Application of VISTA gene as an early diagnosis marker for primary liver cancer

Abstract

The application provides application of a VISTA gene as an early diagnosis marker of primary liver cancer, and belongs to the technical field of biological medicine. The application finds that inhibition of VISTA gene expression can effectively inhibit the proliferation and clone formation of liver cancer, and overexpression of the VISTA gene can significantly enhance the proliferation and clone formation of liver cancer. BRD4 is an upstream regulator of VISTA, and after overexpression of BRD4, the VISTA protein level is obviously increased, and after knockdown of BRD4, the VISTA protein level is obviously decreased. MMP11 is a downstream substrate of VISTA, and VISTA regulates MMP11 at the transcriptional level and the protein level, and after overexpression of VISTA, the expression level of MMP11 is obviously increased, and after knockdown of VISTA, the expression level of MMP11 is obviously decreased. BRD4 regulates the mRNA transcription of MMP11 by regulating the expression of VISTA, and then affects the occurrence of primary liver cancer.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biological medicine, and particularly relates to application of a VISTA gene as an early diagnosis marker for primary liver cancer. BACKGROUND

[0002] Primary liver cancer is the fourth leading cause of cancer death worldwide. At present, there is no cure due to the lack of donor livers and tumor heterogeneity, so it is urgent to study the deep mechanism of liver cancer and explore new potential tumor treatment targets. VISTA is a new immunotherapy target, but little is known about the non-immune checkpoint function of VISTA in liver cancer. SUMMARY

[0003] Therefore, the purpose of the present application is to provide application of a VISTA gene as an early diagnosis marker for primary liver cancer.

[0004] In order to achieve the above-mentioned purpose of the application, the present application provides the following technical solutions:

[0005] The present application provides application of a reagent for detecting expression of a VISTA gene in the preparation of a product for early diagnosis / prognosis prediction of primary liver cancer.

[0006] Preferably, the product comprises a chip or a kit.

[0007] The present application also provides application of a reagent for knocking down expression of a VISTA gene in the preparation of a drug for treating and / or preventing primary liver cancer.

[0008] The present application also provides application of a liver cancer cell strain with knocked down expression of a VISTA gene in the preparation of a drug for treating and / or preventing primary liver cancer.

[0009] The present application also provides application of a reagent for knocking down expression of a BRD4 gene in the preparation of a drug for treating and / or preventing primary liver cancer.

[0010] Compared with the prior art, the present application has the following beneficial effects:

[0011] The present application first discovers that the VISTA gene is up-regulated in liver cancer, and the overall survival of liver cancer patients with high expression of the VISTA gene is significantly reduced, which indicates that detection of the expression level of the VISTA gene can become one of the auxiliary diagnostic indicators for liver cancer diagnosis, and the VISTA gene with high expression as a diagnostic factor for liver cancer has high accuracy.

[0012] The application also finds that inhibiting the expression of the VISTA gene can effectively inhibit the proliferation and clonal formation of liver cancer, and overexpression of the VISTA gene can significantly enhance the proliferation and clonal formation of liver cancer, therefore, interfering with the expression of the VISTA gene can become a new way for preventing or treating liver cancer, and provides a new idea for the development of related drugs in the later stage and clinical treatment.

[0013] The application also finds that BRD4 is an upstream regulatory factor of VISTA, the protein level of VISTA is obviously increased after overexpression of BRD4, and the protein level of VISTA is obviously decreased after knockdown of BRD4; MMP11 is a downstream substrate of VISTA, VISTA regulates MMP11 at the transcriptional level and the protein level, the expression level of MMP11 is obviously increased after overexpression of VISTA, and the expression level of MMP11 is obviously decreased after knockdown of VISTA. BRD4 regulates the mRNA transcription of MMP11 by regulating the expression of VISTA, and then affects the occurrence and development of primary liver cancer. BRIEF DESCRIPTION OF DRAWINGS

[0014] Figure 1 is a VISTA protein level result graph of tumor sites of liver cancer patients in a TCGA database;

[0015] Figure 2 is a VISTA mRNA level result graph of tumor sites of liver cancer patients in a TCGA database;

[0016] Figure 3 is a VISTA protein level result graph of human clinical liver cancer samples;

[0017] Figure 4 is a VISTA mRNA level result graph of human clinical liver cancer samples;

[0018] Figure 5 is a result graph of detecting the expression level of VISTA in human liver cancer tissue samples by using an immunological chemical staining technology;

[0019] Figure 6 is a result graph of performing VISTA immunohistochemical staining on tumor tissues of liver cancer patients, and performing joint analysis of the survival cycle of the patients according to the area and intensity of the staining particles;

[0020] Figure 7 is a result graph of Western blotting experiment of human liver cancer cell lines PLC-5 and Huh7 with stable knockdown of VISTA protein constructed by using PLVX-shRNA-VISTA;

[0021] Figure 8Figure 1 is a Western blotting result of using pLVX-EFla-IRES-Puro-VISTA to construct a human liver cancer cell line PLC-5 and Huh7 stably overexpressing VISTA protein;

[0022] Figure 9 Figure 2 is a result graph of the proliferation ability of human liver cancer cell line PLC-5 after knocking down VISTA;

[0023] Figure 10 Figure 3 is a result graph of the proliferation ability of human liver cancer cell Huh7 after knocking down VISTA;

[0024] Figure 11 Figure 4 is a result graph of the proliferation ability of human liver cancer cell PLC-5 after overexpressing VISTA;

[0025] Figure 12 Figure 5 is a result graph of the proliferation ability of human liver cancer cell Huh7 after overexpressing VISTA;

[0026] Figure 13 Figure 6 is a result graph of the colony formation ability of human liver cancer cell line PLC-5 and Huh7 after knocking down VISTA and overexpressing VISTA;

[0027] Figure 14 Figure 7 is a result graph of the cell proliferation ability after overexpressing VISTA gene and knocking down VISTA gene detected by EDU experiment;

[0028] Figure 15 Figure 8 is the protein level and mRNA level of VISTA in PLC-5 and Huh7 two liver cancer cell lines stimulated by JQ1 for different times;

[0029] Figure 16 Figure 9 is the protein level and mRNA level of VISTA in PLC-5 and Huh7 two liver cancer cell lines stimulated by different concentrations of JQ1;

[0030] Figure 17 Figure 10 is the protein level and mRNA level of VISTA in PLC-5 and Huh7 two liver cancer cell lines after knocking down BRD4;

[0031] Figure 18 Figure 11 is the mRNA level of VISTA in PLC-5 and Huh7 two liver cancer cell lines after overexpressing BRD4;

[0032] Figure 19 Figure 12 is a result graph of cell immunofluorescence analysis after overexpressing BRD4;

[0033] Figure 20 Figure 13 is the protein level of VISTA after overexpressing BRD4-BD1 and BRD4-BD2;

[0034] Figure 21 is a chromatin immunoprecipitation experiment result chart for verifying that BRD4 binds to the promoter of the VISTA gene;

[0035] Figure 22 is a result chart of protein expression level of MMP11 in tumor site of liver cancer patients in TCGA database;

[0036] Figure 23 is a result chart of correlation analysis between VISTA and MMP11 expression in liver cancer samples in TCGA database;

[0037] Figure 24 is a result chart of immunofluorescence experiment of VISTA and MMP11 co-localization;

[0038] Figure 25 is protein level and mRNA level of MMP11 after VISTA knockdown;

[0039] Figure 26 is protein level and mRNA level of MMP11 after VISTA overexpression;

[0040] Figure 27 is a result chart of cell immunofluorescence experiment after VISTA overexpression;

[0041] Figure 28 is protein expression level of VISTA and MMP11 in two liver cancer cell lines after BRD4 knockdown;

[0042] Figure 29 is protein expression level of VISTA and MMP11 in two liver cancer cell lines after BRD4 overexpression;

[0043] Figure 30 is a result chart of detecting protein level of MMP11 after overexpressing BRD4 in two liver cancer cell lines PLC-5 and Huh7 with stable VISTA knockdown;

[0044] Figure 31 is a chromatin immunoprecipitation experiment result chart for verifying that VISTA binds to the promoter of the MMP11 gene. DETAILED DESCRIPTION

[0045] The application provides application of a reagent for detecting expression amount of a VISTA gene in preparation of a product for early diagnosis / prognosis prediction of primary liver cancer. In the application, the product comprises a chip or a kit.

[0046] The application further provides application of a reagent for knocking down expression of a VISTA gene in preparation of a medicine for treating and / or preventing primary liver cancer.

[0047] The application further provides application of the liver cancer cell strain with knocked down VISTA gene expression in preparation of a medicine for treating and / or preventing primary liver cancer.

[0048] The application further provides application of the reagent with knocked down BRD4 gene expression in preparation of a medicine for treating and / or preventing primary liver cancer.

[0049] The technical solutions provided by the application are described in detail below in combination with examples, but they should not be understood as limitations to the protection scope of the application.

[0050] Example 1

[0051] Verification of expression level of VISTA in liver cancer tissues

[0052] I. Statistical analysis of TCGA database data shows that the VISTA protein level ( Figure 1 ) and mRNA level ( Figure 2 ) of liver cancer patients are significantly high.

[0053] II. Western blotting is performed on liver tissues near and in the cancer of clinical patients, and it is found that the protein level ( Figure 3 ) and mRNA level ( Figure 4 ) of VISTA in the cancer of liver cancer patients are significantly high.

[0054] III. Immunohistochemical staining is performed on 90 pairs of cancer tissues and tissues near the cancer of liver cancer patients, and the specific steps are as follows:

[0055] 1. Dewaxing and rewetting: place the slices in a 62℃ oven for 1 hour, then perform 10min dewaxing treatment in environmentally friendly dewaxing liquids 1 and 2, and then perform 3min rewetting treatment in 100% ethanol, 95% ethanol, 85% ethanol, 75% ethanol, 50% ethanol and double-distilled water, respectively;

[0056] 2. Antigen repair: place the slices in 1mM EDTA and antigen repair liquid containing 0.05% Tween, heat to 95℃ for 20min, then take out and place at room temperature, and then wash with PBS solution for 3 times, each for 3min;

[0057] 3. Quenching endogenous peroxidase: place the slices in 3% hydrogen peroxide solution for 10min, and then wash with PBS for 3 times, each for 3min;

[0058] 4. Blocking: use 3% bovine serum albumin solution (abbreviated as BSA, prepared with PBS solution) for blocking for 10min;

[0059] 5. Incubate the first antibody: remove the blocking solution on the slide, add 100 μL of VISTA first antibody (1:100) and BRD4 first antibody (1:100) on the section tissue, and incubate in a wet box at 4°C overnight;

[0060] 6. Incubate the second antibody: warm up at room temperature for 15 min, then wash with PBS for 3 times, each for 3 min. Then add the horseradish peroxidase-labeled second antibody (proteintech company, ready-to-use HRP-labeled goat anti-mouse / rabbit second antibody), incubate at room temperature for 30 min, and wash with PBS for 3 times, each for 3 min;

[0061] 7. DAB staining: develop with DAB developing solution, and the staining time is about 3 min (determine the staining time according to the specific staining degree);

[0062] 8. Hematoxylin staining: put into hematoxylin solution for 5 min (determine the specific staining time according to the specific staining degree), terminate the staining in tap water, then differentiate in 1% hydrochloric acid ethanol solution (75% ethanol, volume ratio) for 3 s, and return to blue in tap water for about 1 h;

[0063] 9. Dehydration, transparency, and sealing with neutral resin sealing agent: dehydrate in 50% ethanol, 75% ethanol, 85% ethanol, 95% ethanol, and 100% ethanol for 3 min respectively, then use dewaxing solution 1 and 2 for transparency for 10 min respectively, take out, wipe and dry, and then seal with neutral resin sealing agent;

[0064] 10. Take pictures under a microscope, then statistically score, and analyze the survival rate of VISTA correlation according to the score and patient information of the tissue source.

[0065] Experimental results: it is found that VISTA is highly expressed in human liver cancer tissue samples Figure 5 , and is negatively correlated with the prognosis of patients Figure 6 .

[0066] Example 2

[0067] Construction of VISTA gene overexpression, knockdown recombinant lentivirus vector and expression verification

[0068] I. Construction of VISTA gene overexpression recombinant lentivirus vector

[0069] 1. Design PCR primers: Find the full-length coding sequence of VISTA in humans in NCBI, use Primer 5 software to design related primers, select pLVX-EF1a-IRES-Puro (P0405, Mlin plasmid) as a vector, according to the VISTA sequence and the enzyme digestion site of the vector, add a FLAG tag protein sequence in the primer, and design appropriate PCR primers. The primer sequences are as follows:

[0070] VISTA-EcoRI-forward:

[0071] CGGAATTCATGGGAGACTACAAGGACGATGATGACAAGATGGGCGTCCCCA (SEQ ID NO: 1)

[0072] VISTA-Xba I-reverse: CTAGTCTAGACTAGATGACCTCAAAGTTTGGAGA (SEQ ID NO: 2)

[0073] 2. Perform VISTA fragment amplification: Use the cDNA obtained by reverse transcription of the total RNA of human liver cancer cells PLC-5 as a template to amplify the VISTA fragment by PCR.

[0074] The PCR amplification system (50 μl system) is as follows:

[0075] High-fidelity DNA polymerase 1 μl

[0076] 5x SF buffer 10 μl

[0077] Primer mix (10 μM) 4 μl

[0078] cDNA 2 μl

[0079] dNTP (10 uM) 1 μl

[0080] ddH2O 32 μl

[0081] PCR reaction, program as follows:

[0082] (1) Pre-denaturation 95°C for 3 min

[0083] (2) Denaturation 95°C for 30 s

[0084] (3) Annealing 60°C for 20 s

[0085] (4) Extension 72°C for 30 s

[0086] (2)-(4) Step reaction for 35 cycles

[0087] Continue to extend: 72°C for 10 min.

[0088] 3. Identification and gel recovery: The PCR product was subjected to agarose gel electrophoresis, and the target band was recovered. The agarose gel recovery kit (TIANgen Company) was used for gel recovery, and the detailed steps were referred to the kit instructions.

[0089] 4. Enzymatic digestion and enzyme connection: The PCR product and the lentiviral vector pLVX-EF1a-IRES-Puro were subjected to double enzyme digestion at 37°C using restriction endonuclease EcoR I and Xba I, respectively. The enzyme digestion system was as follows:

[0090] PCR product enzyme digestion system:

[0091] EcoR I and Xba I, 1 μl each

[0092] 2×Tango buffer 4 μl

[0093] Gel recovery PCR product 14 μl.

[0094] Lentiviral vector enzyme digestion system:

[0095] EcoR I and Xba I, 1 μl each

[0096] 2×Tango buffer 4 μl

[0097] Lentiviral vector: 1 μg

[0098] Double-distilled water was added to 20 μl. Enzymatic digestion was performed at 37°C overnight.

[0099] The double enzyme digestion product was purified using the universal DNA purification kit (TIANgen Company).

[0100] The purified product was subjected to enzyme connection.

[0101] Enzyme connection system (20 μl):

[0102] Lentiviral vector purified product 5 μl

[0103] PCR fragment purified product 12 μl

[0104] T4 ligase 1 μl

[0105] T4 ligase buffer (10×) 2 μl;

[0106] Enzyme connection was performed at 16°C overnight.

[0107] 5. Transformation

[0108] (1) In a clean and sterile centrifuge tube, add 20 μl of the above-mentioned ligation product and 30 μl of competent cells, and mix gently by blowing, and place on ice for 30 min.

[0109] (2) After the above-mentioned step is completed, place the centrifuge tube with the target product after the above-mentioned treatment in a 42°C water bath for 90 s, and then place on ice for 5 min.

[0110] (3) Add 500 μl of LB liquid medium without antibiotics to the above-mentioned centrifuge tube, and incubate at 37°C, 200 rpm for 60 min.

[0111] (4) Centrifuge at 3000 rpm for 5 min, and mix the bacteria with a small amount of supernatant.

[0112] (5) Uniformly drop the above-mentioned bacterial solution onto an LB plate, and evenly spread it with a sterile spreading rod, and incubate at 37°C for about 14 h (according to the growth of the colonies, it can be appropriately extended).

[0113] 6. Identification: After the recovery plate, about 50-100 colonies are generated, and 10 μl of the gun head is used to pick a single growing colony into 10 μl of sterile water, and gently blow to serve as a PCR template for colony PCR identification.

[0114] The PCR system is as follows:

[0115] DNA polymerase Taq 1 μl

[0116] 10×Taq buffer 2 μl

[0117] Primer mix (10 μM) 2 μl

[0118] Bacterial template 4 μl

[0119] dNTP (10 μM) 1 μl

[0120] ddH2O to 20 μl.

[0121] Perform agarose gel electrophoresis, and add the target bacterial solution with positive PCR results to 8 ml of liquid LB medium containing antibiotics, and incubate at 37°C, 200 rpm for about 16 h, and then use a plasmid small extraction kit (TIANGEN company) to extract the plasmid.

[0122] The target plasmid is subjected to PCR and agarose gel electrophoresis identification.

[0123] The PCR system is as follows:

[0124] DNA polymerase Taq 1 μl

[0125] 10×Taq buffer 2 μl

[0126] Primer (10 μM) 1 μl each

[0127] Plasmid 100 ng

[0128] dNTP (10 μM) 1 μl

[0129] ddH2O up to 20 μl.

[0130] The plasmid with positive PCR result was sequenced (Genescript) to ensure that the constructed pLVX-EF1a-IRES-Puro-VISTA plasmid had no mutation and the sequence was completely correct.

[0131] II. VISTA knockdown recombinant lentivirus vector acquisition: PLVX-shRNA-VISTA was purchased from Yobio

[0132] Stable cell line construction:

[0133] 1. Cell preparation: 293T cells were cultured in DMEM medium containing 10% fetal bovine serum and passaged;

[0134] 2. Cell plating: well-grown 293T cells were plated at a density of 60%-70% in a 10 cm culture dish;

[0135] 3. Transfection: 12 hours after plating, the culture medium was replaced with serum-free medium.

[0136] III. Transfection system:

[0137] 1. VISTA gene overexpression recombinant lentivirus vector pLVX-EF1a-IRES-Puro-VISTA transfection system:

[0138] Serum-free medium 200 μl

[0139] pLVX-EF1a-IRES-Puro-VISTA plasmid 12 μg

[0140] VSVG packaging plasmid 9 μg

[0141] DR packaging plasmid 6 μg

[0142] Lipo 8000 transfection reagent 54 μl

[0143] 2. VISTA knockdown recombinant lentivirus vector PLVX-shRNA-VISTA system:

[0144] Serum-free medium 200 μl

[0145] PLVX-shRNA-VISTA plasmid 12 μg

[0146] VSVG packaging plasmid 9 μg

[0147] DR packaging plasmid 6 μg

[0148] Lipo 8000 transfection reagent 54 μl

[0149] After mixing, gently add to 293T cell culture dish, continue normal cell culture.

[0150] Four, lentivirus packaging

[0151] After transfection 6-8h, replace the culture medium with DMEM medium containing 10% fetal bovine serum, continue to culture, pay close attention to the color change of the culture medium during the culture period, add the appropriate amount of culture medium in time to keep the culture medium PH value at a normal level, after transfection 72h, filter the culture medium supernatant with 4.5 μm diameter sterile filter to obtain lentivirus supernatant containing pLVX-EF1a-IRES-Puro-VISTA and PLVX-shRNA-VISTA.

[0152] Five, lentivirus infection and screening

[0153] Human hepatoma cells Plc-5, Huh7 (purchased from American ATCC cell bank) were cultured with DMEM medium containing 10% fetal bovine serum, and the cells in good growth condition were plated in 6cm cell culture dish at a density of 60%-70%, after 12h of plating, 3ml of lentivirus suspension was added, and polybrene (final concentration 10 μg / ml, greatly enhancing the infection efficiency) was added. After 48h of infection, the culture medium was replaced with 10% DMEM medium containing puromycin (final concentration 1 μg / ml) for screening, and the human hepatoma cells not infected with lentivirus would be killed, and after 72h of screening, the surviving cells were pLVX-EF1a-IRES-Puro-VISTA and PLVX-shRNA-VISTA stable transfection cell lines.

[0154] Six, Western blotting experiment on stable cell lines:

[0155] 1. Collect cells and extract protein: Collect the stably transfected cells cultured in 6 cm dishes by trypsinization, PBS washing, and centrifugal precipitation, and then collect the cells in 1.5 ml centrifuge tubes. Add 400 μl RIPA solution and 1 mM PMSF to the cell precipitate, and lyse the cells at 4°C for 30 minutes. Centrifuge at 4°C and 12000 rpm for 10 minutes, take out 1 μl supernatant, and perform BCA quantification on the protein sample. Add 6x protein loading buffer according to the volume of the supernatant, mix thoroughly, and boil in a metal bath at 95°C for 15 minutes. After cooling, divide the sample and store it at -80°C.

[0156] 2. SDS-PAGE gel electrophoresis

[0157] (1) Prepare 10% SDS-PAGE gel separation gel.

[0158] Separation gel formula:

[0159] 4 ml ultrapure water

[0160] 3.3 ml 30% acrylamide

[0161] 2.5 ml 1.5 M Tris-HCL (pH 8.8)

[0162] 100 μl 10% SDS

[0163] 100 μl 10% ammonium persulfate

[0164] 4 μl TEMED separation gel

[0165] After the separation gel is solidified, add the concentrated gel and gently insert the comb into the concentrated gel formula:

[0166] 2.1 ml ultrapure water

[0167] 0.5 ml 30% acrylamide

[0168] 0.38 ml 1.0 M Tris-HCL (pH 6.8)

[0169] 30 μl 10% SDS

[0170] 30 μl 10% ammonium persulfate

[0171] 3 μl TEMED

[0172] After the gel is condensed, the comb is gently pulled out and placed in the electrophoresis tank. The protein sample and protein standard molecular weight marker are added to different lanes of the gel. The protein sample is supplemented with 1x protein loading buffer. The electrophoresis is performed at a constant voltage of 80v. After the sample is electrophoresed beyond the condensed gel, the electrophoresis is performed at a constant voltage of 120v. When the bromophenol blue is electrophoresed to the bottom of the gel, the electrophoresis is stopped.

[0173] (2) Transferring: In the transferring clamp, the transferring sponge pad (without filter paper), the gel, the PVDF membrane (activated with methanol), the transferring sponge pad (without filter paper) are sequentially placed from the negative electrode to the positive electrode. The bubbles between the gel and the PVDF membrane are removed. The transferring is performed in the transferring tank using the transferring solution. The transferring is performed on ice at a constant voltage of 80v for a time determined by the molecular weight (1 min / kDa).

[0174] (3) Blocking: The blocking is performed using 5% skimmed milk (prepared in PBST solution) at room temperature for 60 min using a shaker at a slow speed.

[0175] (4) Incubating the primary antibody and the secondary antibody: The primary antibody diluent is prepared according to the following formula:

[0176] Fetal bovine serum: 3g

[0177] 10% sodium azide: 200ul

[0178] The PBST is added to 100ml.

[0179] The primary antibody is diluted to a working concentration according to the primary antibody diluent at 1:1000. The target band is incubated in the diluted primary antibody in a refrigerator at 4℃ for 16h. After the incubation, the primary antibody is recovered. The secondary antibody diluted with 5% skimmed milk (1:5000) is added. The secondary antibody is incubated in a refrigerator at 4℃ for 1h. After the incubation, the secondary antibody is recovered. The secondary antibody is washed with the PBST solution on a shaker at a fast speed for 3 times, each time for 5 min.

[0180] (5) Color development: The western Lumaxl Light Peroxide A and B are mixed at a ratio of 1:1 to prepare a working solution. The working solution is applied to the target band. The color development is performed on an exposure instrument. The picture is saved.

[0181] Experimental results: After the infection of PLVX-shRNA-VISTA, the VISTA protein expression of the human liver cancer cells is obviously reduced ( Figure 7 ). After the infection of pLVX-EF1a-IRES-Puro-VISTA, the VISTA protein expression of the human liver cancer cells is obviously increased ( Figure 8 ).

[0182] Example 3

[0183] Verification of the effect of VISTA on the proliferation ability on the stable cell line

[0184] I. Cell proliferation detection

[0185] The well-grown stable cell line cells were plated in 96-well plates at a number of 1000 per well, and three repeated control groups were set up. The plated cells were Plc-5 and Huh7 cells overexpressing pLVX-EF1a-IRES-Puro-VISTA, knockdown expressing PLVX-shRNA-VISTA, and pLVX-EF1a-IRES-Puro, respectively. The CCK kit (Bi Yun Tian) was used to detect the proliferation ability of the Plc-5 and Huh7 stable cell lines. The culture medium was replaced every 24 h, CCK8 was added according to the kit instructions, and the absorbance was detected at λ = 450 nm using an enzyme marker after 2 h of continuous culture. The data were collected and statistically analyzed.

[0186] Experimental results: it can be seen that the proliferation of human liver cancer cells is inhibited after knockdown of VISTA ( Figure 9 and Figure 10 ), and the proliferation ability of human liver cancer cells is enhanced after overexpression of VISTA ( Figure 11 and Figure 12 ).

[0187] II. Cloning experiment

[0188] Different stable cells were plated in six-well plates at the same number of 400-800, and the plated cells were Plc-5 and Huh7 cells overexpressing pLVX-EF1a-IRES-Puro-VISTA, knockdown expressing PLVX-shRNA-VISTA, and pLVX-EF1a-IRES-Puro (empty vector), respectively. The culture medium was replaced once every 2-3 days. After about two weeks, 4% paraformaldehyde was used for fixation for 30 min, and 0.05% crystal violet was used for staining for 20 min. The six-well plates after staining were washed with double distilled water, air-dried, and then observed and photographed for analysis of the results.

[0189] Experimental results: it can be seen that the proliferation ability of human liver cancer cells is enhanced after overexpression of VISTA, and the proliferation ability of human liver cancer cells is weakened after knockdown of VISTA ( Figure 13 ).

[0190] III. EDU detection of cell proliferation

[0191] (1) Cell preparation: Lysine-coated small discs were placed at the bottom of a 6-well culture plate, sterilized by ultraviolet irradiation for 30 minutes, and then logarithmically growing human hepatoma cell stable cell line PLC-5 and Huh7 were trypsinized, centrifuged, and the supernatant was discarded. The cells were resuspended in culture medium, and the cells were blown into a single cell suspension. 2 x 10 5 cells were inoculated in each well of a 6-well culture plate, and the cells were evenly attached to the small discs.

[0192] (2) EDU labeling: First, dilute the EDU solution with cell culture medium at a ratio of 1000: 1 to prepare an appropriate amount of 50 μM EDU. Add 100 μL of 50 μM EDU to each well, incubate for 2 h, and then replace the culture medium with PBS. Wash the cells twice with PBS for 5 min each time.

[0193] (3) Cell fixation: Add 50 μl of 4% paraformaldehyde fixing solution to each well, and fix at room temperature for 30 min. After discarding the fixing solution, add 50 μL of 2 mg / ml glycine to each well. Shake the incubator for 5 min, and then wash with PBS for 3 times, 5 min each time.

[0194] (4) Apollo staining: Under room temperature and light shielding conditions, add 100 mL of 1 x Apollo staining reaction solution to each well, and incubate on the decolorizing shaker for 30 min. Discard the staining reaction solution, and then add 100 μl of 0.5% Triton X-100 PBS. Wash 2-3 times on the decolorizing shaker, 10 min each time.

[0195] (5) DNA staining: Under room temperature and light shielding conditions, first dilute the reagent Hoechst 33342 at a ratio of 100: 1 to prepare an appropriate amount of 1 x Hoechst 33342 reaction solution. Add 100 μl of 1 x Hoechst 33342 reaction solution to each well, and incubate on the decolorizing shaker for 30 min. Discard the staining reaction solution, and then add 100 μl of PBS to each well and wash 1-3 times.

[0196] (6) Image acquisition and analysis: Immediately after staining, use a confocal fluorescence microscope to acquire images,

[0197] Experimental results: Compared with the control group, the proliferation ability of human hepatoma cells overexpressing VISTA was enhanced, and the proliferation ability of human hepatoma cell lines was significantly weakened after knocking down VISTA. Figure 14

[0198] Example 4

[0199] Upstream regulatory factors of VISTA

[0200] ​RNA-seq analysis of VISTA and BRD4 showed that the RNA level of VISTA increased after overexpression of BRD4. The RNA level of VISTA decreased significantly after JQ1 (inhibitor of BET family proteins BRD2, BRD3 and BRD4) treatment, which prompted us to further study VISTA.

[0201] I. By BET protein family inhibitor JQ1 treatment of human hepatoma cell PLC-5 and Huh7, extract the treated cell RNA for reverse transcription, verify the mRNA level of VISTA by fluorescence quantitative PCR experiment, the specific steps are as follows:

[0202] 1. Cell plating: human hepatoma cell line PLC-5 and Huh7, after cell passage, plating on six-hole plate.

[0203] 2. Inhibition of BET protein function: after 12h of cell plating, the culture medium was replaced with 0.5% fetal bovine serum-containing DMEM medium for starvation, and after 24h, JQ1 was used for treatment with time gradient (0h, 6h, 12h, 24h) and concentration gradient (0μM, 0.01μM, 0.1μM, 1μM).

[0204] 3. Trizol method for extracting total RNA, the specific steps are as follows:

[0205] (1) The cells to be detected corresponding to the six-hole plate were washed with PBS solution and 1ml of cell RNA lysis solution (Trizol) was added, and the cells were collected in a 1.5ml enzyme-free sterile centrifuge tube.

[0206] (2) After adding 200μl of chloroform, shake well.

[0207] (3) In 4℃ centrifuge, 12000rpm, centrifuge for 10min.

[0208] (4) Take the upper clear liquid, as little as possible, try to avoid sucking other layered precipitate, transfer it to another 1.5ml sterile enzyme-free centrifuge tube, add equal volume of isopropanol, mix well.

[0209] (5) 12000rpm centrifugation for 10min. A small amount of white precipitate is visible at the bottom of the tube, and the supernatant is discarded carefully.

[0210] (6) Wash the white precipitate with 1ml of 75% ethanol. 4℃, 12000rpm centrifugation for 10min, discard the supernatant, leave the precipitate.

[0211] (7) Dry the tube wall and the white precipitate at room temperature to a translucent state, add appropriate amount of DEPC water to dissolve, measure the RNA concentration.

[0212] 4. Reverse transcription:

[0213] Prepare 20 μΐ reverse transcription system:

[0214] mRNA 1 μg

[0215] 5x qRT SuperMix (Novozyme) 4 μΐ

[0216] DEPC water to 20 μΐ.

[0217] Reverse transcription by PCR instrument, reaction program:

[0218] 50°C 15 min

[0219] 85°C 5 s

[0220] Obtain reverse transcription product cDNA.

[0221] 5. Fluorescent quantitative PCR:

[0222] QPCR primers of GAPDH and VISTA, sequences are:

[0223] GAPDH-homo-F: CATGTTCGTCATGGGTGTGAACCA (SEQ ID NO: 3)

[0224] GAPDH-homo-R: ATGGCATGGACTGTGGTCATGAGT (SEQ ID NO: 4)

[0225] VISTA-homo-F: ACGCCGTATTCCCTGTATGTC (SEQ ID NO: 5)

[0226] VISTA-homo-R: TTGTAGAAGGTCACATCGTGC (SEQ ID NO: 6)

[0227] Prepare 10 μΐ fluorescent quantitative PCR reaction system in 96-well plate:

[0228] Primer: 0.5 μΐ of each forward and reverse primer

[0229] cDNA: 1 μΐ

[0230] DEPC water 3 μΐ

[0231] 2x chamQ SYBR qPCR Master Mix (Novozyme) 5 μΐ

[0232] Fluorescent quantitative PCR by QS6P QPCR instrument, reaction program:

[0233] (1) 95°C 3 min

[0234] (2) 95°C 20 s

[0235] (3) 60°C 20 s

[0236] (4) 72°C 20 s

[0237] (2)-(4) 40 cycles of reaction. Set a reasonable threshold, collect fluorescence signal, and obtain CT value in exponential amplification stage.

[0238] Experimental results: By analyzing, it can be concluded that with the increase of the time and concentration of JQ1 stimulation, the mRNA level of VISTA in the two liver cancer cell lines is significantly decreased (below Figure 15 and below Figure 16 ).

[0239] II. Inhibition of BET protein (BRD2, BRD3, BRD4) function by JQ1, extraction of cell protein, and verification of VISTA protein level by Western blotting experiment.

[0240] 1. Cell plating: well-grown human liver cancer cell lines PLC-5 and Huh7 were subcultured and plated on six-well plates at a density of 50% and cultured.

[0241] 2. Inhibition of BET protein function: after 12h of cell plating, the culture medium was replaced with DMEM medium containing 0.5% fetal bovine serum for starvation, and after 24h, JQ1 was added for treatment with time gradient (0h, 12h, 24h, 48h) and concentration gradient (0μM, 0.01μM, 0.1μM, 1μM).

[0242] 3. Extraction of cell protein for Western blotting experiment (the specific experimental procedure has been described in detail before).

[0243] Experimental results: with the increase of the time and concentration of JQ1 treatment, the protein level of VISTA in the two liver cancer cell lines is significantly decreased (above Figure 15 and above Figure 16 ).

[0244] III. Knockdown of specific BET protein (BRD2, BRD3, BRD4) expression, extraction of cell protein, and verification of VISTA protein level by Western blotting experiment.

[0245] 1. Cell plating: well-grown human liver cancer cell lines PLC-5 and Huh7 were subcultured and plated on six-well plates at a density of 50% and cultured.

[0246] 2. Plasmid transfection: After the cells were plated for 12 h, the medium was replaced with fresh DMEM medium containing 10% fetal bovine serum, and plasmid transfection was performed.

[0247] The shRNA plasmids of BRD2, BRD3 and BRD4 were purchased from Genview Biotech Co., Ltd.

[0248] The functional sequences of the plasmids are as follows:

[0249] BRD2-shRNA: CCGGGCTGCTGATGTACGGCTTATGCTCGAGCATAAGCCGTACATCAGCAGCTTTTTT (SEQ ID NO: 7)

[0250] BRD3-shRNA: CCGGGGAGATGCTATCCAAGAAGCCTCGAGGCTTCTTGGATAGCATCTCCCTTTTTT (SEQ ID NO: 8)

[0251] BRD4-shRNA: CCGGCAGAGTGATCTATTGTCAATACTCGAGTATTGACAATAGATCACTCTGTTTTTT (SEQ ID NO: 9).

[0252] Prepare the transfection system:

[0253] shRNA plasmid: 2 μg

[0254] Lipo8000 transfection reagent: 4 μl

[0255] Serum-free medium: 100 μl.

[0256] The transfection conditions are referred to the lipo8000 instruction manual (Biyun Tian)

[0257] 72 h after transfection, cell proteins were extracted for Western blotting.

[0258] Experimental results: Only after knocking down BRD4, the protein level of VISTA in two hepatoma cell lines (upward of Figure 17 ) and the mRNA level of VISTA (downward of Figure 17 ) were significantly reduced, suggesting that among the BET protein family, the main upstream protein member regulating VISTA is BRD4. After overexpression of BRD4, the mRNA level of VISTA in PLC-5 and Huh7 cell lines was significantly increased ( Figure 18 ).

[0259] Four, after overexpression of BRD4, cell immunofluorescence analysis

[0260] 1. Cell preparation: Lysine-coated discs were placed at the bottom of a 24-well plate and sterilized by UV irradiation for 30 min. Logarithmic growth human liver cancer cells Plc-5 and Huh7 were collected, digested with trypsin, centrifuged, and the supernatant was discarded. The cells were resuspended in culture medium, and the cells were dispersed into a single-cell suspension. 5 × 10⁶ cells were placed in each well. 4 One cell was seeded into a 24-well culture plate, allowing the cells to adhere evenly to the small disc.

[0261] 2. Transfection: Purchase ov-flag-BRD4 plasmid from Qingke Biotechnology. After transfecting 0.5μg of plasmid for 24 hours (the specific experimental steps have been detailed above), remove the culture medium and wash twice with PBS. Be careful to be gentle and avoid washing off the cells.

[0262] 3. Fixation: Fix cells with 500 μl of paraformaldehyde for 15 min, discard the culture medium, add 500 μl of PBS and wash slowly on a shaker for 5 min, repeat 3 times.

[0263] 4. Breakthrough: Add 500 μl of 0.5% Triton X-100 PBS, let stand for 10 min, aspirate the liquid, add 500 μl of PBS and shake slowly for 5 min, repeat 3 times.

[0264] 5. Add 3% BSA and incubate at room temperature for 1 hour to block non-specific proteins.

[0265] 6. Aspirate BSA, add primary antibody (DAPI, BRD4, VISTA diluted at a ratio of 1:100), and incubate at 4°C for 16 hours.

[0266] 7. Recover the primary antibody, wash 3 times with PBS, add the fluorescent secondary antibody with the corresponding excitation wavelength, and dilute the secondary antibody with PBS according to the instructions. Incubate at 4°C in the dark for 2 hours.

[0267] 8. Add 500 μL of PBS and shake slowly on a shaker for 5 minutes, repeat 3 times.

[0268] 9. Transfer the small discs to a glass slide, fix them with neutral resin, and take pictures and analyze them under a laser confocal fluorescence microscope.

[0269] Experimental results showed that when BRD4 was overexpressed, the protein expression level of VISTA was also significantly increased, and BRD4 and VISTA shared a common nuclear localization. Figure 19 ).

[0270] Fifth, we will now clarify which of the two BRD4 protein domains, BD1 and BD2, plays a major role in the regulation of VISTA. This experiment will involve constructing plasmids that overexpress GFP-BRD4-BD1 and GFP-BRD4-BD2, and then transfecting them to competitively inhibit the target domain of BRD4.

[0271] Construct BD1, BD2 overexpression plasmid with GFP tag on pcDNA3.0 (the specific construction steps have been described in detail before)

[0272] Primer sequence:

[0273] BRD4-BD1-BamHI-F: CGGGATCCAGGCAGACCAACCAACTGC (SEQ ID NO: 10)

[0274] BRD4-BD1-xbal-R: GCTCTAGATTGCAAGAAGAGCTTTTCCAG (SEQ ID NO: 11)

[0275] BRD4-BD2-BamHI-F: CGGGATCCAAGGTCTCGGAGCAGCTCAAG (SEQ ID NO: 12)

[0276] BRD4-BD2-xbaI-R: GCTCTAGAAGGCTCGTCCGGCATCTTG (SEQ ID NO: 13)

[0277] After successful construction, the plasmid was amplified.

[0278] Transfect 3 μg of plasmid (the specific experimental steps have been described in detail before).

[0279] After transfection for 24-48 h, cell protein was extracted, and Western blotting was performed (the specific experimental steps have been described in detail before).

[0280] Experimental results: after overexpression of BRD4-BD1, the protein level of VISTA was significantly reduced Figure 20 ), suggesting that the BD1 domain in BRD4 is the most important for the regulation of VISTA.

[0281] Six, further verify that BRD4 binds to the promoter of VISTA gene through chromatin immunoprecipitation experiment, and regulates the transcription of VISTA, the specific steps are as follows:

[0282] 1, cross-linking and cell collection

[0283] (1) Cells were passaged and plated into 10 cm cell culture dishes, and divided into control group, overexpression BRD4 and JQ1 treatment group. In the cells to be treated, the final concentration of 1% formaldehyde was added according to the volume of the medium, and the DNA and protein were cross-linked by slowly shaking on a shaking table at room temperature for 10 minutes.

[0284] (2) Add glycine solution to final concentration of 125 mM, room temperature, 5 min, slow shaking, stop cross-linking.

[0285] (3) Wash cells twice with 10 ml pre-cooled PBS.

[0286] (4) Add 1 ml solution A, scrape cells, collect in 1.5 ml centrifuge tube. 4000 rpm, 4°C, 5 min, discard supernatant, keep pellet; the composition and preparation method of solution A are shown in Table 1.

[0287] Table 1 Composition and preparation method of solution A

[0288]

[0289] 2. Ultrasonic disruption

[0290] (1) Add 600 μl solution C (proteinase inhibitors are added immediately before use), resuspend cells, vortex to lyse cells. After ultrasonic disruption, run a DNA gel to check fragment size (DNA gel concentration is about 1.5%, which is appropriate), and the fragment size is preferably 200-1000 bp; the composition and preparation method of solution C are shown in Table 2.

[0291] Table 2 Composition and preparation method of solution C

[0292]

[0293] (2) 12000 rpm, 4°C, 15 min. Take supernatant, discard pellet.

[0294] 3. Preclear sample

[0295] (1) Add 50 μl protein A / G beads and protamine (final concentration 200 μg / ml, stock solution 10 mg / ml, prepared with ddH2O) to 500 μL supernatant, 4°C, rotate for 2 h.

[0296] (2) 12000 rpm, 4°C, 15 min. Take supernatant, discard pellet.

[0297] (3) Take 20 μl from the supernatant as input.

[0298] 4. Binding

[0299] Take 200 μl supernatant, add 4 μl primary antibody, 8 μl protein A / G beads, protamine (final concentration 200 μg / ml) and BSA (final concentration 1 mg / ml), and make up the total volume to 300 μl with Chip 1 solution. Incubate at 4°C overnight or for 6 h. The rest of the supernatant is frozen at -80°C for later use.

[0300] 5. Wash

[0301] (1) Centrifuge at 4°C, 3000 rpm for 1 min to precipitate the beads, and discard the supernatant.

[0302] (2) Wash the beads with 400 μl of Chip 1 solution, Chip 2 solution, Chip 3 solution and TE solution, respectively, and add DTT (final concentration 1 mM) to the four solutions during washing.

[0303] The compositions and preparation methods of the Chip 1 solution, Chip 2 solution and Chip 3 solution are shown in Tables 3, 4 and 5, respectively.

[0304] Table 3 Composition and preparation method of Chip 1 solution

[0305]

[0306]

[0307] Table 4 Composition and preparation method of Chip 2 solution

[0308]

[0309] Table 5 Composition and preparation method of Chip 3 solution

[0310]

[0311] 6. Proteinase K digestion

[0312] (1) Add 100 μl elution solution (0.5% SDS, 0.1 M NaHCO3 and 5 μg proteinase K), and also perform this step and the subsequent steps on the input sample. The elution solution is prepared fresh.

[0313] (2) Shake at 65°C overnight or for 6 h on a molecular hybridization instrument.

[0314] 7. DNA purification, precipitation and dissolution

[0315] (1) Add 300 μL phenol chloroform to each tube, shake vigorously, at this time, white cream can be reached. 8000 rpm, 4°C centrifugation for 3 min, take the supernatant, discard the beads. Repeat extraction 2-3 times until no white cream appears, the supernatant is clear.

[0316] (2) Take the supernatant, add 100 μL of chloroform, shake vigorously, 8000 rpm, 4°C centrifugation for 3 min, take the supernatant.

[0317] (3) Add 300 μL (3 times the volume) of anhydrous ethanol, add 10 μL (1 / 10 volume) of 3M NaOAc, and 0.3 μL (1 / 100 volume) of glycogen (20 mg / ml), precipitate at -20°C for 30 min.

[0318] (4) Normal temperature, 12000 rpm centrifugation for 10 min.

[0319] (5) Discard the supernatant, and wash the precipitate with 70% ethanol once.

[0320] (6) Normal temperature, 12000 rpm centrifugation for 10 min. After the ethanol is absorbed as much as possible, the precipitate is dried.

[0321] (7) Add 40 μl TE to dissolve the DNA.

[0322] 8. PCR reaction: The results of the chip can be reflected by Q-PCR experiment, and also can be reflected by ordinary PCR and then running DNA gel. Subsequent fluorescence quantitative PCR (Q-PCR) experiment, Q-PCR primer sequence:

[0323] VISTA-chip-F: AAGTTCTTCCTCACTCCTCCC (SEQ ID NO: 14)

[0324] VISTA-chip-R: CAGATATAAATCTGCCCTGCC (SEQ ID NO: 15)

[0325] Experimental results: After overexpression of BRD4, BRD4 can bind to the promoter region of VISTA gene to promote its transcription, and JQ1 can significantly weaken the binding of BRD4 to the promoter region of VISTA ( Figure 21 ).

[0326] Example 5

[0327] Downstream substrate of VISTA

[0328] I. In the data analysis of TCGA database, it was found that MMP11 was also highly expressed in liver cancer ( Figure 22 ), and the expression of VISTA and MMP11 had obvious correlationFigure 23 )。

[0329] Two, by immunofluorescence experiment (see example 4 for specific steps), it can be seen that VISTA has co-localization with MMP11 Figure 24 )

[0330] Three, after knocking down VISTA or overexpressing VISTA in PLC-5 and Huh7 cell lines, Western blotting experiment, Q-PCR experiment (see example 4 for specific steps) are carried out.

[0331] Experimental results: after knocking down VISTA, the protein level and mRNA level of MMP11 are obviously reduced Figure 25 ); after overexpressing VISTA, the protein level and mRNA level of MMP11 are obviously increased Figure 26 ).

[0332] Four, after overexpressing VISTA, immunofluorescence experiment (see example 4 for specific steps) is carried out.

[0333] Experimental results: the expression level of MMP11 is obviously increased, and VISTA and MMP11 have intranuclear co-localization Figure 27 ).

[0334] Five, BRD4, VISTA and MMP11 proteins are detected in PLC-5 and Huh7 stable BRD4 knockdown cell lines.

[0335] Experimental results: it is found that after knocking down BRD4, the protein expression of VISTA and MMP11 is obviously reduced Figure 28 ); however, after overexpressing BRD4, the protein expression of VISTA and MMP11 is obviously increased Figure 29 ).

[0336] After overexpressing BRD4 in two liver cancer cell lines stably knocking down VISTA, the protein level Figure 30 ) and mRNA level Figure 31 ) of MMP11 are not significantly restored.

[0337] From the above examples, it can be concluded that BRD4 regulates the mRNA transcription of MMP11 by regulating the expression of VISTA, thereby affecting the occurrence and development of liver cancer, and VISTA plays an important role in the occurrence and development of liver cancer and can be used as a marker for early diagnosis of liver cancer.

[0338] The above only describes the preferred embodiments of the present application, and it should be noted that for those skilled in the art, without departing from the principles of the present application, a number of improvements and refinements can be made, and these improvements and refinements should also be considered as the protection scope of the present application.

Claims

1. The use of a reagent for knocking down VISTA gene expression in the preparation of drugs for the treatment and / or prevention of primary liver cancer, characterized in that, Knockdown of VISTA can treat and / or prevent primary liver cancer by inhibiting the expression level of MMP11.

Images