Monoamine oxidase inhibitors as modulators of beta cell vulnerability in type 1 diabetes mellitus

Abstract

The present invention relates to monoamine oxidase inhibitors as modulators of beta cell vulnerability in type 1 diabetes. The invention also provides methods of using the compositions for reducing blood glucose, increasing insulin secretion to glucose response, preventing pancreatic beta cell or beta-like cell death, and preventing type 1 diabetes mellitus.

Description

[0001] manual

[0002] This application is a divisional application of Chinese patent application 202080097338.7 (International Application No. PCT / US2020 / 066560), whose application date is December 22, 2020 and whose invention name is "Monoamine oxidase inhibitors as regulators of beta cell vulnerability in type 1 diabetes".

[0003] This application claims the benefit of priority to U.S. Provisional Application No. 62 / 952,538, filed on December 23, 2019, the entire contents of which are incorporated by reference.

[0004] Sequence Listing

[0005] This application is submitted with a sequence listing in electronic format. The sequence listing is provided in the form of a file with the file name "2020-11-04_01123-0011-00PCT_Sequence_Listing_ST25.txt", created on November 4, 2020, and with a size of 12,288 bytes. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety. Technical Field

[0006] The present application relates to monoamine oxidase inhibitors (MAOIs) for the treatment of diabetes, including autoimmune diabetes. Background Art

[0007] Type 1 diabetes (T1D) is caused by immune-mediated killing of pancreatic β cells (1). Several groups have developed efficient differentiation protocols to generate insulin-producing β-like cells from human embryonic or induced pluripotent stem cells (2). These advances have raised the prospect of using autologous stem cell-derived β cells to replace lost β cells in T1D patients, a strategy that has the potential to provide an unlimited supply of cells while also circumventing the problem of transplant rejection. However, key obstacles remain. In the absence of immunosuppression, recurrent autoimmunity rapidly destroys transplanted β cells. Immunotherapies that induce tolerance to β cells in T1D patients have not been successfully translated from animal models to humans (1). To overcome this critical issue, genetic modifications that render transplanted β cells resistant to autoimmune killing have been investigated. Others have attempted to generate cells with reduced immunogenicity by targeting a series of rationally selected genes involved in immune recognition, including HLA molecules for antigen presentation (3, 4). Although this approach has been reported to be partially effective, it requires complete abrogation of immune surveillance that protects against infection and tumor formation.

[0008] The present disclosure describes monoamine oxidase inhibitors (MAO inhibitors) as novel modulators of β-cell vulnerability in autoimmune diabetes, such as T1D. SUMMARY OF THE INVENTION

[0009] According to the description, the present application describes a method for lowering blood sugar or increasing insulin secretion in a subject in response to glucose, comprising administering a monoamine oxidase inhibitor (MAOI), wherein the monoamine oxidase inhibitor binds to renalase, binds to flavin adenine dinucleotide (FAD), and / or produces an active agent that binds to renalase or FAD.

[0010] In some embodiments, the subject has autoimmune diabetes. In some embodiments, the subject has type 1 diabetes. In some embodiments, the subject has autoimmune diabetes induced by immunotherapy. In some embodiments, monoamine oxidase inhibitors are administered in combination with other treatment methods. In some embodiments, other treatment methods are insulin. In some embodiments, the insulin is a fast-acting, intermediate-acting or long-acting insulin. In some embodiments, other treatment methods are glucagon-like peptide analogs or agonists, dipeptidyl peptidase-4 inhibitors, amylin analogs, biguanides, thiazolidinediones, sulfonylureas, meglitinide, alpha-glucosidase inhibitors, or sodium / glucose transporter 2 inhibitors. In some embodiments, the blood glucose level of the subject is higher than 11.1mmol / liter or 200mg / dl.

[0011] In some embodiments, the method of preventing pancreatic β cell or β-like cell death comprises administering a monoamine oxidase inhibitor (MAOI), wherein the MAOI binds renalase, binds flavin adenine dinucleotide (FAD), and / or produces an agent that binds renalase or FAD.

[0012] In some embodiments, the beta cell is a cell of the subject. In some embodiments, the beta cell is not a cell of the subject. In some embodiments, the subject is receiving treatment with an immunotherapy. In some embodiments, the immunotherapy is a checkpoint antibody.

[0013] In some embodiments, the checkpoint antibody is an anti-PD-1 antibody, an anti-PD-L1 antibody, or an anti-CTLA-4 antibody. In some embodiments, the β cells or β-like cells are transplanted. In some embodiments, the β cells or β-like cells are transplanted into a patient with autoimmune diabetes. In some embodiments, the β cells or β-like cells are administered by transplanting into the pancreas, liver, or fat pad via surgery, injection, or infusion.

[0014] In some embodiments, a method of preventing the development of type 1 diabetes comprises screening a subject for type 1 diabetes risk factors; determining whether the subject has an increased risk of developing type 1 diabetes; and administering a monoamine oxidase inhibitor if the subject has an increased risk of type 1 diabetes.

[0015] In some embodiments, screening the subject for risk factors includes obtaining data for a genetic risk score based on known gene variants associated with type 1 diabetes, a family history of type 1 diabetes, the presence of one or more autoantibodies to β-cell antigens known to predict disease risk, and / or impaired glucose tolerance.

[0016] In some embodiments, the subject is a mammal. In some embodiments, the mammal is a human.

[0017] In some embodiments, the monoamine oxidase inhibitor is propargylamine, hydrazine, propylamine or an oxazolidinone derivative. In some embodiments, the monoamine oxidase inhibitor is clorgyline, pargyline, rasagiline, sitagliptin, ladostingil, ASS234, isocarbazide, toloxatone or tranylcypromine.

[0018] Other purposes and advantages will be partially listed in the following description, partially obvious from the specification, or understood through practice. These purposes and advantages will be realized and achieved through the elements and combinations particularly pointed out in the appended claims.

[0019] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the claims.

[0020] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate one or more embodiments and, together with the description, serve to explain the principles described herein. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 A genome-scale CRISPR / Cas9 screen identified Rnls as a regulator of β-cell survival in the NOD mouse model. NIT-1 cells (10 7 ) were implanted subcutaneously (SubQ) into NOD.scid mice with or without intravenous injection of 10 7 After 8 weeks, NIT-1 grafts were removed from recipients with (autoimmune) and without (non-autoimmune) splenocytes co-injected. Next generation sequencing of gRNAs present in surviving grafts revealed

[0022] Rnls gRNA (MGLibA_46009, 5'-CTACTCCTCTCGCTATGCTC-3' (SEQ ID NO: 1)) was one of only 11 gRNAs detected at high frequency in mice with β-cell autoimmunity.

[0023] Figure 2A-2L We show that the Rnls mutation protects NIT-1 and primary NODβ cells from autoimmunity in vivo. (A) Experimental approach used to test the survival of NIT-1β cells after transplantation and induction of autoimmunity. mut NIT-1 cells (10 7 ) were implanted into the opposite flanks of NOD.scid mice. 7 splenocytes induced autoimmunity. (B) Representative images of transplant luminescence on days 0, 3, 7, 14, and 18 after transplantation. (C,D) Paired Rnls over time (C) and on day 18 (D) mut Relative luminescence of transplanted cells compared to control cells, normalized to the ratio on day 0. Data show mean ± SEM of n = 5 (+splenocytes) and n = 3 (-splenocytes) mice. (E) Experimental method used to test the survival of NIT-1 cells transplanted into diabetic NOD mice. Control (NT) and Rnls mut NIT-1 cells (10 7 ) were implanted into opposite flanks of overtly diabetic NOD mice.

[0024] (F) Representative images of graft luminescence at days 0, 5, 8, 10, 14, and 18 after transplantation. (G) Remaining luminescence ratio relative to day 0 (100%). (H) Paired Rnls mut Relative luminescence to the control group. Data show mean ± SEM of n = 5 mice. (I) Experimental method used to test autoimmune killing of primary pancreatic β cells. NOD.scid islet cells transduced with lentivirus encoding non-targeting (NT) control or Rnls-targeting gRNA and rat insulin promoter (RIP)-driven Cas9 endonuclease were transplanted under the left and right renal capsules of the same NOD.scid recipients, respectively. Autoimmunity was induced as in (A). (J) Representative images of islets transplanted on explanted kidneys at day 39. (K) Quantification of insulin mRNA relative to glucagon (Gcg) mRNA in paired grafts from non-autoimmune (-splenocytes, n = 5) and autoimmune (+splenocytes, n = 6) mice at day 39. (L) Paired Rnls mutRelative expression of insulin in control (NT) and control (NT) grafts. Data represent mean ± SEM. *P < 0.05, **P < 0.01, calculated by nonparametric unpaired Mann-Whitney test (CD, GH, I) and paired Wilcoxon test (K). All data are representative of 2 or more similar experiments.

[0025] Figures 3A-3H Rnls deficiency reduces immune recognition of β cells in vitro. (AD) In ​​control and Rnls treated with thapsigargin (TG) or vehicle (DMSO), mut Representative flow cytometry data and MHC-I (A, B, MFI: mean fluorescence intensity) and MHC-II (C, D, MHC-II + The data are summarized as the percentage of cells expressing BDC2.5-TCR. The data are representative of three independent experiments. (E and F) + T cells were co-cultured with NIT-1 cells and irradiated splenocytes from NOD.scid mice. CD4 + IFN-γ expression by T cells. Representative (E) and combined data (F) from technical triplicates are shown. Data are representative of 5 independent experiments. (G and H) ELISPOT measurement of polyclonal CD8 + T cells were treated with control group or Rnls mut Activation after stimulation of NIT-1 cells. Wells without NIT-1 cells or with PMA and ionomycin (Iono) served as negative and positive controls, respectively. Data are representative of three independent experiments. Data were compared by analysis of variance (ANOVA) and Tukey's multiple comparison test. ns, not significant, ***P=0.0001. All data are mean ± SEM.

[0026] Figures 4A-4E Shown that Rnls deficiency confers ER stress resistance in vitro. (A and B) Cell viability assay 24 h after thapsigargin (TG) (A) and tunicamycin (TC) (B) treatment. n = 4 technical replicates per condition, representative of 2 independent experiments.

[0027] (CE) The unfolded protein response (UPR) in response to TG challenge was measured. mutPhosphorylation (PERK, eIF2a, and IRE1a), expression (ATF4, Txnip, NRF2), and cleavage (ATF6, Caspase3) of ER stress pathway proteins (C), Xbp1 splicing (D), and Chop and Txnip mRNA levels (E) were measured in NIT-1 cells. Data represent mean ± SEM, *#P<0.05, **##P<0.01, ***###P<0.001, calculated by ANOVA and Sidak's multiple comparison test. *Control group vs. Rnls mut Non-treated group of cells; #Control group and Rnls mut TG-treated groups of cells (D and E).

[0028] Figures 5A-5H Shown that pargyline binds to RNLS and protects β cells from autoimmunity. (A) Schematic representation of the interaction of pargyline with the FAD cofactor within the predicted RNLS active site. (B) Denaturation profiles of human recombinant RNLS protein in the presence and absence of pargyline (PG), as determined by a SYPRO Orange protein dye-based thermal shift assay. (C) Changes in RNLS melting temperature (Tm) under the action of pargyline. Data were fitted to a four-parameter sigmoidal curve with variable slope. n = 3 technical replicates per condition, representative of 2 independent experiments. (D) Experimental approach used to test the protection of NIT-1 cells transplanted into diabetic NOD mice with pargyline. (E) Representative images of transplant luminescence at days 0, 3, 5, 7, 12, and 19 after transplantation. (F) Ratio of remaining transplant luminescence relative to day 0 (100%). (G) Blood glucose levels over time in control and pargyline-treated mice. (H) Plasma insulin levels at day 20 (D20) in control and pargyline-treated mice. Data show mean ± SEM of n = 5 mice per group and are representative of 2 similar experiments, *P < 0.05, calculated by ANOVA and Tukey's multiple comparison test.

[0029] Figure 6A-6B Showing that autoimmune killing of NIT-1 cells in NOD mice can be visualized by bioluminescence imaging. (A and B) 10 7 Bioluminescence imaging of NIT-1 cells transplanted subcutaneously into NOD.scid mice. The transplanted cells were engineered to carry the CMV-luciferase 2 (Luc2) reporter gene. Some recipient mice were also injected intravenously with 10 isolated from spontaneously diabetic (DM) NOD mice. 7 splenocytes to induce β-cell killing. Images were taken on day 1 (A) and day 15 (B) after injection.

[0030] Fig. 7A and7B Validation of targeted mutation of Rnls by CRISPR-Cas9 is shown. (A) T7 endonuclease I assay. mut Genomic DNA of cells was tested for CRISPR-Cas9 gene editing events. Cleavage of heteroduplex mismatch sites digested with T7 endonuclease I was analyzed by agarose gel electrophoresis. mut The DNA of the cells was separated into multiple digested fragments, indicating efficient mutation of the target region of the Rnls gene. (B) mut The genomic DNA of the cells was sequenced to identify individual mutations (SEQ ID NOs: 17-23). ​​The Rnls gRNA targeting site in the wild type (SEQ ID NO: 16) is underlined. mut The most frequent mutation in a cell.

[0031] Figure 8 We show that Rnls mutations do not impair insulin secretion. Islets (≈1700) were purified from 8-week-old CD1 mice, dispersed, and transduced with lentivirus encoding either non-targeting (NT) or Rnls-targeting gRNAs together with the Cas9 endonuclease driven by the rat insulin promoter. After 72 h, islets were sequentially stimulated with 2.8 mM glucose, 16.8 mM glucose, and finally 30 mM KCl to induce insulin secretion. Islet genomic DNA was quantified for normalization of DNA content for ELISA insulin measurements. Data show mean ± SEM. Note that the islet dispersion required for lentiviral transduction reduced the overall responsiveness of purified islets compared with intact islets. Insulin secretion from Rnls mutant islet cells was not significantly different from that from control (NT) islets.

[0032] Figures 9A-9B The results showed that the Rnls mutation did not prevent allogeneic rejection of NIT-1β cells. mut NIT-1 cells (10 7 ) were implanted into the opposite flanks of C57BL / 6 mice (n=3). Graft luminescence was measured on days 0, 4, and 7 after transplantation. Representative bioluminescent images (A) and relative luminescence of the grafts over time (B) are shown. Data represent mean ± SEM. Grafts in both the control and mutant groups were destroyed by allogeneic rejection within one week.

[0033] Figures 10A-10B Display, Rnls mutCells are not resistant to non-ER stress-induced cell death. (A) Relative cell viability after 6 and 24 hours of treatment with 40 mM streptozotocin (STZ) (n = 3 technical replicates). (B) Relative cell viability after 48 hours of treatment with mitomycin C (MMC) at the indicated concentrations (n ​​= 3 technical replicates). Data represent mean ± SEM, ***P < 0.001, calculated by analysis of variance and Sidak's multiple comparison test.

[0034] Figures 11A-11D The results showed that Rnls knockout replicated the Rnls mut ER stress resistance phenotype of cells. Rnls knockout NIT-1 cell lines were generated by deleting exons 2-4 or exon 5. The deletion efficiency was confirmed by qPCR of genomic DNA. RnlsΔEx2 / 4 cells showed ∼60% deletion of exons 2-4 by genomic DNA qPCR (A), while RnlsΔEx5 cells showed ∼87% deletion of exon 5 (B). (C and D) Cell viability of Rnls-deficient cells was measured after 72 h of thapsigargin (TG, C) and tunicamycin (TC, D) treatment. Data show mean ± SEM, ***P < 0.001, calculated by unpaired t-test (A and B) and ANOVA with Sidak's multiple comparison test (C and D).

[0035] Figures 12A-12B showed that Rnls overexpression sensitized NIT-1 cells to ER stress-induced death and reversed the Rnls mut (A and B) NIT-1 cell viability was measured after treatment with the indicated concentrations of thapsigargin (TG) for 24 h. Overexpression of Rnls in WT NIT-1 cells increased sensitivity to low-dose TG-induced killing (A). mut CRISPR-immune Rnls (CiRnls) expressed in cells restored sensitivity to TG-induced killing (B). n = 4 technical replicates per group. Data represent mean ± SEM, *#P < 0.05, ***###P < 0.001, calculated by ANOVA plus Sidak's multiple comparison test. * Control group vs. Rnls mut Comparison of cells; #Rnls mut With Rnls mut Comparison of +CiRnls cells.

[0036] Figures 13A-13C The results showed that overexpression of Rnls in vivo increased the sensitivity to autoimmune killing. OE)NIT-1 cells were implanted into opposite flanks of NOD.scid mice. Some transplant recipients were also injected intravenously with splenocytes from diabetic NOD mice (DM NOD splenocytes). Graft bioluminescence was imaged on days 0, 2, 3, and 7 (A). Rnls OE Relative luminescence of the grafts of the control group over time, normalized to day 0, is shown in (B). Data from all mice analyzed on day 3 are shown in (C). OE The grafts were more sensitive to autoimmune killing, as evidenced by the rapid disappearance of luminescence. OE All grafts were killed by -90% (data not shown), resulting in similar relative luminescence levels. n = 6 mice (two grafts each). Data represent mean ± SEM, *P < 0.05, **P < 0.01, calculated by unpaired t-test.

[0037] Figures 14A-14B showed that Rnls overexpression in vivo can restore Rnls mut Cell sensitivity to autoimmune killing. Both Rnls carry the luciferase reporter gene mut NIT-1 cells and Rnls expressing CRISPR-insensitive Rnls transgene (CiRnls) mut Cells were implanted into the opposite flanks of NOD.scid mice. Transplant recipients were also injected intravenously with spleen cells from diabetic (DM) NOD mice. Graft bioluminescence was imaged at days 0, 2, 3, and 5 after injection (A). Relative luminescence of paired grafts over time, normalized to day 0, is shown in (B). Data represent mean ± SEM.

[0038] Fig.15 The expression of islet Rnls was shown to be elevated in the diabetes-prone NOD mouse strain. The expression level of Rnls mRNA isolated from C57BL / 6, NOD and NOD.scid mice was determined by TaqMan using Rnls (Mm04178677_m1) and Hprt1 (Mm0302475_m1) probes from Thermo Fisher Scientific. n = 8 mice per group. Data show mean ± SEM, *P < 0.05, **P < 0.01, calculated by nonparametric Kruskal-Wallis with Dunn's multiple comparison test.

[0039] Figures 16A-16H We show that Rnls depletion reduces the UPR following ER stress using various markers. Figure 4CThe data shown in represent the quantification of Western blot data. Images were acquired and quantified using a C-DiGit scanner and Image Studio software (LI-COR Biosciences). N = 3 / group. Data show mean ± SEM, *#P < 0.05, **##P < 0.01, ***##P < 0.001, calculated by ANOVA and Dunnett's multiple comparison test. *Compared with control cells without TG treatment; #Compared with control cells treated with TG for 5 hours.

[0040] Fig.17 We show that deficiency of Rnls confers resistance to oxidative stress. mut NIT-1 cells were cultured overnight in the presence or absence of indicated concentrations of hydrogen peroxide (H2 O2). Cell viability was assessed using the CellTiter-Glo Luminescent Cell Viability Assay. Data show mean ± SEM of triplicate cultures and are representative of three independent experiments.

[0041] ****P<0.0001.

[0042] Fig.18 It was shown that pargyline treatment can preserve insulin expression in long-term diabetic NOD mice. Pancreata were isolated from control and pargyline-treated diabetic NOD mice described in Figure 5, and these mice were euthanized on day 20 after β-cell transplantation. Pancreatic sections were stained with anti-insulin (DAKO, #A0564), anti-CD3 (Bio-rad, #MCA500), and DNA dye Hoechst33342 (Invitrogen, #H3570). Goat anti-guinea pig Alexa Flour 488 and donkey anti-rat Alexa Flour 594 secondary antibodies (Thermo Fisher Scientific, #A11073 and #A21209) were used to detect insulin and CD3 antibodies, respectively. All images were taken with a Zeiss LSM710NLO confocal microscope.

[0043] Figures 19A-19B The results showed that pargyline treatment could not prevent the destruction of β cells after allogeneic transplantation. Wild-type NIT-1 cells carrying the luciferase reporter gene (10 7 ) were implanted into C57BL / 6 mice and treated with or without oral pargyline in drinking water. The bioluminescence of the grafts was measured on days 1, 2, 3, and 4 after transplantation. Representative bioluminescence images (A) and relative luminescence of the grafts over time (B) are shown. Data show mean ± SEM, n = 3 mice per group.

[0044] Figures 20A-20F Shown are the results of thermal shift assays of human recombinant renalase in the presence of pargyline (A), rasagiline (B), sitagliptin (C), tranylcypromine (D), isocarbazine (E), or toloxatone (F). All drugs were used at 100 mM and resulted in destabilization of the enzyme as evidenced by a decrease in the unfolding temperature (leftward shift of the curve).

[0045] Fig.21A and 21B Figures showing the in vivo effects of pargyline in a diabetic model. (A) Pargyline treatment reduces the incidence of diabetes after cyclophosphamide injection. Ten-week-old male NOD mice were grouped and fed pargyline (5 μg / ml) in drinking water. Diabetes was induced by intraperitoneal injection of cyclophosphamide (200 mg / kg). (B) Pargyline treatment reduces the incidence of diabetes after PD-1 blockade. Ten-week-old female NOD mice were grouped and fed pargyline (10 μg / ml) in drinking water. Diabetes was induced by intravenous injection of anti-PD-1 antibody (250 μg / mouse).

[0046] Figures 22A-22C Shown are the in vivo effects of pargyline treatment (25 μg / ml pargyline in drinking water) on a mouse model of type 1 diabetes. Pargyline treatment improved survival when diabetes was induced by adoptive transfer (A) or by low-dose streptozotocin (STZ, B). Pargyline also delayed the onset of diabetes after STZ treatment (C).

[0047] Description of the sequence

[0048] Table 1 provides a listing of certain sequences mentioned herein.

[0049]

[0050]

[0051] Description of Embodiments

[0052] I. Definitions

[0053] In addition to the definitions in this subsection, further definitions of terms are interspersed throughout the text.

[0054] In the present invention, "a" or "an" means "at least one" or "one or more" etc., unless the context clearly indicates otherwise. The term "or" means "and / or" unless otherwise indicated. However, in the case of multiple dependent claims, the use of the term "or" means to refer to more than one of the preceding claims in an alternative manner.

[0055] As used herein, "autoimmunity" or "autoimmune attack" refers to an attack by a subject's immune system on cells that are part of the subject. Thus, an autoimmune disease is an abnormal immune response to a normal body part. In the case of type 1 diabetes, the autoimmune attack is primarily directed against the beta cells of the pancreas, which normally secrete insulin in a glucose-dependent manner. As used herein, "autoimmune diabetes" relates to any diabetes induced by an autoimmune attack, such as type 1 diabetes or diabetes induced by immunotherapy.

[0056] As used herein, "β-like cell" refers to any cell that secretes insulin in response to glucose. Thus, a pancreatic β cell is a "β-like cell." A β-like cell can be derived from a cell that does not normally produce insulin in response to glucose. For example, a β-like cell can be a stem cell that is induced to differentiate into a "β-like cell" that produces insulin in response to glucose. (See FW Pagliuca et al., Cell 159:428-439 (2014); E Kroon et al., Nature Biotech 26(4):443-452 (2008); and A Rezania et al., Nature Biotech 32(11):1121-1133 (2014). Similarly, "β-like cells" can also be pancreatic exocrine cells (see Q Zhou et al., Nature 455:627-633 (2008)), pancreatic α cells (see Li et al., Cell 168:86-100 (2017)), or intestinal cells (see Ariyachet C et al., Cell Stem Cell 18(3):410-21 (2016)), which are induced to produce insulin in response to glucose. The term "β-like cells" also includes cells that become glucose-responsive insulin secretors after being transplanted into a subject.

[0057] As used herein, the term "treatment" includes any administration or therapeutic application to a subject's disease, and includes inhibiting the disease, preventing its development, alleviating one or more symptoms of the disease, or preventing the recurrence of one or more symptoms of the disease. For example, treatment of a subject with type 1 diabetes may include alleviating hyperglycemia, or reducing the subject's need for exogenous insulin, compared to a time point before administration of the drug.

[0058] II. MAOIs that bind renalase or FAD

[0059] The present application relates to lowering blood glucose or increasing insulin secretion in response to glucose in a subject, comprising administering a monoamine oxidase inhibitor (MAOI), wherein the MAOI binds to renal isothiocyanate (RNLS), binds to flavin adenine dinucleotide (FAD), and / or produces an active agent that binds to RNLS or FAD.

[0060] The binding site for flavin adenine dinucleotide (FAD) is conserved in flavoprotein oxidases, such as RNLS and MAO (see Gaweska and Fitzpatrick Biomol Concepts. 2(5):365-377 (2011)). These flavoprotein oxidases may have structural diversity in other regions, but retain homology in the FAD binding site. FAD is composed of an adenine nucleotide (adenosine monophosphate) and a flavin mononucleotide bridged by their phosphate groups.

[0061] Human RNLS (hRNLS) includes a flavin adenine dinucleotide (FAD) binding site and uses FAD as a cofactor for catalysis. MAO (including MAO A and MAO B isomers) also interacts with FAD and can complex with inhibitors that bind to FAD.

[0062] A variety of MAOIs have been described, some of which can bind to FAD (see Ramsay and Albreht Journal of Neural Transmission 125:1659-1683 (2018)).

[0063] In some embodiments, the MAOI binds to renal isothiocyanate (RNLS). MAOIs that bind to RNLS can be determined using standard binding assays, such as radioligand binding, functional assays, or thermal shift assays. The present application describes various MAOIs that can bind to FAD and can also bind to RNLS. In some embodiments, a thermal shift assay can be used to determine the binding of the MAOI to RNLS, such as Figures 20A-20F The data shown in .

[0064] In some embodiments, the MAOI binds to the RNLS by binding to FAD bound to the RNLS. In some embodiments, the binding of the MAOI to the RNLS prevents or inhibits the function of the RNLS.

[0065] In some embodiments, MAOIs bind to FAD. In some embodiments, MAOIs bind to the flavin of FAD. In some embodiments, MAOIs bind to the N5 atom of flavin.

[0066] In some embodiments, MAOIs produce active species that can bind to RNLS. In some embodiments, MAOIs produce active species that can bind to FAD. In some embodiments, MAOIs are modified by RNLS to an active form that can bind to FAD or RNLS. In some embodiments, MAOIs or their active species form covalent adducts with FAD or RNLS.

[0067] In some embodiments, the MAOI binds reversibly to FAD or RNLS. In some embodiments, the MAOI binds irreversibly to FAD or RNLS.

[0068] In some embodiments, the MAOI is covalently bound to FAD or RNLS. In some embodiments, the MAOI is non-covalently bound to FAD or RNLS.

[0069] In some embodiments, the monoamine oxidase inhibitor is a propargylamine, hydrazine, propylamine, or oxazolidinone derivative.

[0070] In some embodiments, the monoamine oxidase inhibitor is propargylamine, hydrazine, propylamine or an oxazolidinone derivative. In some embodiments, the monoamine oxidase inhibitor is clorgyline, pargyline, rasagiline, sitagliptin, ladostingil, ASS234, isocarbazide, toloxatone or tranylcypromine.

[0071] III. Treatment Methods

[0072] A method of treating diabetes comprising administering a MAOI is contemplated. The method can be used to treat diabetes, including autoimmune diabetes. In some embodiments, the subject has immunotherapy-induced autoimmune diabetes or type 1 diabetes.

[0073] Also contemplated is a method of reducing blood glucose levels comprising administering a MAOI. The method can be used to treat a subject with diabetes, including autoimmune diabetes. In some embodiments, the subject has autoimmune diabetes induced by immunotherapy or type 1 diabetes.

[0074] Also contemplated is a method of increasing insulin secretion in response to glucose comprising administering a MAOI. The method can be used to treat a subject with diabetes, including autoimmune diabetes. In some embodiments, the subject has autoimmune diabetes induced by immunotherapy or type 1 diabetes.

[0075] Also contemplated is a method of preventing or slowing the death of pancreatic β cells or β-like cells comprising administering a MAOI. The method can be used to treat a subject with diabetes, including autoimmune diabetes. In some embodiments, the subject suffers from autoimmune diabetes or type 1 diabetes induced by immunotherapy.

[0076] Glucose levels in the blood are normally tightly regulated to maintain an adequate source of energy for the body's cells. Insulin and glucagon are the main hormones that regulate blood sugar levels. In response to increases in blood sugar, such as after a meal, insulin is released from the beta cells of the pancreas. Insulin regulates carbohydrate and fat metabolism by promoting the uptake of glucose from the blood into fat and skeletal muscle. Insulin also promotes fat storage and inhibits the release of glucose from the liver. Regulating insulin levels is the body's primary means of regulating glucose in the blood.

[0077] When the glucose level in the blood drops, insulin is no longer released, and instead glucagon is released from the alpha cells of the pancreas. Glucagon causes the liver to convert stored glycogen into glucose and release this glucose into the blood. Thus, insulin and glucagon work together to regulate blood sugar levels.

[0078] In one embodiment, the treatment for diabetes is administering a MAOI to the subject to lower blood sugar.

[0079] Hyperglycemia refers to elevated levels of glucose in the blood. Hyperglycemia may be associated with high levels of sugar in the urine, frequent urination, and increased thirst. Diabetes refers to the medical condition of high blood sugar.

[0080] The American Diabetes Association (ADA) advises that a fasting plasma glucose (FPG) level of 100 mg / dL to 125 mg / dL or an HbA1c level of 5.7% to 6.4% is considered hyperglycemia and may indicate that the subject is at high risk for developing diabetes (i.e., prediabetes; see ADA guidelines 2015).

[0081] The ADA states that the diagnosis of diabetes can be made in a variety of ways. A diagnosis of diabetes can be made when an HbA1c level ≥ 6.5%, an FPG level ≥ 126 mg / dL, a 2-hour plasma glucose ≥ 200 mg / dL during an OGTT, or a random plasma glucose level ≥ 200 mg / dL in a subject with typical symptoms of hyperglycemia. In some embodiments, the subject's blood glucose level is above 11.1 mmol / liter or 200 mg / dl.

[0082] Diabetes can be divided into type 1 and type 2. Type 1 diabetes (formerly known as insulin-dependent diabetes or juvenile diabetes) is an autoimmune disease characterized by the destruction of the insulin-producing beta cells of the pancreas. Typical symptoms of type 1 diabetes are frequent urination, thirst, increased hunger, and weight loss. Subjects with type 1 diabetes rely on insulin injections to survive.

[0083] If people with diabetes lack the ability to regulate their glucose levels, they may develop a range of serious complications, including hardening of the arteries, kidney disease, stroke, nerve damage and blindness.

[0084] In some embodiments, the subject being treated has diabetes according to the diagnostic criteria of the American Diabetes Association. In some embodiments, the HbA1c level of a subject with diabetes is ≥6.5%. In some embodiments, the FPG level of a subject with diabetes is ≥126 mg / dL. In some embodiments, the 2-hour plasma glucose of a subject with diabetes during OGTT is ≥200 mg / dL. In some embodiments, the random plasma glucose level of a subject with diabetes is ≥200 mg / dL or 11.1 mmol / L. In some embodiments, the random plasma glucose level of a subject with diabetes is ≥200 mg / dL or 11.1 mmol / L, and there are typical symptoms of hyperglycemia.

[0085] In some embodiments of the invention, the subject is a mammal. In some embodiments, the mammal is a human, non-human primate, cattle, horse, pig, sheep, goat, dog, cat or rodent. In some embodiments, the subject is a human subject.

[0086] In some embodiments, the subject has autoimmune diabetes. In some embodiments, the subject being treated has type 1 diabetes.

[0087] In some embodiments, the subject being treated has relatively reduced insulin levels. In some embodiments, the subject being treated has decreased beta cell mass. In some embodiments, the subject's decreased beta cell mass is due to an autoimmune disease.

[0088] Treatment of patients with therapies aimed at increasing the body's immune response to cancer, known as immunotherapy, has also been associated with the development of autoimmune diabetes (see Alrifai T et al., Case Reports in Oncological Medicine 2019: Article ID 8781347). For example, immune checkpoint antibodies have been reported to cause immune-mediated damage to pancreatic islet cells, leading to the induction of autoimmune diabetes that resembles type 1 diabetes.

[0089] In some embodiments, the subject has autoimmune diabetes induced by immunotherapy. In some embodiments, the immunotherapy is a checkpoint antibody. In some embodiments, the checkpoint antibody is an anti-PD-1 antibody, an anti-PD-L1 antibody, or an anti-CTLA-4 antibody.

[0090] In one embodiment, the method comprises lowering the blood glucose level of the diabetic subject to below about 200 mg / dL, 150 mg / dL, 100 mg / dL, or about 125 mg / dL.

[0091] In some embodiments, the treatment of diabetes is to reduce the subject's blood sugar after administration of MAOI. In some embodiments, the treatment of diabetes is to increase the subject's insulin level after administration of MAOI. In some embodiments, the treatment of diabetes is to increase the subject's insulin secretion after administration of MAOI.

[0092] In some embodiments, administration of a MAOI causes a decrease in blood glucose levels such that the levels are less than 200 mg / dL.

[0093] In some embodiments, MAOI is used in combination with other treatment methods. In some embodiments, other treatments are insulin. In some embodiments, the insulin is rapid-acting, intermediate-acting or long-acting insulin. In some embodiments, additional treatments are glucagon-like peptide analogs or agonists, dipeptidyl peptidase-4 inhibitors, amylin analogs, biguanides, thiazolidinediones, sulfonylureas, meglitinide, alpha-glucosidase inhibitors, or sodium / glucose transporter 2 inhibitors.

[0094] The present application also encompasses methods for preventing pancreatic beta cells or beta-like cells from dying, including administering a monoamine oxidase inhibitor. Exemplary beta cells or beta-like cells include those that are transplanted into a subject as a means of treating diabetes. Currently, transplanted beta or beta-like cells are susceptible to cell death due to autoimmune attacks on the transplanted cells.

[0095] In some embodiments, the β cells or β-like cells are transplanted. In some embodiments, the β cells or β-like cells are transplanted into a subject with autoimmune diabetes. In some embodiments, the β cells or β-like cells are transplanted into the pancreas, liver, or fat pad by surgery, injection, or infusion.

[0096] Other exemplary β cells or β-like cells that can be protected by MAOIs include those subjects at risk of developing autoimmune diabetes, such as those subjects who are receiving immunotherapy. In some embodiments, the β or β-like cells are β or β-like cells of a subject who is receiving immunotherapy. In some embodiments, the immunotherapy is a checkpoint antibody. In some embodiments, the checkpoint antibody is an anti-PD-1 antibody, an anti-PD-L1 antibody, or an anti-CTLA-4 antibody.

[0097] A. Transplanted β cells or β-like cells

[0098] The beta cells of the pancreas are cells that normally secrete insulin. These beta cells of the pancreas are located in the islets of Langerhans, also known as the islets of Langerhans. Transplanted beta or beta-like cells are cells that are placed into an individual, where the cells are from a different individual, or from the same individual but from a different original source in the body than the islets of Langerhans.

[0099] In some embodiments, the β or β-like cell has been reintroduced into the same or a different individual from which it was isolated. In some embodiments, the β or β-like cell is a β or β-like cell of a subject. When introduced into the same subject from which it was isolated, it is an autologous β or β-like cell. When introduced into a different subject from which it was isolated, it is a heterologous β or β-like cell.

[0100] In some embodiments, a β-like cell is a cell that does not normally produce insulin in response to glucose, but is induced or designed to have a β-like cell phenotype, i.e., induced or designed to produce insulin in response to glucose. β-like cells include "designer β cells" that are described as using a synthetic pathway to produce insulin (see M Xie et al., Science

[0101] 354(6317):1296-1301(2016)).

[0102] Various types of β-like cells have been described.

[0103] a) Stem cells

[0104] According to the present invention, any stem cell that can differentiate into β-like cells can be a β-like cell. In some embodiments, the β-like cells can be differentiated from hematopoietic stem cells, bone marrow stromal stem cells or mesenchymal stem cells.

[0105] β-like cells capable of secreting insulin in response to glucose can be generated from pluripotent stem cells (PSCs) (see FW Pagliuca et al., Cell 159:428-439 (2014)) or embryonic stem cells (ESCs) (see E Kroon et al., Nature Biotech 26(4):443-452 (2008) and A Rezania et al., Nature Biotech 32(11):1121-1133 (2014)).

[0106] In some embodiments, the stem cells may be embryonic stem cells. In some embodiments, the embryonic stem cells are taken from blastocysts. In some embodiments, the embryonic stem cells may be from in vitro fertilization and donated embryos. In some embodiments, the embryonic stem cells have undergone directed differentiation.

[0107] In some embodiments, the stem cell can be an adult stem cell. Adult stem cells may also be referred to as "somatic" stem cells. In some embodiments, adult stem cells are undifferentiated cells found in the differentiated cells of a tissue or organ.

[0108] In some embodiments, the stem cell is an induced pluripotent stem cell (iPSC).

[0109] In some embodiments, stem cells can be derived from bone marrow, adipose tissue, or blood. In some embodiments, these cells can be derived from umbilical cord blood.

[0110] In some embodiments, the stem cells undergo directed differentiation into beta-like cells. In some embodiments, the directed differentiation is based on treating the stem cells with a modulator. In some embodiments, the directed differentiation is based on culture conditions.

[0111] In some embodiments, β-like cells are produced in vitro from human PSCs (hPSCs). In some embodiments, β-like cells are produced from hPSCs by directed differentiation. In some embodiments, β-like cells are produced from hPSCs using a multi-step protocol. In some embodiments, β-like cells are produced from hPSCs using sequential regulation of multiple signaling pathways. In some embodiments, β-like cells are produced from hPSCs using a three-dimensional cell culture system.

[0112] In some embodiments, β-like cells are produced in vitro from human ESCs (hESCs). In some embodiments, β-like cells are produced from hESCs using directed differentiation. In some embodiments, β-like cells are produced from hPSCs using a multi-step protocol. In some embodiments, β-like cells are produced from hESCs using sequential regulation of multiple signaling pathways. In some embodiments, β-like cells are produced from hESCs using planar cell culture and air-liquid interface at different stages of differentiation.

[0113] b) Non-stem cells

[0114] In some embodiments, β-like cells are produced by non-stem cells. In some embodiments, β-like cells are produced by differentiated non-β cells. In some embodiments, β-like cells are produced by reprogramming or transdifferentiation of differentiated non-β cells.

[0115] In some embodiments, the β-like cell is a reprogrammed non-β cell. In some embodiments, the β-like cell is a transdifferentiated non-β cell.

[0116] Since all cells in the human body contain a complete genome, any type of cell can be induced to become a β-like cell according to the principles of reprogramming and transdifferentiation. Therefore, the present invention is not limited by the original phenotype of β-like cells.

[0117] Pancreatic exocrine cells can be reprogrammed into insulin-secreting β-like cells (see Q Zhou et al., Nature 455: 627-633 (2008)).

[0118] In some embodiments, pancreatic exocrine cells are reprogrammed into β-like cells. In some embodiments, pancreatic exocrine cells differentiate into β-like cells based on re-expression of transcription factors. In some embodiments, these transcription factors are Ngn3, Pdx1 and Mafa.

[0119] Pancreatic α cells can transdifferentiate into β-like cells. The antimalarial drug artemisin inhibits the master regulatory transcription factor Arx (Aristaless related homeobox) and enhances γ-aminobutyric acid (GABA) receptor signal transduction, resulting in weakened pancreatic α cell identity and transdifferentiation of α cells into β-like cell phenotypes (see Li et al., Cell 168: 86-100 (2017) and Ben-Othman N et al., Cell 168 (1-2): 73-85 (2017)).

[0120] In some embodiments, β-like cells are transdifferentiated cells. In some embodiments, α cells are transdifferentiated into β-like cells. In some embodiments, transdifferentiation into β-like cells is due to inhibition of Arx. In some embodiments, transdifferentiation into β-like cells is due to enhancement of GABA receptor signaling.

[0121] Gastric tissue can be reprogrammed into β-like cells (see Ariyachet C et al., Cell Stem Cell 18(3):410-21(2016)). In some embodiments, intestinal or gastric cells are reprogrammed into β-like cells. In some embodiments, reprogramming is based on the expression of β-cell reprogramming factors. In some embodiments, cells of the gastric antrum are reprogrammed into β-like cells. In some embodiments, these cells of the gastric antrum are gastric antral endocrine cells. In some embodiments, the reprogrammed gastric antral endocrine cells can be assembled into a mini-organ of β-like cells.

[0122] Also contemplated is a method of preventing the development of type 1 diabetes by administering a MAOI.Certain individuals may be predicted to be at high risk for developing type 1 diabetes based on one or more risk factors, such as family history.

[0123] In some embodiments, the method of preventing the development of type 1 diabetes comprises screening a subject for risk factors for type 1 diabetes; determining whether the subject has an increased risk of developing type 1 diabetes; and administering a MAOI if the subject has an increased risk of type 1 diabetes.

[0124] In some embodiments, screening the subject for risk factors includes obtaining data for a genetic risk score based on known gene variants associated with type 1 diabetes, a family history of type 1 diabetes, the presence of one or more autoantibodies to β-cell antigens known to predict disease risk, and / or impaired glucose tolerance.

[0125] Many people with type 1 diabetes have a genetic predisposition because their genome includes one or more type 1 diabetes-associated gene variants. The presence of one or more of these variants results in an increased risk of type 1 diabetes. Because these type 1 diabetes-associated gene variants can be inherited, subjects with a positive family history of type 1 diabetes may be at greater risk of developing the disease.

[0126] Various type 1 diabetes related gene variants have been described (e.g., see Watkins RA et al., Translation Res. 164 (2): 110-21 (2014)). In some embodiments, one or more type 1 diabetes related gene variants are composed of one or more HLA genes. In some embodiments, one or more type 1 diabetes related gene variants are HLA polymorphisms that confer a greater risk of type 1 diabetes. In some embodiments, one or more type 1 diabetes related gene variants are contained in one or more non-HLA genes.

[0127] In some embodiments, family history of type 1 diabetes is determined through patient medical history or questionnaire. In some embodiments, family history of type 1 diabetes is based on one or more siblings, parents, or grandparents having type 1 diabetes.

[0128] In some embodiments, the level of autoantibodies to beta cell antigens is measured to determine an increased risk of developing type 1 diabetes. A variety of autoantibodies to beta cell antigens are described in the literature (e.g., see Watkins 2014). Autoantibody panels are commercially available to identify individuals at risk for type 1 diabetes. Including certain antibodies, such as anti-ZnT8, in the autoantibody levels can predict individuals at risk for type 1 diabetes. In some embodiments, the presence of one or more autoantibodies is used to determine an increased risk of developing type 1 diabetes. In some embodiments, the number of autoantibodies or the titer of a specific autoantibody is used to determine an increased risk of developing type 1 diabetes.

[0129] In some embodiments, impaired glucose tolerance is used to determine an increased risk of developing type 1 diabetes. In some embodiments, a subject at increased risk of developing type 1 diabetes shows an abnormal glucose tolerance result but does not currently meet the criteria for type 1 diabetes.

[0130] In some embodiments, according to the presence of more than one risk factor, it is determined that the subject has an increased risk of type 1 diabetes. For example, a subject with a positive family history of type 1 diabetes may be determined to have abnormal glucose tolerance at the same time. Multiple risk factors for type 1 diabetes can be assessed to determine the risk of the subject suffering from type 1 diabetes. In some embodiments, an algorithm based on multiple risk factors is used to determine the risk of the subject suffering from type 1 diabetes (e.g., see Watkins 2014).

[0131] In some embodiments, a subject at increased risk for type 1 diabetes is administered an MAOI. In some embodiments, administration of an MAOI can prevent the onset of type 1 diabetes in a subject at increased risk. In some embodiments, administration of an MAOI can delay the time it takes for a subject at increased risk to develop type 1 diabetes. Example

[0132] Example 1. CRISPR screening of β-cell protective mutations identified the T1D GWAS candidate gene Rnls

[0133] The selective pressure of autoimmunity was used to screen for protective mutations in β cells on a genome-wide scale. To achieve efficient genome editing and experimental reproducibility, we used the NIT-1 β cell line, which was originally derived from insulinomas in nonobese diabetic (NOD) mice (5). These cells are suitable for autologous transplantation into NOD mice, the most extensively studied animal model of type 1 diabetes (6). Importantly, NIT-1 cells transplanted into diabetic NOD mice are rapidly destroyed by autoimmunity ( Figure 6A-6B ). NIT-1 cells were transduced with the mouse lentiviral GeCKO A CRISPR library, which contains approximately 60,000 gRNAs targeting a total of approximately 19,050 genes (7). A low multiplicity of infection (MOI) was used to ensure that cells carried no more than one mutation. A total of 10 7 The mutant NIT-1 cells were transplanted into immunodeficient NOD.scid mice, and spleen cells from diabetic NOD mice were injected into the transplant recipients to induce β-cell killing ( Figure 1). Despite the almost complete destruction of beta cells, a small population of NIT-1 cells was recovered after 8 weeks that had survived the onslaught of autoimmunity. The target genes were identified by sequencing the gRNAs present in the surviving beta cells. Only 11 unique gRNA sequences were detected, corresponding to 11 target genes, which appeared at high frequencies in NIT-1 cells that survived autoimmune killing ( Figure 1 ). Notably, one of these genes was Rnls, a candidate gene for a region of the human genome identified through GWAS as associated with overall risk of T1D (8) and age of diabetes onset (9). Rnls was prioritized for validation based on its association with autoimmune diabetes in humans.

[0134] Example 2. Rnls deficiency protects β cells from autoimmune killing

[0135] A Rnls mutant NIT-1 cell line was generated using the Rnls gRNA discovered in the screen (Rnls mut )( Figure 7A-7B NIT-1 cells were also engineered to carry a luciferase reporter gene for longitudinal non-invasive imaging of β cells after transplantation ( Figure 6A-6B ). Validation experiments were performed using methods similar to those of the initial genome-wide screen. Figure 2A As shown, Rnls mut The cells and control NIT-1 cells transduced with non-targeting (NT) gRNA were co-transplanted into opposite flanks of NOD.scid mice. The transplant recipients were then injected with spleen cells from diabetic NOD mice. As a control for the survival and proliferation of β cells in the absence of autoimmunity, the grafts of β cells were monitored in NOD.scid mice that did not receive diabetogenic immune cells. The control NIT-1 cells were killed by autoimmunity within one to two weeks after transplantation, as measured by loss of graft luminescence and analysis of grafts removed from euthanized mice. In contrast, Rnls mut NIT-1 cells persist in the same recipient mouse for up to 2 months ( Figure 2B-2D and data not shown). Next, the protective capacity of Rnls deficiency was validated by direct implantation of NIT-1 cells into overtly diabetic NOD mice ( Figure 2E ). Similarly, NIT-1 cells in the control group were rapidly eliminated, while Rnls mut Cells survived significantly longer in diabetic NOD mice with persistent autoimmunity ( Figure 2F-2H ).

[0136] Disruption of Rnls was tested to see if it would similarly protect primary mouse beta cells. Pancreatic islets were isolated from immunodeficient NOD.scid mice that lack autoimmune infiltration in the pancreas. Dispersed islet cells were treated with a Cas9 endonuclease encoding a rat insulin promoter and targeting Rnls. mut ) gRNA or non-targeting (NT) control gRNA ( Fig.2I ). Gene-edited and control islet cells were transplanted under one kidney capsule of the same NOD.scid mouse. Two weeks later, the transplant recipients were injected with spleen cells from diabetic NOD mice to induce autoimmune beta cell killing. As a control for the effects of gene disruption in the absence of autoimmunity, islet grafts were also followed in NOD.scid recipients that did not receive spleen cells from diabetic mice. As expected, autoimmunity reduced the size of the control grafts and the expression of insulin ( Figure 2J-2L ). In contrast, Rnls mut Islets survived autoimmunity and maintained insulin expression. These results suggest that targeting Rnls in primary β cells is protective in the pathophysiologically relevant setting of autoimmune diabetes. Notably, targeting Rnls did not affect the in vitro insulin secretion capacity of islet cells ( Figure 8 ).

[0137] Example 3. Rnls mutations reduce immune recognition of β cells

[0138] The direct effects of Rnls deletion on immune recognition were investigated. mut The expression of MHC class I and class II molecules on the surface of NIT-1 cells was comparable to that of control cells ( Figure 3A and 3B Rnls are responsive to β cells co-cultured with antigen presenting cells and NIT-1 β cells (12) (BCD2.5 TCR transgenic (10,11)) CD4 + There was no significant effect on T cell responses ( Figure 3C ). However, Rnls mut NIT-1 cells elicited a markedly attenuated polyclonal β-cell reactive CD8 isolated from diabetic NOD mice + T cell response ( Figure 3D Since the deficiency of Rnls impairs the response of autoreactive cytotoxic T cells, we tested the mut NIT-1 cells protect against T cell alloreactivity. To test this, Rnls mutand control NIT-1 cells were transplanted into opposite flanks of MHC-mismatched C57BL / 6 mice. Both β-cell transplants were rapidly destroyed by a strong allogeneic response by host immune cells ( Figures 9A-9B ), showing that Rnls deficiency does not affect allogeneic rejection. These data suggest that Rnls mut It is not that β cells are immune to immune detection or killing, but rather that they are unable to fully stimulate autoreactive CD8 + T cells.

[0139] Example 4. Rnls mutations confer ER stress resistance

[0140] Accumulating evidence supports a role for ER stress in β-cell death in diabetes. The unfolded protein response (UPR) triggered by ER stress has been implicated in β-cell apoptosis in T1D and type 2 diabetes (13-15). Importantly, ER stress has been postulated to promote β-cell death in T1D not only directly but also indirectly, as it is able to increase the presentation of self- and neoantigens, for example by affecting post-translational modifications (12,16-18). Rnls mutations may affect the cellular response to ER stress, thereby attenuating the stimulation of diabetogenic CD8+ T cells. To test this idea, NIT-1 cells were challenged with the ER stress agent thapsigargin (TG). Control cells were highly sensitive to TG treatment, with concentrations greater than 50 nM killing the majority of cells. Remarkably, Rnls mutant cells even withstood 20-fold higher TG concentrations ( Figure 4A Similar results were also observed for another ER stress agent, tunicamycin (TC) ( Figure 4B ). It is worth noting that Rnls mut NIT-1 cells remain sensitive to mitomycin C and streptozotocin, two drugs that cause cell death independent of ER stress ( Figures 10A-10B ). These data suggest that Rnls deficiency does not protect against all forms of cell death and that its protective effects may be limited to specific cellular stressors. To determine whether ER stress resistance was a direct effect of the Rnls mutation and not due to off-target effects of the Rnls gRNA, additional cell lines were generated in which either exons 2 to 4 or exon 5 of the Rnls gene were deleted using different gRNAs. These alternative Rnls-deficient β-cell lines were again protected from ER stress-induced cell death ( Figures 11A-11D ), confirming that ER stress resistance is a direct consequence of Rnls deficiency.

[0141] Example 5. Overexpression of Rnls sensitizes β cells to ER stress and autoimmunity

[0142] To further evaluate the role of Rnls in altering β-cell sensitivity to ER stress and autoimmunity, we overexpressed Rnls in NIT-1β cells using lentiviral transgenesis. Although overexpression of Rnls alone only slightly increased sensitivity to TG-induced killing ( Figures 12A-12B ), but it appeared to significantly accelerate autoimmune killing of beta cells implanted in diabetic mice ( Figures 13A-13C ). Reintroduction of Rnls into Rnls using a transgene with a synonymous mutation at the gRNA target site mut Re-expression of Rnls restored the expression of Rnls mut Cellular sensitivity to ER stress ( Figures 12A-12B In addition, re-expression of Rnls also accelerated the expression of Rnls in diabetic NOD mice. mut Autoimmune destruction of cells Figures 14A-14B ). Collectively, these data suggest that Rnls expression can modulate β-cell vulnerability to ER stress and autoimmunity. Notably, Rnls expression was 10-15-fold higher in islets of diabetes-prone NOD mice than in diabetes-resistant C57BL / 6 mice ( Fig.15 ). The elevated expression of Rnls is not simply a consequence of pancreatic inflammation, as similar Rnls mRNA levels were measured in the pancreas of both NOD and immunodeficient NOD.scid mice. This intriguing observation suggests that Rnls may be a genetically encoded regulator of β-cell vulnerability in both mice and humans, although the exact manner in which Rnls expression is regulated in these two species remains to be elucidated.

[0143] Example 6. Rnls alter the cellular response to ER stress

[0144] To understand how Rnls deficiency increases ER stress resistance, we measured the UPR, which mediates cellular adaptation to ER stress. Activation of key ER stress sensors IRE1α (19), PERK (20), and ATF6 (21) was upregulated in the presence of Rnls. mut Downstream of these UPR triggers, phosphorylation of eIF2α, protein levels of ATF4, and splicing of XBP1 were significantly reduced ( Figure 4C and 4D ,as well as Figures 16A-16H The expression of Chop and Txnip was also reduced ( Figure 4E and Figures 16A-16H), both of which have been implicated in ER stress-induced apoptosis (22-24). These data suggest that Rnls deficiency increases the threshold of ER stress that triggers the UPR, which could explain how Rnls mutations suppress the proapoptotic effects of stimuli that cause cellular stress. The protective effects of Rnls deficiency are not limited to ER stress, as Rnls mut The cells also tolerated oxidative stress better than control NIT-1 cells ( Fig.17 Consistent with this finding, loss of Rnls increased the expression of NRF2 (25), a key regulator of the oxidative stress response. Figure 4C and Fig.16H ) The lack of Rnls appears to increase the ability of beta cells to withstand the cellular stresses that are implicated in destruction during type 1 diabetes.

[0145] Example 7. Pargyline phenotype mimics the protective effect of Rnls deficiency

[0146] Rnls is a flavoprotein oxidase whose cellular function has not been elucidated (26). Its proposed substrates are 2- and 6-dihydroNAD(P) (27), isomers of β-NAD(P)H, although it is unclear whether these are physiologically relevant. However, the crystal structure of human RNLS was solved several years ago (28). The enzyme utilizes a FAD cofactor for catalysis, similar to other oxidases, including monoamine oxidase B (MAO-B). Based on structural similarities, the FDA-approved MAO-B inhibitor pargyline (29) was predicted to bind to RNLS ( Figure 5A To test this prediction, the thermal stability of RNLS was measured in the presence or absence of pargyline ( Figure 5B and 5C Pargyline reduced the thermal stability of RNLS in a dose-dependent manner, suggesting a direct interaction between the drug and the enzyme. Pargyline is an oral drug that is soluble in water and can be administered to mice via the drinking water. The efficacy of pargyline was evaluated in a rigorous β-cell transplantation model. Recently, diabetic NOD mice with severe hyperglycemia (blood glucose > 600 mg / dL) were transplanted with NIT-1β cells ( Figure 5D ). Graft survival was again monitored longitudinally by noninvasive bioluminescence imaging ( Figure 5E Untreated mice remained hyperglycemic and rapidly lost their beta cell grafts ( Figure 5E-5G Notably, pargyline treatment enabled the transplanted β cells to survive, produce insulin, and reverse hyperglycemia in diabetic mice ( Figure 5E-5H ). Histological analysis of the pancreas 3 weeks after the onset of diabetes and transplantation showed that mice treated with pargyline still had a large number of pancreatic glands rich in insulin ( Fig.18 ). In contrast, the pancreases of untreated diabetic mice were completely devoid of insulin staining. These observations suggest that pargyline protects not only transplanted NIT-1 cells but also endogenous β cells from autoimmunity, reproducing the protective effect of Rnls deficiency. Notably, pargyline did not prevent allogeneic rejection of NIT-1 cells transplanted into C57BL / 6 mice, indicating that the drug has no immunosuppressive effects (Figure 19A19B). This observation again replicates the effect of Rnls deficiency, which confers protection against autoimmunity but not alloreactivity.

[0147] These data suggest that RNLS is a regulator of β-cell vulnerability in T1D. This finding could explain why genomic variation at the RNLS locus influences both the overall risk of T1D (8) and the age of onset (9). How disease-associated variants alter the function or expression of RNLS is unclear. Based on our results, it seems necessary to explore how this candidate T1D risk gene is regulated. Rnls are differentially expressed in islets between diabetes-prone NOD mice and diabetes-free C57BL / 6 mice, further supporting the idea that RNLS may be a genetic risk factor for β-cell autoimmunity.

[0148] These data also highlight the central role of β-cell ER stress in promoting islet autoimmunity. The ER and oxidative stress resistance conferred by Rnls deficiency is associated with protection against autoimmunity, which is consistent with the growing literature implicating ER stress in T1D.

[0149] Importantly, the finding that RNLS deletion renders β cells resistant to autoimmunity suggests that there is a genetic engineering solution for β-cell replacement in T1D that does not perturb either β-cell properties or immunity and immune surveillance. RNLS deletion may be a safe and effective modification in SC-β cells to overcome autoimmunity in patients with T1D. Finally, an FDA-approved drug that replicates the protective effects of RNLS deletion has been described. Its apparent efficacy in protecting β cells, coupled with its favorable safety profile, should make pargyline and other MAO-B inhibitors predicted to target RNLS worthy of further evaluation for the prevention or treatment of type 1 diabetes.

[0150] Example 9. Evaluation of MAO Inhibitors as RNLS Inhibitors

[0151] To test the predicted binding of monoamine oxidase inhibitors (MAOIs) to human recombinant renalase (rRNLS), a thermal shift assay was performed, which measures the unfolding of a protein at increasing temperatures using a hydrophobic fluorescent probe. As the temperature increases, the fluorescence increases because the protein unfolds and exposes hydrophobic residues to which the probe can bind.

[0152] Human recombinant RNLS protein was produced by GenScript USA Inc. using the E. coli expression vector pET28a-MBP. RNLS protein was obtained from the supernatant of cell lysate and then purified by Ni Bio-rad column. 2mM RNLS dissolved in PBS was incubated with 100mM pargyline (Sigma-Aldrich, #P8013), rasagiline (Tocris, cat#4308) or sitagliptin (Tocris, cat#1095) at 4°C for 20 minutes, and then SYPRO Orange dye (Invitrogen, #S6650) was added to determine thermal denaturation. Thermal shift assays were performed using the QuantStudio 6Flex Real-Time PCR system (Applied Biosystems), with the initial temperature maintained at 25°C for 2 minutes, then raised to 95°C at a rate of 1°C / s, and finally maintained at 95°C for 2 minutes. Results were collected in increments of 0.25°C.

[0153] Three propargylamine drugs for MAO-I (pargyline ( Fig. 20A ), Rasagiline ( Fig. 20B ) and sitagliptin ( Fig. 20C )) altered the thermal unfolding curve of rRNLS, indicating that these compounds directly interact with the enzyme, as predicted by structure-based modeling.

[0154] Example 10. In vivo effects of pargyline treatment on a diabetes prevention model

[0155] To test the ability of MAO-I pargyline to prevent the onset of autoimmune diabetes in the nonobese diabetic (NOD) mouse model, the best characterized model of type 1 diabetes, animals were given oral pargyline prior to disease induction. Fig.21A ) or anti-PD-1 antibody ( Fig. 21B) induces diabetes. Cyclophosphamide is a compound known to accelerate the onset of diabetes in the NOD model (see Harada M & Makino S, Diabetologia 1984, 3: 429). PD-1 blockade has also been shown to cause rapid onset of diabetes in NOD mice (see Ansari MJ et al. J Exp Med 2003, 198: 63), and immune checkpoint inhibition (including PD-1 inhibition) used to treat various cancers can cause autoimmune diabetes in some patients (reviewed in Clotman K et al., J Clin Endocrinol Metab 2018, 103: 3144).

[0156] Ten-week-old male or female NOD mice were intraperitoneally injected with cyclophosphamide (200 μg / g body weight, Sigma-Aldrich,

[0157] #C0768) or anti-PD-1 (250 μg / mouse intravenously, BioXcell, #BE0146) to induce diabetes. Pargyline treatment was started one week before disease induction. Blood glucose was monitored every 1-2 days to test the onset of diabetes.

[0158] Pargyline treatment protected against the induction of diabetes and significantly reduced the proportion of diabetic animals after cyclophosphamide or anti-PD-1 treatment ( Figures 21A-21B ).

[0159] The protective effects of pargyline treatment were also evaluated in other mouse models of type 1 diabetes.

[0160] In a model of type 1 diabetes, 10 million spleen cells from diabetic NOD mice were adoptively transferred (transplanted by intravenous injection) into immunodeficient NOD.scid mice treated with or without pargyline (25 μg / ml pargyline in drinking water). Recipient mice were tested for diabetes within 110 days after cell transfer. Kaplan-Meier survival curves were compared by log-rank test, and treatment with pargyline significantly improved survival (P = 0.027, Fig.22A ).

[0161] In another type 1 diabetes model, C57BL / 6 mice were induced to develop diabetes by repeated injections of low-dose streptozotocin (STZ, 50 mg / kg / day, intraperitoneal injection of STZ for 5 consecutive times per day). Pargyline was started one week before the induction of diabetes.

[0162] Mice were treated with 25 μg / ml pargyline in drinking water. Kaplan-Meier survival curves were compared by log-rank test (P = 0.01, Fig. 22BThe Mann-Whitney test was used to compare the diabetes onset days of the diseased mice (P = 0.004, Fig. 22C ). Pargyline treatment significantly increased the survival rate after STZ treatment and delayed the onset of diabetes after STZ treatment.

[0163] Example 11. Screening for other MAOIs that bind to RNLS

[0164] Other known MAOIs were tested for rRNLS binding by thermal shift assay. Both are irreversible MAOIs, tranylcypromine ( Fig.20D ) and hydrazine ( Fig.20E ), and the reversible MAO-A inhibitor toloxatone ( Fig.20F ), shifted the thermal unfolding curve of rRNLS in a manner comparable to that of pargyline, indicating that these compounds also interact directly with the enzyme.

[0165] Example 12. Materials and Methods

[0166] The following methods were used in the experiments.

[0167] Mouse

[0168] Non-obese diabetic (NOD) mice, NOD.scid (NOD.CB 17-Prkdc scid Both C57BL / J and C57BL / 6J were purchased from Jackson Laboratory (Bar Harbor, ME). Animals were housed in a pathogen-free facility at the Joslin Diabetes Center, and all experimental procedures were approved and performed in accordance with institutional guidelines and regulations.

[0169] CRISPR GeCKOA library screening

[0170] Mouse GeCKO-v2 (Genome-Scale CRISPR Knock-Out) A lentiviral collection library was obtained from Addgene (Addgene, #1000000052), targeting 19050 genes with 3 gRNAs / gene (30), and was prepared as described previously (31). Wild-type NIT-1 cells (ATCC #CRL-2055) were infected with the GeCKO A CRISPR lentiviral library at an MOI of 0.3 and then selected with puromycin (2 μg / ml) on day 3 after lentiviral infection. 7 The mutant NIT-1 cells were transplanted subcutaneously into 8-week-old female NOD.scid mice and injected intravenously with 10 7diabetic NOD splenocytes in 200 μl sterile PBS to induce autoimmunity. NOD.scid mice transplanted subcutaneously with mutant NIT-1 cells but not injected with diabetic NOD splenocytes were used as controls (non-autoimmune group). Diabetic NOD splenocytes were isolated from spontaneously diabetic female NOD mice as described previously (32). Screening was terminated 8 weeks after injection, and the remaining grafts were recovered from autoimmune and non-autoimmune mice. Genomic DNA was extracted from the grafts (Quick-gDNA midiprep kit, Zymo Research), and NGS (next generation sequencing) libraries were prepared as previously described (33), and NGS sequencing analysis was performed (Novogene, CA). Standard bioinformatics methods were used to extract gRNA sequences from the NGS sequencing data, and the distribution of gRNAs was calculated as counts per million (CPM).

[0171] Cell lines

[0172] NIT-1 (#CRL-2055) and 293FT (#R7007) cell lines were from ATCC and Thermo Fisher Scientific, respectively. Cells were maintained in DMEM (Gibco, 10313039) supplemented with 10% fetal bovine serum (FBS, Gibco), glutagro and penicillin / streptomycin (Corning) in a 37°C incubator with 5% CO2. To generate control and Rnls mut NIT-1 cells, non-targeting (NT) gRNA (5'TAAAAACGCTGGCGGCCTAG 3', MGLibA_67395 (SEQ ID NO: 2)) and Rnls gRNA (5'CTACTCCTCTCGCTATGCTC 3', MGLibA_46009 (SEQ ID NO: 1)) were cloned into the LentiCRISPR-v2 vector, and these cell lines were established using lentivirus containing NT or Rnls gRNA, respectively. mutRnls mutations in cells were confirmed by deep sequencing analysis (MGH DNA Core Facility, Cambridge, MA). Rnls-overexpressing NIT-1 cell lines were generated by infecting wild-type (WT) NIT-1 cells with full-length mouse Rnls lentivirus driven by the EF1α promoter (of note, the full-length mouse Rnls we cloned and used was based on the annotation of the NCBI database at the end of 2017, which contained 300 aa. The Rnls annotation in NCBI was updated in March 2019, and the encoded protein now has 42 additional amino acids at the N-terminus). To generate Rnls expressing CiRnls mut Cells were transduced with Rnls mutant NIT-1 cells using lentivirus carrying a full-length mouse Rnls (CiRnls) driven by the CRISPR-immune EF1α promoter and containing a synonymous mutation in the gRNA target site of Rnls. The modified gRNA target sequence used in CiRnls was 5'TTATAGTAGCCGGTACGCA 3' (SEQ ID NO:3). Rnls-deficient NIT-1 cell lines (Rnls Ex2 / 4 and RnlsEx5) were generated according to previously published protocols (36). Two gRNAs were designed to target the 5'- and 3'-ends of the genomic DNA sequence of Rnls exons 2-4 or exon 5. The gRNA sequences for exons 2-4 were 5'CGTCTGGGAAGTCTTGGTCG 3' and 5'

[0173] CGGGACTCATCCCATTGTCG 3' (SEQ ID NO: 4-5); the gRNA sequence of exon 5 is 5'

[0174] GGGGAGTGAGGATAGGATAG 3' and 5'TCCGTAGTGGTTTTAGAGTG 3' (SEQ ID NO: 6-7). The lenti-multi-CRISPR plasmid (Addgene, #85402) was used to express two single gRNAs cassettes for deleting exons 2-4 or exon 5 of Rnls. The two gRNA cassettes were amplified using the Phusion High-Fidelity PCR Kit: 40 cycles: 98°C, 15 seconds; 60°C, 15 seconds; 72°C, 30 seconds. The PCR products were digested with BbsI (Invitrogen) and subcloned into the pSpCas9(BB)-2A-Puro(PX459) v2.0 vector (Addgene, #62988). These plasmids were then transfected into NIT-1 cells by polyethylenimine (FisherScientific) followed by puromycin selection. The sequences of all plasmids were verified by Sanger sequencing before transduction and transfection.

[0175] Preparation and transplantation of primary pancreatic islets

[0176] Islets were prepared and purified from 8-week-old female NOD.scid mice as described previously (35). Purified NOD.scid mouse islets were immediately cultured in low-adhesion dishes in RMPI 1640 medium (Gibco) supplemented with 10% FBS and penicillin / streptomycin. Lentivirus encoding NT or Rnls gRNA together with Cas9 endonuclease under the control of the rat insulin promoter (RIP) was added to the culture medium for overnight infection. The next day, the islets were washed twice with culture medium, and approximately 300 islets were transplanted under each kidney capsule of 8-week-old female NOD.scid mice. The transplant recipients were allowed to recover from surgery for two weeks, and then the mice were randomly assigned to non-autoimmune and autoimmune groups. Mice in the autoimmune group were intravenously injected with 10 purified from spontaneously diabetic female NOD mice. 7 Splenocytes were prepared as described previously (32). On day 25 after splenocyte injection, islet grafts were recovered and gene expression analysis was performed by quantitative real-time PCR (qPCR).

[0177] Quantitative real-time PCR (qPCR)

[0178] Cells or islet transplants were treated with TRIzol (Thermo Fisher Scientific) and RNA was extracted according to the manufacturer's protocol. Purified RNA was reverse transcribed into cDNA using the SuperScript IV First Strand Synthesis Kit (Invitrogen). Insulin 1 (Mm01259683_g1), Glucagon (Mm01269055_m1), and Hprt1 (Mm0302475_m1) probes for TaqMan assays were purchased from Thermo Fisher Scientific. Gene expression levels of Chop and Txnip were analyzed by SYBR green PowerUp qPCR assay (Applied Biosystems). Primer sequences for Chop: forward-5'CCACCACACCTGAAAGCAGAA 3' (SEQ ID NO: 8); reverse-5'AGGTGAAAGGCAGGGACTCA3' (SEQ ID NO: 9); Txnip: forward-5'TCAAGGGCCCTGGGAACATC 3' (SEQ ID NO: 10); reverse-5'GACACTGGTGCCATTAAGTCAG 3' (SEQ ID NO: 11). All qPCR assays were performed using the QuantStudio6Flex Real-Time PCR System (Applied Biosystems).

[0179] Cell viability assay

[0180] Cells were seeded in 96-well white plates (50,000 cells / well) and cultured overnight in the presence or absence of indicated concentrations of thapsigargin, tunicamycin, streptozotocin (Sigma-Aldrich), mitomycin C (Fisher Scientific), or hydrogen peroxide (H2O2, Fisher Scientific). Cell viability was assessed 24 h later using the CellTiter-Glo Luminescent Cell Viability Assay (Promega).

[0181] In vivo bioluminescence imaging

[0182] The NIT-1 cell line was engineered to constitutively express the firefly luciferase gene (Luc2) driven by the EF1α promoter via lentiviral delivery, except for Figure 7, where a CMV-Luc2 construct was used. Mice transplanted with luciferin-expressing cells were injected intraperitoneally with D-luciferin at a dose of 150 mg / kg for bioluminescent imaging. D-luciferin (Gold Biotechnology, Cat#LUCK) solution was prepared in sterile DPBS (without calcium or magnesium) at a concentration of 15 mg / ml and filtered (0.22 μm) before injection. Luminescence was measured using an IVIS Spectrum imaging system (PerkinElmer).

[0183] XBP1 splicing assay

[0184] Cells were treated with 1 μM DMSO or thapsigargin for 5 h. RNA was extracted with TRIzol and reverse transcribed into cDNA as described for qPCR. Spliced ​​(s) and unspliced ​​(u) Xbp1 cDNAs were amplified by PCR for 35 cycles using Phusion High-Fidelity DNA Polymerase (Invitrogen): 94°C, 10 sec; 64°C, 30 sec; 72°C, 30 sec. The sizes of the PCR products of Xbp1 were 473 bp (Xbp1u) and 447 bp (Xbp1s) and were separated by electrophoresis on 3% agarose gel. The ratio of Xbp1s / Xbp1u was measured by Adobe Photoshop CC 2019. The primer sequences for Xbp1 were forward-5'AAACAGAGTAGCAGCGCAGACTGC 3' (SEQ ID NO: 12) and reverse-5'TCCTTCTGGGTAGACCTCTGGGAG 3' (SEQ ID NO: 13).

[0185] Western blotting

[0186] Cell lysates were collected in RIPA lysis buffer containing protease and phosphatase inhibitors (cOmplete protease inhibitor cocktail, Sigma-Aldrich; Pierce phosphatase inhibitor, Thermo Scientific Fisher) on ice. Protein concentration was measured using Pierce BCA protein assay (Thermo Scientific Fisher). 40 μg of denatured cell lysate protein was used for SDS-PAGE electrophoresis (4-20% TGX gel, Bio-Rad). The primary antibodies used subsequently were: PERK (Cell signaling, #3192), phospho-PERK (Thr980, Cell signaling, #3179), ATF4 (Cellsignaling, #11815), ATF6 (Novus Biologicals, #NBP1-40256SS), eIF2α (Cellsignaling, #2103), phospho-eIF2α (Ser51, Cell signaling. #3597), IRE1α (Cellsignaling, #3294), phospho-IRE1α (Ser724, Novus Biologicals, #NB100-2323SS), Txnip (MBL, K0205-3), cleaved Caspase 3 (Cell signaling, #9664S), NRF2 (Santa Cruz Biotechnology, #54715). Cruz, #SC365949) and actin (ABclonal, #AC004). All images were acquired and quantified using a C-DiGit blot scanner and Image Studio software (LI-COR Biosciences).

[0187] T7 Endonuclease I Assay

[0188] Rnl mut CRISPR / Cas9 editing in cells was detected by T7 endonuclease I mismatch cleavage assay. The Quick-gDNA miniprep kit (Zymo Research) was used to prepare the gDNA from control and Rnls mutGenomic DNA (gDNA) was purified from NIT-1 cells. The Rnls gRNA targeting site was amplified using the Phusion High-Fidelity PCR Kit (Thermo Fisher Scientific). The primers used for Rnls gRNA site PCR were: forward 5'TGCTATAGACAGTTGGGACTTGTTT 3' (SEQ ID NO: 14); reverse 5'ATATTGCGTTCTATTATCAATGGAGATGAAGC 3' (SEQ ID NO: 15). The PCR product (approximately 200 ng) was denatured at 95°C for 5 minutes and then reannealed in a thermal cycler using the following protocol to form heteroduplexes: ramp down to 85°C at -2°C / sec; ramp down to 25°C at -0.1°C / sec; hold at 4°C. 10 units of T7 endonuclease I were added to the annealed PCR product and the reaction was incubated at 37°C for 15 minutes. The digestion reaction was stopped with 1 μL of 0.5 M EDTA and immediately applied to a 1.5% agarose gel to visualize the digested and undigested products by electrophoresis.

[0189] CD4 + T cell stimulation assay

[0190] Using CD25 + CD25 Treg cells were isolated from BDC2.5-TCR transgenic (Tg) NOD mice using the Regulatory T Cell Isolation Kit (Miltenyi, 130-091-041). - CD4 + T cells. Before incubation with NIT-1 cells, purified CD4 + T cells were maintained in culture for three weeks by weekly stimulation with 1 μM BDC2.5 mimetic epitope in the presence of irradiated splenocytes from NOD.scid mice and 20 U / mL IL-2 (Peprotech, 212-12-20UG). The day before co-culture of T cells and NIT-1, NIT-1 cell lines were incubated with or without 1 μM thapsigargin for 5 hours. NIT-1 cells were washed extensively with complete DMEM after incubation. Then 5x10 4 NIT-1 cells were plated in 100 μL of culture medium in each well of a 96-well plate. 5 BDC2.5-Tg CD4 + T cells and 5x 10 5NOD.scid spleen cells were resuspended in 100 μL RPMI medium and added to NIT-1 cultures. Cells were co-cultured in a 5% CO2 and 37°C incubator for 24 hours. During the last 5 hours of culture, cells were treated with BD Golgi plug (diluted 1:1,000; BD bioscience, #555029). After incubation, cells were collected and stained with the following antibodies, all purchased from BioLegend; BV785 CD3 (clone 17A2, #100231), PE-Cy7 CD4 (clone GK1.5, #100421), PE anti-TNF-α (clone MP6-XT22, #506306), PE rat IgG1kappa isotype control (clone RTK2071, #400407), APC IFN-γ (clone XMG1.2, #505810), and APC rat IgG1 kappa isotype control (clone RTK2071, #400411). Zombie Violet Fixable Viability Kit (BioLegend, #423114) was used for dead cell staining, and BD Cytofix / Cytoperm Plus (BD bioscience, #554714) was used for intracellular cytokine staining, following the manufacturer's instructions. Flow cytometry was performed on an LSR fortessa instrument (BD Biosciences), and data were analyzed using Flow Jo v10.6 (Flow Jo, LLC).

[0191] MHC class I and II expression analysis

[0192] 5x10 5 NIT-1 cells were plated in 500 μL complete DMEM medium per well of a 24-well plate.

[0193] Cells were treated with or without 1.25 μM thapsigargin for 24 h in a 5% CO2 and 37°C incubator and then harvested and stained with the following antibodies, all of which were purchased from BioLegend: APC anti-mouse H-2Kd (clone SF1-1.1, #116620), APC mouse IgG2a kappa isotype control (clone MOPC-173, #400219), and mouse I-Ag 7 Cross-reactive PE anti-mouse IA k (Aβ k) (clone 10-3.6, #109908), PE mouse IgG2a kappa isotype control (clone MOPC-173, #400213). Flow cytometry was performed as described above.

[0194] CD8 + T cell ELISPOT assay

[0195] 5 μg / mL capture antibody (BD NA / LETM purified anti-mouse IFN-γ, BD Biosciences, #51-2525KA) was coated on a 96-well ELISPOT plate (Millipore Sigma, #MAIPS4510) at 4°C overnight. The next day, the plate was blocked with 200 μL complete RPMI medium for 2 hours at room temperature. NIT-1 cells were treated with 100 U / mL IFN-γ for 72 hours before use in the experiment, washed and incubated with 10 5 Cells / 100 μL were suspended in complete DMEM medium. Mouse CD8a + CD8 was isolated and purified from a female diabetic NOD mouse using the Isolation Kit (Miltenyi, #130-104-075). + T cells. 10 5 CD8 + T cells were resuspended in 100 μL complete RPMI medium. NIT-1 cells and CD8 + T cells were mixed in a 96-well plate coated with antibodies at a ratio of 1:1 and co-cultured in a 37°C incubator with 5% CO2 for 24 hours. The cells were discarded and the plates were washed three times with PBS-0.1% Tween20 wash buffer. 2g / mL detection antibody (biotinylated anti-mouse IFN-γ, BD Biosciences, #51-1818KA) was added to each well and incubated for 2 hours at room temperature. The plate was washed three times with wash buffer and HRP-coupled streptavidin (BD Biosciences, #557630) was added to each well for 1 hour. After washing four times with wash buffer and three times with PBS, substrate solution (R&D, #DY999) was added to each well and incubated for 15-30 minutes. The reaction was stopped by adding deionized water to each well, and the plate was further washed with deionized water. The spots were counted and analyzed using an Immunospot S6Universal-V instrument (Cellular Technology Limited).

[0196] RNLS structural analysis and drug binding modeling

[0197] hRNLS uses flavin adenine dinucleotide (FAD) as a cofactor for catalysis. Therefore, to identify compounds that could potentially inhibit hRNLS, the Protein Data Bank was searched for protein-inhibitor complex structures with FAD. The search identified complexes of inhibitors covalently linked to FAD with MAO-B. Structural alignment and analysis of the hRNLS crystal structure with these FAD-based complex structures suggested that these inhibitors, such as pargyline, might also inhibit hRNLS. A model of the full-length hRNLS in complex with pargyline was constructed based on the crystal structures of human renalase (PDB:3QJ4)(36) and the MAO-B rasagiline complex (PDB:2C65)(37). The model was first optimized at pH 7.0 using the Schrodinger Protein Preparation Wizard (38) and energy minimized with decreasing constraints on the backbone and solute heavy atoms (1000, 5.0 force constants). Afterwards, multiple stages of 100 ns molecular dynamics (MD) simulations were performed using Desmond (39). The last frame of the MD simulation was used as Fig. 6A The final model in .

[0198] RNLS thermal transfer test

[0199] The human recombinant RNLS protein was produced by GenScript USA Inc. using the E. coli expression vector pET28a-MBP. The RNLS protein was obtained from the supernatant of the cell lysate and then purified by Ni Bio-rad column. 2 mM RNLS dissolved in PBS was mixed with 0, 0.1, 1, 10, 25, 50, and 100 mM pargyline (Sigma-Aldrich,

[0200] #P8013) were incubated at 4°C for 20 minutes, and then SYPRO Orange dye (Invitrogen, #S6650) was added to measure thermal denaturation. Thermal shift assays were performed using the QuantStudio 6Flex Real-Time PCR System (Applied Biosystems) with an initial temperature of 25°C for 2 minutes, followed by a temperature increase of 1°C / s to 95°C, and a final temperature hold of 95°C for 2 minutes. Results were collected in 0.25°C increments. The melting temperature (Tm) of RNLS in the presence and absence of pargyline was calculated by the first derivative of fluorescence emission as a function of temperature (-dF / dT).

[0201] Oral Pargyline Treatment Study

[0202] Nine-week-old female NOD mice were induced with diabetes by intraperitoneal injection of cyclophosphamide (200 μg / g body weight, Sigma-Aldrich, #C0768). Diabetic NOD mice (blood glucose >450 mg / dl) were confirmed 10-14 days later and randomly assigned to a control group (normal water) or a pargyline-treated group (5 μg / ml pargyline hydrochloride in drinking water, Sigma-Aldrich #P8013). Treatment began one week before β-cell transplantation. NIT-1β cells carrying a luciferase reporter gene were pretreated with 5 μM pargyline for 24 hours before transplantation. 7 NIT-1 cells were subcutaneously transplanted into each diabetic NOD mouse. Blood glucose was monitored every 1-2 days, and bioluminescence of the transplants was imaged every 2-3 days.

[0203] Glucose-stimulated insulin secretion and insulin ELISA

[0204] Primary islets were isolated from 8-week-old CD1(ICR) mice (Envigo) and immediately cultured in 24-well low-adhesion plates. Mice were transduced with lentivirus encoding non-targeting (NT) or Rnls gRNAs together with the Cas9 endonuclease driven by the rat insulin promoter. After 72 h, mice were washed twice with 1 mL of Krebs Ringer Bicarbonate HEPES (KRB) buffer containing 2.8 mM glucose and then incubated in 2.8 mM glucose KRB buffer at 37°C for 1 h. 0.8 mL of KRB was removed and saved for insulin measurements and then replaced with 0.8 mL of 20.2 mM glucose KRB buffer for a final glucose concentration of 16.8 mM and incubated for another 1 h at 37°C. KRB buffer was again sampled for insulin and then incubated with 30 mM KCl together with 16.8 mM glucose at 37°C for 1 h before the final insulin sampling. Genomic DNA was purified from islets and insulin levels were normalized to DNA content. Insulin levels were assessed by ultrasensitive mouse insulin ELISA kit (Crystal Chem, #90080).

[0205] Statistical analysis

[0206] Statistical analysis was performed by unpaired or paired tests using Prism software version 8.0.2. All data are presented as mean ±

[0207] Mean ± SEM. P < 0.05 was considered statistically significant. Adequate sample size was estimated without using power calculations. No samples were excluded from the analysis. Animal experiments were not randomized. Data analysis was not blinded. All data are representatives of two or more similar experiments.

[0208] References

[0209] 1. M.A. Atkinson, B.O. Roep, A. Posgai, D.C.S. Wheeler, M. Peakman, The challenge of modulating β-cell autoimmunity in type 1 diabetes. Lancet Diabetes Endocrinol. 7, 52 - 64 (2019).

[0210] 2. J. Odorico, J. Markmann, D. Melton, J. Greenstein, A. Hwa, C. Nostro, A. Rezania, J. Oberholzer, D. Pipeleers, L. Yang, C. Cowan, D. Huangfu, D. Egli, U. Ben - David, L. Vallier, S.T. Grey, Q. Tang, B. Roep, C. Ricordi, A. Naji, G. Orlando, D.G. Anderson, M. Poznansky, B. Ludwig, A. Tomei, D.L. Greiner, M. Graham, M. Carpenter, G. Migliaccio, K. D’Amour, B. Hering, L. Piemonti, T. Berney, M. Rickels, T. Kay, A. Adams, Report of the Key Opinion Leaders Meeting on Stem Cell - derived Beta Cells. Transplantation. 102, 1223 - 1229 (2018).

[0211] 3. X. Han, M. Wang, S. Duan, P.J. Franco, J.H.-R. Kenty, P. Hedrick, Y. Xia, A. Allen, L.M.R. Ferreira, J.L. Strominger, D.A. Melton, T.B. Meissner, C.A. Cowan, Generation of hypoimmunogenic human pluripotent stem cells. Proc. Natl. Acad. Sci. 116, 10441 - 10446 (2019).

[0212] 4.T.Deuse,X.Hu,A.Gravina,D.Wang,G.Tediashvili,C.De,W.O.Thayer,A.Wahl,J.V.Garcia,H.Reichenspurner,M.M.Davis,L.L.Lanier,S.Schrepfer,Hypoimmunogenicderivatives of induced pluripotent stem cells evade immune rejection in fullyimmunocompetent allogeneic recipients.Nat.Biotechnol.37,252-258(2019).

[0213] 5.K.Hamaguchi,H.R.Gaskins,E.H.Leiter,NIT-1,a pancreatic beta-cellline established from a transgenic NOD / Lt mouse.Diabetes.40,842-9(1991).

[0214] 6.J.A.Pearson,F.S.Wong,L.Wen,The importance of the Non Obese Diabetic(NOD)mouse model in autoimmune diabetes.J.Autoimmun.66,76-88(2016).

[0215] 7.N.E.Sanjana,O.Shalem,F.Zhang,Improved vectors and genome-widelibraries for CRISPR screening.Nat.Methods.11,783-784(2014).

[0216] 8.J.C.Barrett,D.G.Clayton,P.Concannon,B.Akolkar,J.D.Cooper,H.A.Erlich,C.Julier,G.Morahan,J.Nerup,C.Nierras,V.Plagnol,F.Pociot,H.Schuilenburg,D.J.Smyth,H.Stevens,J.A.Todd,N.M.Walker,S.S.Rich,Genome-wideassociation study and meta-analysis find that over 40 loci affect risk oftype 1 diabetes.Nat.Genet.41,703-7(2009).

[0217] 9.J.M.M.Howson,J.D.Cooper,D.J.Smyth,N.M.Walker,H.Stevens,J.-X.She,G.S.Eisenbarth,M.Rewers,J.A.Todd,B.Akolkar,P.Concannon,H.A.Erlich,C.Julier,G.Morahan,J.Nerup,C.Nierras,F.Pociot,S.S.Rich,Type 1 Diabetes GeneticsConsortium,Evidence of gene-gene interaction and age-at-diagnosis effects intype 1 diabetes.Diabetes.61,3012-7(2012).

[0218] 10.K.Haskins,M.Portas,B.Bergman,K.Lafferty,B.Bradley,Pancreaticislet-specific T-cell clones from nonobese diabeticmice.Proc.Natl.Acad.Sci.86,8000-8004(1989).

[0219] 11.J.D.Katz,B.Wang,K.Haskins,C.Benoist,D.Mathis,Following adiabetogenic T cell from genesis through pathogenesis.Cell.74,1089-100(1993).

[0220] 12.M.L.Marré,J.L.Profozich,J.T.Coneybeer,X.Geng,S.Bertera,M.J.Ford,M.Trucco,J.D.Piganelli,Inherent ER stress in pancreatic isletβcells causesself-recognition by autoreactive T cells in type 1 diabetes.J.Autoimmun.72,33-46(2016).

[0221] 13.A.L.Clark,F.Urano,Endoplasmic reticulum stress in beta cells andautoimmune diabetes.Curr.Opin.Immunol.43,60-66(2016).

[0222] 14.U.Ozcan,Q.Cao,E.Yilmaz,A.-H.Lee,N.N.Iwakoshi,E.Ozdelen,G.Tuncman,C. L.H.Glimcher,G.S.Hotamisligil,Endoplasmic Reticulum Stress LinksObesity,Insulin Action,and Type 2 Diabetes.Science.306,457-461(2004).

[0223] 15.T.Izumi,H.Yokota-Hashimoto,S.Zhao,J.Wang,P.A.Halban,T.Takeuchi,Dominant negative pathogenesis by mutant proinsulin in the Akita diabeticmouse.Diabetes.52,409-16(2003).

[0224] 16.M.J.L.Kracht,M.van Lummel,T.Nikolic,A.M.Joosten,S.Laban,A.R.vander Slik,P.A.van Veelen,F.Carlotti,E.J.P.de Koning,R.C.Hoeben,A.Zaldumbide,B.O.Roep,Autoimmunity against a defective ribosomal insulin gene product intype 1 diabetes.Nat.Med.23,501-507(2017).

[0225] 17.M.L.Marre,J.W.McGinty,I.-T.Chow,M.E.DeNicola,N.W.Beck,S.C.Kent,A.C.Powers,R.Bottino,D.M.Harlan,C.J.Greenbaum,W.W.Kwok,J.D.Piganelli,E.A.James,Modifying Enzymes Are Elicited by ER Stress,Generating EpitopesThat Are Selectively Recognized by CD4+T Cells in Patients With Type 1Diabetes.Diabetes.67,1356-1368(2018).

[0226] 18.J.Sidney,J.L.Vela,D.Friedrich,R.Kolla,M.von Herrath,J.D.Wesley,A.Sette,Low HLA binding of diabetes-associated CD8+T-cell epitopes isincreased by post translational modifications.BMC Immunol.19,12(2018).

[0227] 19.J.S.Cox,C.E.Shamu,P.Walter,Transcriptional induction of genesencoding endoplasmic reticulum resident proteins requires a transmembraneprotein kinase.Cell.73,1197-206(1993).

[0228] 20.H.P.Harding,Y.Zhang,D.Ron,Protein translation and folding arecoupled by an endoplasmic-reticulum-resident kinase.Nature.397,271-274(1999).

[0229] 21.H.Yoshida,K.Haze,H.Yanagi,T.Yura,K.Mori,Identification of the cis-Acting Endoplasmic Reticulum Stress Response Element Responsible forTranscriptional Induction of Mammalian Glucose-regulatedProteins.J.Biol.Chem.273,33741-33749(1998).

[0230] 22.S.Oyadomari,A.Koizumi,K.Takeda,T.Gotoh,S.Akira,E.Araki,M.Mori,Targeted disruption of the Chop gene delays endoplasmic reticulum stress-mediated diabetes.J.Clin.Invest.109,525-532(2002).

[0231] 23.AHMinn,C.Hafele,A.Shalev,Thioredoxin-Interacting Protein IsStimulated by Glucose through a Carbohydrate Response Element and Inducesβ-Cell Apoptosis.Endocrinology.146,2397-2405(2005).

[0232] 24. CMOslowski, T. Hara, B. O'Sullivan-Murphy, K. Kanekura, S. Lu, M. Hara, S. Ishigaki, LJZhu, E. Hayashi, STHui, D. Greiner, RJ Kaufman, R. Bortell, F. Urano, Thioredoxin-Interacting Protein Mediates ER Stress-InducedβCell Death through Initiation of the Inflammasome.Cell Metab.16,265–273(2012).

[0233] 25.TWKensler,N.Wakabayashi,S.Biswal,Cell survival responses toenvironmental stresses via the Keap1-Nrf2-ARE pathway.Annu.Rev.Pharmacol.Toxicol.47,89-116(2007).

[0234] 26.GRMoran,The catalytic function of renalase:A decade ofphantoms.Biochim.Biophys.Acta-Proteins Proteomics.1864,177-186(2016).

[0235] 27.BABeaupre,MRHoag,JRoman,FH G.R.Moran,MetabolicFunction for Human Renalase:Oxidation of Isomeric Forms ofβ-NAD(P)H that AreInhibitory to Primary Metabolism.Biochemistry.54,795-806(2015).

[0236] 28.M.Milani,F.Ciriello,S.Baroni,V.Pandini,G.Canevari,M.Bolognesi,A.Aliverti,FAD-Binding Site and NADP Reactivity in Human Renalase:A NewEnzyme Involved in Blood Pressure Regulation.J.Mol.Biol.411,463-473(2011).

[0237] 29.J.D.Taylor,A.A.Wykes,Y.C.Gladish,W.B.Martin,New Inhibitor ofMonoamine Oxidase.Nature.187,941-942(1960).

[0238] 30.Sanjana,N.E.,Shalem,O.&Zhang,F.Improved vectors and genome-widelibraries for CRISPR screening.Nat Methods 11,783-784,(2014).

[0239] 31.Joung,J.et al.Genome-scale CRISPR-Cas9 knockout andtranscriptional activation screening.Nat Protoc 12,828-863,(2017).

[0240] 32.Schuster,C.,Jonas,F.,Zhao,F.&Kissler,S.Peripherally inducedregulatory T cells contribute to the control of autoimmune diabetes in theNOD mouse model.Eur J Immunol 48,1211-1216,(2018).

[0241] 33.Shalem,O.et al.Genome-scale CRISPR-Cas9 knockout screening inhuman cells.Science 343,84-87,(2014).

[0242] 34.Cao,J.et al.An easy and efficient inducible CRISPR / Cas9 platformwith improved specificity for multiple gene targeting.Nucleic Acids Res 44,e149,(2016).

[0243] 35.Kuznetsova,A.et al.Trimeprazine increases IRS2 in human islets andpromotes pancreatic beta cell growth and function in mice.JCI Insight 1,pii:e80749(2016).

[0244] 36.M.Milani,F.Ciriello,S.Baroni,V.Pandini,G.Canevari,M.Bolognesi,A.Aliverti.FAD-binding site and NADP reactivity in human renalase:a newenzyme involved in blood pressure regulation.J.Mol.Biol.411,463-473(2011).

[0245] 37. C. Binda, F. Hubalek, M. Li, Y. Herzig, J. Sterling, DE Edmonson, A. Mattevi. Binding of rasagiline-related inhibitors to human monoamine oxidases: a kinetic and crystallographic analysis. J. Med. Chem. 48, 8148-8154 (2005).

[0246] 38. GM Sastry, M. Adzhigirey, T. Day, R. Annabhimoju, W. Sherman. Protein and ligand preparation: Parameters, protocols, and influence on virtual screening enrichments. J. Comput. Aided Mol. Des., 27, 221-234 (2013).

[0247] 39.KJBowers,DEChow,H.Xu,RODror,MPEastwood,BAGregersen,JLKelpeis,I.Kolossvary,MAMoraes,FDSacerdoti,JKSalmon,Y.Shan,DEShaw.Scalable Algorithms for Molecular Dynamics Simulations on CommodityClusters.Proceedings of the 2006ACM / IEEE Conference on Supercomputing(SC06),p43(2006).

[0248] Equivalent method

[0249] The above written description is considered sufficient to enable one skilled in the art to practice the embodiments of the present invention. The foregoing description and examples detail certain embodiments and describe the best mode contemplated by the inventor. However, it is to be understood that no matter how detailed the foregoing appears in text, the embodiments may be implemented in many ways and should be interpreted in accordance with the appended claims and any equivalents thereof.

[0250] As used herein, the term about refers to numerical values, including, for example, integers, fractions, and percentages, whether or not explicitly indicated. The term about generally refers to a numerical range (e.g., + / - 5-10% of the listed range) that one of ordinary skill in the art considers to be comparable to the listed numerical values ​​(e.g., having the same function or result). When terms such as at least and about precede a list of numerical values ​​or ranges, these terms modify all numerical values ​​or ranges provided in the list. In some cases, the term about may include numerical values ​​rounded to the nearest significant figure.

Claims

1. A method of lowering blood glucose, increasing insulin secretion in response to glucose, and preventing or slowing pancreatic β-cell or β-like cell death in a subject, comprising administering a monoamine oxidase inhibitor (MAOI), wherein the MAOI: a. binds to renalase; and / or b. binds flavin adenine dinucleotide (FAD); and / or c. Producing an agent that binds renalase or FAD.

2. The method according to claim 1, wherein the subject has autoimmune diabetes, optionally wherein the autoimmune diabetes is induced by immunotherapy.

3. The method of claim 1 or claim 2, wherein the subject has type 1 diabetes.

4. The method of claim 2, wherein the autoimmune diabetes is induced by immunotherapy, optionally wherein the immunotherapy is an immune checkpoint modulator.

5. The method of claim 4, wherein the immune checkpoint regulator is an inhibitor of PD-1, PD-L1 or CTLA-4, optionally wherein the inhibitor is an antibody.

6. The method of any of the preceding claims, wherein the MAOI is administered in combination with another treatment.

7. The method of claim 6, wherein the other treatment is insulin, optionally wherein the insulin is rapid-acting, intermediate-acting or long-acting insulin.

8. The method according to claim 6, wherein the other treatment is a glucagon-like peptide analog or agonist, a dipeptidyl peptidase-4 inhibitor, an amylin analog, a biguanide, a thiazolidinedione, a sulfonylurea, a meglitinide, an alpha-glucosidase inhibitor, or a sodium / glucose transporter 2 inhibitor.

9. The method of any one of the preceding claims, wherein the subject has a blood glucose level above 11.1 mmol / liter or 200 mg / dl.

10. The method according to claim 1, wherein the β or β-like cells are the subject's own.

11. The method according to claim 10, wherein the β-cells or β-like cells have been removed from a subject, manipulated ex vivo, and re-implanted into a subject.

12. The method according to claim 1, wherein the β-cell or β-like cell is non-autologous to the subject.

13. The method of claim 11 or 12, wherein the β cells or β-like cells are transplanted into a subject suffering from autoimmune diabetes.

14. The method of claim 13, wherein the β cells or β-like cells are transplanted into the pancreas, liver or fat pad via surgery, injection or infusion.

15. A method for preventing the occurrence of type 1 diabetes, comprising: a. Screening subjects for risk factors for type 1 diabetes; b. determining whether the subject has an increased risk of developing type 1 diabetes; and c. If the subject has an increased risk of type 1 diabetes, administering a monoamine oxidase inhibitor (MAOI), wherein the MAOI: i. bind renalase; and / or ii. binds flavin adenine dinucleotide (FAD); and / or iii. Producing an agent that binds renalase or FAD.

16. The method of claim 15, wherein screening the subject for risk factors comprises obtaining data for a genetic risk score based on known type 1 diabetes-associated gene variants, a family history of type 1 diabetes, the presence of one or more autoantibodies to beta cell antigens known to predict disease risk, and / or impaired glucose tolerance.

17. The method of any of the preceding claims, wherein the subject is a mammal.

18. The method of claim 17, wherein the mammal is a human.

19. The method of any of the preceding claims, wherein the monoamine oxidase inhibitor is a propargylamine, hydrazine, propylamine or oxazolidinone derivative.

20. The method of any one of the preceding claims, wherein the monoamine oxidase inhibitor is clorgyline, pargyline, rasagiline, sitagliptin, radotirig, ASS234, isocarboxazid, toloxatone, or tranylcypromine.

Images