Haimen goats with the ID genotype exhibit excellent growth traits and can serve as an effective molecular marker for improving growth traits in Haimen goats. The detection method of this invention is simple, rapid, accurate, and inexpensive, which can improve the breeding efficiency of Haimen goats and has high application value.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and livestock breeding, and relates to an InDel molecular marker related to the growth traits of Haimen goats and its application. Background Technology

[0002] High-quality breeds are the foundation of modern livestock production. Strengthening the protection and utilization of breed resources and increasing the degree of improved breeds play a vital role in promoting the high-quality development of animal husbandry. Haimen goats are unique to Haimen, Jiangsu Province, and are excellent local breed resources, as well as a national-level protected livestock breed. Protecting the Haimen goat breed is of great significance for strengthening awareness of livestock breed protection, increasing local farmers' income, and promoting the high-quality development of my country's animal husbandry. Currently, the production performance of Haimen goats is not high, and their population size is small. Therefore, by strengthening the breeding of the Haimen goat breed to improve its quality and expand its population, it is possible to transform high-quality germplasm resources into advantageous economic benefits, thus promoting the high-quality development of modern animal husbandry in my country.

[0003] In livestock production, improving the growth performance of superior breeds of livestock and poultry significantly impacts economic benefits. Among these, weight, body length, height, chest circumference, chest depth, and chest width are crucial indicators of growth performance in Haimen goats. Therefore, improving these attributes is a key focus of Haimen goat research. Traditional breeding methods are time-consuming and inefficient, making it difficult to quickly and effectively improve goat growth performance. With the development of genetics and molecular biology, marker-assisted selection (MAS) technology offers a new approach to animal breeding. MAS eliminates the interference of environmental factors on phenotypic traits, directly selecting for target genotypes, effectively improving breeding efficiency, reducing the blind spots in the breeding process, and providing strong technical support for the selection of growth traits in Haimen goats.

[0004] The development of high-throughput sequencing technology has reduced the cost of InDel marker development (Varshney et al., 2009). As one of the most abundant polymorphic mutations, InDel is suitable for the development of genome-wide molecular markers (Gao et al., 2012). InDel, as a high-throughput molecular marker, combines the advantages of various genetic markers. Traditional molecular marker development is generally based on only one sequence, while InDel marker development is entirely based on sequence differences, resulting in fewer non-polymorphic sites during development. Compared with other molecular markers, the probability of InDel mutations of the same length occurring at the same locus in the genome is extremely small, and they can be considered to have the same origin (dentify-by-descent, IBD) (Shedlock & Okada, 2000). Therefore, InDel markers have high accuracy and stable variation, avoiding ambiguity in subsequent analyses due to specificity and complexity. Furthermore, InDel markers exhibit polymorphism both within and between species, demonstrating strong universality. (et al., 2008).

[0005] The PPP1R13B gene encodes a member of the ASPP (p53 apoptosis-stimulating protein) family of p53-interacting proteins. This protein contains four ankyrin repeat sequences and an SH3 domain involved in protein-protein interactions. ASPP proteins are essential for p53 family proteins to induce apoptosis. They promote DNA binding and transactivation of p53 family proteins at the promoters of pro-apoptotic genes. The expression of this gene is regulated by the E2F transcription factor (RefSeq, July 2008). However, no studies have yet reported molecular markers associated with growth traits in Haimen goats associated with the PPP1R13B gene. Summary of the Invention

[0006] In order to overcome the shortcomings of existing technologies in the breeding of growth traits in Haimen goats, the purpose of this invention is to provide an InDel molecular marker related to the growth traits of Haimen goats and its application.

[0007] To achieve the above objectives, the present invention adopts the following technical solution:

[0008] In a first aspect, the present invention claims protection for the use of InDel molecular markers associated with growth traits in Haimen goats, or substances for detecting InDel molecular markers associated with growth traits in Haimen goats, in any of the following:

[0009] (1) Screening and / or breeding Haimen goats with excellent growth traits;

[0010] (2) To prepare products for screening and / or breeding Haimen goats with excellent growth traits;

[0011] (3) Regulate the growth traits of Haimen goats;

[0012] The InDel molecular marker is a DNA molecule with a nucleotide sequence as shown in SEQ ID No. 1.

[0013] This invention screened an InDel molecular marker associated with growth traits in Haimen goats from the PPP1R13B gene. The sequence number of the PPP1R13B gene is NC_030828.1. The InDel molecular marker is a mutation located at position 67616252 bp of the PPP1R13B gene genomic sequence: TGAGGATTTGACCTTTTAATGAATACAAATCATAAGCATTGTATTTTCTGTTCTACAG ins (abbreviated as PPP1R13B 58bp ins). The results showed that different genotypes at the InDel molecular marker locus had a significant impact on the growth traits of Haimen goats. Haimen goats with the ID heterozygous genotype at the InDel molecular marker locus had significantly higher body length, body height, and chest depth than those with the DD and II homozygous genotypes at the InDel molecular marker locus.

[0014] Furthermore, the screening and / or breeding of Haimen goats with excellent growth traits involves using the aforementioned InDel molecular markers to identify and screen Haimen goats with excellent growth traits and then breeding them.

[0015] Furthermore, the substance contains (or is) PCR primers for amplifying genomic DNA fragments of Haimen goats, including the InDel molecular marker.

[0016] In a specific embodiment of the present invention, the PCR primers comprise an upstream primer F1 and a downstream primer R1;

[0017] Upstream primer F1: 5'-AGCATCTGGGATGATGCTTGTA-3' (SEQ ID No. 2);

[0018] Downstream primer R1: 5'-TTCTTCCCGTAAAGCCGCTC-3' (SEQ ID No. 3).

[0019] (The upstream primer F1 is a single-stranded DNA that specifically binds upstream of the InDel molecular marker in the genomic DNA of Haimen goat, and the downstream primer R1 is a single-stranded DNA that specifically binds downstream of the InDel molecular marker in the genomic DNA of Haimen goat.)

[0020] Furthermore, the growth traits of the Haimen goat include at least one of body length, body height, and chest depth.

[0021] Furthermore, the above application is to detect different genotypes of the InDel molecular marker sites in the genomic DNA of the blood of Haimen goats to be tested. The body length, body height, and chest depth of Haimen goats with the InDel molecular marker site being the ID heterozygous genotype are significantly higher than those of Haimen goats with the InDel molecular marker sites being the DD and II homozygous genotypes.

[0022] Secondly, the present invention claims a method for identifying the growth performance of Haimen goats, which detects different genotypes of the InDel molecular marker sites in the genomic DNA of the blood of Haimen goats to be tested, wherein the body length, body height and chest depth of Haimen goat individuals with the InDel molecular marker site being the ID heterozygous genotype are significantly higher than those of Haimen goat individuals with the InDel molecular marker sites being the DD and II homozygous genotypes.

[0023] Thirdly, this invention claims protection for a genetic breeding method for high-growth-performance Haimen goats, using the genomic DNA of the blood of the Haimen goat to be tested as a template, and performing PCR amplification using the aforementioned PCR primers; determining the genotype of the InDel molecular marker locus based on the PCR amplification product, and finding that Haimen goat individuals with the InDel molecular marker locus being ID heterozygous have significantly higher body length, body height, and chest depth than Haimen goat individuals with the InDel molecular marker locus being DD and II homozygous; retaining Haimen goat individuals containing the ID heterozygous genotype, and progressively improving the growth performance of Haimen goats.

[0024] In a specific embodiment of the present invention, the PCR amplification reaction system is 20 μL, comprising: 10 μL of 2×Taq PlusMaster Mix II; 0.6 μL each of forward and reverse primers; 1 μL of template DNA; and 7.8 μL of deionized water. The PCR amplification reaction program is as follows: 95℃ pre-denaturation for 5 min; 98℃ denaturation for 10 s, 55℃ annealing for 30 s, and 72℃ extension for 1 min, for a total of 35 cycles; 72℃ extension for 7 min; and storage at 4℃ after PCR.

[0025] Furthermore, the method for determining the genotype of the InDel molecular marker site based on the PCR amplification product is as follows: directly sequence or perform agarose gel electrophoresis on the PCR amplification product, and make a determination based on the sequencing results or agarose gel electrophoresis results.

[0026] The agarose gel electrophoresis results showed a clear band at 278 bp for Haimen goat individuals with the DD homozygous genotype (Haimen goat individuals without the InDel molecular marker), clear bands at both 278 bp and 336 bp for Haimen goat individuals with the ID heterozygous genotype (Haimen goat individuals with the InDel molecular marker), and a clear band at 336 bp for Haimen goat individuals with the II homozygous genotype (Haimen goat individuals with the InDel molecular marker).

[0027] Alternatively, the PCR amplification product can be directly sequenced, and the result can be determined based on the sequencing peak diagram: if both strands of the peak diagram at the target position have an added base, the individual is a Haimen goat with the II homozygous genotype; if only one strand of the peak diagram has an added base, the individual is a Haimen goat with the ID heterozygous genotype; and if no base is added to the peak diagram, the individual is a Haimen goat with the DD homozygous genotype.

[0028] Fourthly, the present invention claims protection for the aforementioned InDel molecular markers related to the growth traits of Haimen goats.

[0029] Fifthly, the present invention claims protection for a PCR primer or a kit containing the aforementioned InDel molecular markers associated with growth traits in Haimen goats. The specific sequences of the PCR primers are as described above.

[0030] Compared with the prior art, the present invention has the following beneficial effects:

[0031] This invention is the first to discover an effective InDel molecular marker in the PPP1R13B gene that influences the growth traits of Haimen goats. Using the kit provided by this invention, the genotype of the molecular marker is detected by PCR amplification and direct sequencing of the product. This method is simple, rapid, accurate, and inexpensive. Using the molecular marker of this invention to screen Haimen goats, retaining individuals with the ID heterozygous genotype and eliminating those with the DD and II homozygous genotypes, can progressively improve the growth traits of Haimen goats and accelerate their breeding progress, demonstrating high application value. Attached Figure Description

[0032] Figure 1 The results of 2% agarose gel electrophoresis of PCR amplification products of PPP1R13B 58bp ins in individuals of Haimen goats are shown. M represents DL2000 Plus DNA Marker, DD represents homozygous individuals at the PPP1R13B 58bp ins site, ID represents heterozygous individuals, and II represents homozygous mutant individuals.

[0033] Figure 2Sequencing diagram of the 58bp insPCR amplification product of PPP1R13B. Detailed Implementation

[0034] The technical solution of the present invention will be further described in detail below with reference to the embodiments and related drawings. However, it is worth noting that the embodiments of the present invention are not limited thereto, and those skilled in the art can implement them in other different forms without departing from the spirit and purpose of the present invention.

[0035] Example 1: Genotyping and Identification of the InDel Molecular Marker Site of the PPP1R13B Gene in Haimen Goats

[0036] 1. Collection of experimental animals and samples

[0037] The Haimen goats used in this experiment were sourced from Jiangsu Jinsheng Goat Breeding Technology Development Co., Ltd., totaling 210 individuals. All goats were healthy and raised under the same conditions and environment. 10 mL of blood was collected from each goat's jugular vein and placed in an anticoagulant tube containing EDTA, then stored at -20°C. Phenotypic information, including growth data, was collected for subsequent association analysis experiments.

[0038] 2. Main Instruments

[0039] Pipettes (Eppendorf), electronic balance (HENGJI), microwave oven (Galanz), refrigerator (Haier), handheld centrifuge (SCILOGEX, S1010E), vortex mixer (Dalong), digital display constant temperature water bath (Changzhou Putian, HH-G2), high-speed refrigerated centrifuge (Eppendorf, 5424R), micro spectrophotometer (NANODROP2000), PCR instrument (Applied Biosystems), electrophoresis apparatus (Beijing Liuyi, DYY-6C), fully automated digital gel imaging system (Tanon, Tanon-4100).

[0040] 3. Main reagents

[0041] TIANGEN Blood Genomic DNA Extraction Kit (Centrifuge Column), 50×TAE (Solarbio), agarose (BIOWEST), 2×Taq Plus Master MixⅡ (Dye Plus) (Vazyme, P213-03), 10000×TS-GelRed Nucleic Acid Gel Dye (TSINGKE, TSJ003), 100bp Ladder (CWBIO).

[0042] 4. Methods

[0043] 4.1 Extraction of genomic DNA from goat blood

[0044] Five hours in advance, remove the goat blood from the -20°C freezer and place it in a 4°C freezer to thaw. Once the blood is completely thawed, extract DNA from the whole blood according to the instructions of the TIANGEN Blood Genomic DNA Extraction Kit.

[0045] DNA concentration and quality were detected using a micro-spectrophotometer, including OD. 260 / 280 It should be between 1.80 and 2.00, OD 260 / 230 The value should be between 1.80 and 2.20. DNA samples that pass the test should be stored at -20°C.

[0046] 4.2 Primer Design for Candidate InDel Sites

[0047] Information on InDel sites related to the PPP1R13B gene was found using the Ensembl database (https: / / asia.ensembl.org / index.html), and genotyping primers were designed using Primer Premier 5 software. InDel site information and primer information are shown in Tables 1 and 2.

[0048] Table 1. InDel site information of PPP1R13B gene

[0049]

[0050] Table 2 Primer sequences for PPP1R13B InDel genotyping

[0051]

[0052]

[0053] 4.3 Validation of candidate InDel molecular marker sites primers

[0054] 4.3.1 Mixing Pool Preparation

[0055] Sixty DNA samples were randomly selected from 95 samples from Haimen goats and randomly divided into six groups of ten. One μL of each sample from each group was added to the same 1.5 mL centrifuge tube to prepare a DNA pool for subsequent verification of candidate InDel site polymorphisms and primers.

[0056] 4.3.2 Mixed-pool PCR amplification

[0057] (1) PCR amplification system (20 μL): 2×Taq Plus Master Mix II 10 μL; forward and reverse primers 0.6 μL each; template DNA 1 μL; deionized water 7.8 μL.

[0058] (2) PCR amplification program: 95℃ pre-denaturation for 5 min; 98℃ denaturation for 10 s, 55℃ annealing for 30 s, 72℃ extension for 1 min, for a total of 35 cycles; 72℃ extension for 7 min; after PCR, store at 4℃.

[0059] 4.3.3 Agarose gel electrophoresis of mixed-cell PCR products

[0060] (1) Preparation of 2% agarose gel: Measure 2g of agarose and 100mL of 1×TAE and pour them into an Erlenmeyer flask. Heat in a microwave oven on high for 3 minutes until the solution is clear and transparent; otherwise, extend the heating time appropriately. After standing until the solution is no longer hot to the touch, add 5μL of nucleic acid dye, mix thoroughly, pour onto a plate, and wait for solidification.

[0061] (2) After the agarose gel solidifies, the sample loading operation is performed. The PCR product loading volume is 10 μL and the DNA Marker loading volume is 4 μL. Gently place the agarose gel into the electrophoresis tank containing 1×TAE (the liquid level of 1×TAE should cover the gel surface), and perform electrophoresis at 140V 300mA for 35 min.

[0062] (3) After electrophoresis, the gel was transferred to a fully automated digital gel imaging system for observation.

[0063] The mixed-pool DNA was subjected to agarose gel electrophoresis, and the results are as follows: Figure 1 As shown in the figure. Agarose gel electrophoresis results showed a clear band at 278 bp, indicating the presence of no InDel marker in the Haimen goat individuals (DD homozygous genotype); two clear bands at 278 bp and 336 bp, indicating the presence of InDel marker in heterozygous Haimen goats (ID heterozygous genotype); and a clear band at 336 bp, indicating the presence of InDel marker in homozygous Haimen goats (II homozygous genotype). The results were consistent with the expected fragment size and showed no nonspecific bands, indicating good specificity of the two primer pairs, allowing for subsequent operations.

[0064] 4.4 Genotyping

[0065] 4.4.1 Sample PCR amplification

[0066] (1) PCR amplification system (20 μL): 2×Taq Plus Master Mix II 10 μL; forward and reverse primers 0.6 μL each; template DNA 1 μL; deionized water 7.8 μL.

[0067] (2) PCR amplification program: 95℃ pre-denaturation for 5 min; 98℃ denaturation for 10 s, 55℃ annealing for 30 s, 72℃ extension for 1 min, for a total of 35 cycles; 72℃ extension for 7 min; after PCR, store at 4℃.

[0068] 4.4.2 Sequencing of Sample PCR Products and Determination of Results

[0069] The PCR products were sent to Qingke Biotechnology for sequencing, and the sequencing results were compared and analyzed using SnapGene software.

[0070] The genotype of the PPP1R13B 58bp ins site was determined based on the sequencing peak diagram: When both strands of the target site showed an addition of a base, the genotype was II; when only one strand showed an addition of a base, the genotype was ID; and when no base was added, the genotype was DD. Figure 2 ).

[0071] The above results indicate that PCR amplification of Haimen goat genomic DNA using primer P1, followed by genotyping via direct sequencing, enables rapid and accurate identification of the InDel molecular marker site of the Haimen goat PPP1R13B gene.

[0072] Example 2: Statistical analysis of the InDel site polymorphism of the PPP1R13B gene and its relationship with growth traits in Haimen goats.

[0073] 1. Statistical analysis of population genetic parameters of PPP1R13B 58bp ins

[0074] Genotyping was performed on 95 Haimen goats using the primers and methods designed in Example 1, and population genetic parameters at the locus were calculated, including genotype frequency, allele frequency, homozygosity, heterozygosity, effective number of alleles, polymorphism information content, and Hardy-Weinberg equilibrium P-value.

[0075] The results are shown in Table 3. The PPP1R13B 58bp ins site in Haimen goats has three genotypes: DD, ID, and II. Among them, I is the dominant allele, which is low polymorphism (PIC<0.25) and conforms to Hardy-Weinberg equilibrium (P>0.05).

[0076] Table 3. Population genetic parameters of PPP1R13B gene

[0077]

[0078] 2. Association between PPP1R13B 58bp ins and growth traits of Haimen goats

[0079] Using SAS (9.4) software and the GLM program, least squares statistical analysis was performed to analyze the association between different genotypes of PPP1R13B 58bpins and growth traits of Haimen goats.

[0080] Using gender as a fixed effect, the model is: Y ijk =μ+Gi +S j +e ijk In the formula, Y ijk Individual weight and body size phenotypic values; μ is the population mean; G i Genotype effect; S j For fixed effects; e ijk This is random error.

[0081] 2.1 Correlation analysis between PPP1R13B 58bp ins and growth traits of Haimen goats

[0082] Fixed effects other than genotype effects that were not significantly associated with individual phenotypic values ​​were removed. Association analysis was performed between the InDel locus of the PPP1R13B gene and the number of lambs born in Haimen goats. The results are expressed as "least square mean ± standard error".

[0083] The results are shown in Table 4. The PPP1R13B 58bp ins had a significant effect on the growth traits of Haimen goats. The body length, body height, and chest depth of Haimen goats with the InDel molecular marker site being the ID heterozygous genotype were significantly higher than those with the InDel molecular marker sites being the DD and II homozygous genotypes.

[0084] Table 4. Association between the InDel locus of the PPP1R13B gene and growth traits in Haimen goats.

[0085]

[0086] Note: Different lowercase letters in the same column indicate significant differences (P < 0.05).

[0087] Example 3: Method for improving growth traits of Haimen goats

[0088] The main methods for improving the growth traits of Haimen goats include the following steps:

[0089] 1. Collect blood samples from the Haimen goats to be tested and extract genomic DNA from the blood.

[0090] 2. Using primer P1 as described in Example 1, PCR amplification was performed with blood genomic DNA as a template, and the genotype was determined by direct sequencing of the PCR amplification products.

[0091] in:

[0092] (1) PCR amplification system (20 μL): 2×Taq Plus Master Mix II 10 μL; forward and reverse primers 0.6 μL each; template DNA 1 μL; deionized water 7.8 μL.

[0093] (2) PCR amplification program: 95℃ pre-denaturation for 5 min; 98℃ denaturation for 10 s, 55℃ annealing for 30 s, 72℃ extension for 1 min, for a total of 35 cycles; 72℃ extension for 7 min; after PCR, store at 4℃.

[0094] (3) Sequencing: The PCR product and primer P1 were sent to Qingke Biotechnology Co., Ltd. for direct sequencing.

[0095] (4) Genotype determination: The PPP1R13B 58bp ins sequencing peaks were compared and analyzed using SnapGene software. When both strands of the peak at the target position had an added base, the genotype was II; when only one strand had an added base, the genotype was ID; and when no base was added, the genotype was DD. Figure 2 ).

[0096] 3. The ID genotype of PPP1R13B 58bp ins can serve as an effective molecular marker for improving the growth traits of Haimen goats.

[0097] Selecting individuals with the ID genotype as parents in Haimen goat breeding can improve the growth traits of offspring.

[0098] By using the InDel molecular marker of this invention to screen Haimen goats, retaining individuals with the ID genotype for genetic selection, and eliminating individuals with the DD and II genotypes, the breeding goal of improving the growth performance of Haimen goats can be achieved.

Claims

1. The application of substances containing InDel molecular markers associated with growth traits in Haimen goats in any of the following: (1) Screening and / or breeding Haimen goats with excellent growth traits; (2) To prepare products for screening and / or breeding Haimen goats with excellent growth traits; The InDel molecular marker is a DNA molecule with a nucleotide sequence as shown in SEQ ID No. 1; The substance is a PCR primer for amplifying the InDel molecularly labeled Haimen goat genomic DNA fragment; the PCR primer consists of an upstream primer F1 and a downstream primer R1; Upstream primer F1: 5'-AGCATCTGGGATGATGCTTGTA-3'; Downstream primer R1: 5'-TTCTTCCCGTAAAGCCGCTC-3'; The growth traits of the Haimen goat mentioned above are at least one of body length, body height, and chest depth; Heterozygous individuals containing the InDel molecular marker had significantly higher body length, body height, and chest depth than individuals without the InDel molecular marker and homozygous individuals containing the InDel molecular marker.

2. A method for evaluating the growth performance of Haimen goats, characterized in that: Using the genomic DNA of the blood of the Haimen goat to be tested as a template, PCR amplification was performed using the PCR primers described in claim 1; The genotype of the InDel molecular marker site is determined based on the PCR amplification product. The method for determining the genotype of the InDel molecular marker site based on the PCR amplification product is as follows: directly sequence or perform agarose gel electrophoresis on the PCR amplification product, and make a determination based on the sequencing results or agarose gel electrophoresis results. The agarose gel electrophoresis results showed a clear band at 278 bp for individuals with the DD homozygous genotype, clear bands at both 278 bp and 336 bp for individuals with the ID heterozygous genotype, and a clear band at 336 bp for individuals with the II homozygous genotype. Alternatively, the PCR amplification product can be directly sequenced, and the sequence peaks can be used to determine the individual: if both strands at the target position have a single base added, the individual is a Haimen goat with the II homozygous genotype; if only one strand has a single base added, the individual is a Haimen goat with the ID heterozygous genotype; if no single base is added, the individual is a Haimen goat with the DD homozygous genotype; the single base is a DNA molecule as shown in SEQ ID No.

1. The body length, body height, and chest depth of Haimen goats with the InDel molecular marker locus being the ID heterozygous genotype were significantly higher than those of Haimen goats with the InDel molecular marker locus being the DD and II homozygous genotypes.

Images