NCgl1764 gene mutant and application thereof in preparation of L-lysine

Abstract

The invention discloses an NCgl1764 gene mutant and an application of the NCgl1764 gene mutant in preparation of L-lysine. The invention provides an NCgl1764 protein mutant. The NCgl1764 protein mutant comprises any one of the following proteins: a protein obtained by replacing the 64th site of NCgl1764 protein as shown in SEQ ID No.2 with other amino acids from F; or a protein which is derived from bacteria, has more than 95% of identity with the protein and is related to the production of L-amino acid by the bacteria; or a protein which is obtained by substituting and / or deleting and / or adding one or more amino acid residues of the protein and is related to production of L-amino acid by bacteria; or a fusion protein obtained by connecting a label to the N end and / or C end of the protein. The invention proves that the yield of L-lysine can be obviously increased by performing point mutation on the NCgl1764T191C in the coding region of the NCgl1764 gene in corynebacterium glutamicum. The invention has important significance on the yield of L-lysine.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS: This application claims priority to the Chinese patent application (application number 202410254359.5) filed on March 6, 2024, the entire contents of which are incorporated herein by reference. Technical Field

[0002] The present invention relates to the field of biotechnology, and specifically to NCgl1764 Gene mutant and its application in preparing L-lysine. Background Art

[0003] L-lysine is one of the important essential amino acids and has a mature fermentation production process. However, with the increasing production costs, its production capacity must be further improved, so more and more research is being conducted on the transformation of its production metabolic pathways. L-lysine is produced by fermentation of Escherichia coli and Corynebacterium. Generally, L-lysine is produced by genetically engineered strains that improve its production capacity. In recent years, in order to improve the production efficiency of L-lysine, various recombinant strains or mutants with excellent L-lysine production capacity have been developed using genetic recombination technology with Corynebacterium as the target. Evonik Operations Co., Ltd. Patent CN113166787 A uses a strain with complete or partial deletion of whiB4 The L-lysine secretion bacterial fermentation production of Corynebacterium glutamicum with the gene species has achieved good results; WO2023284419A1 reported that the mutation of serine 217 of aceE to any of alanine, aspartic acid, glutamic acid, leucine, and proline can increase the production of L-lysine in Corynebacterium glutamicum. CJ CheilJedang Co., Ltd. patent CN111247250 A will have enhanced α-glucosidase activity aglA Gene overexpression is used to produce L-amino acids to increase L-amino acid production. NCgl1764 The product encoded by the gene has not yet been studied and is a hypothetical protein. NCgl1764 Report on mutation of T to C at position 191 of the gene. Summary of the invention

[0004] The object of the present invention is to provide NCgl1764 Gene mutant and its application in preparing L-lysine.

[0005] In the first aspect, the present invention claims protection for a protein mutant (ie, NCgl1764 protein mutant).

[0006] The protein mutant claimed in the present invention comprises (or is) any of the following: (A1) Protein obtained by replacing the 64th amino acid residue of the original protein (i.e., NCgl1764 protein) from phenylalanine (F) to other amino acids; (A2) a protein derived from bacteria and having more than 95% identity with the protein defined in (A1) and related to the production of L-amino acids (such as L-lysine) by bacteria; (A3) a protein derived from (A1) or (A2) that is related to the production of L-amino acids (such as L-lysine) by bacteria, obtained by substituting and / or deleting and / or adding one or more amino acid residues to the protein defined in (A1) or (A2); (A4) A fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of any of the proteins defined in (A1) to (A3).

[0007] Among them, the amino acid sequence of the original protein (i.e., NCgl1764 protein) contains SEQ ID No.2.

[0008] The term "identity" as used herein refers to sequence similarity to a natural amino acid sequence. Identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0009] The 95% or greater identity may specifically be 96% or greater identity, or 97% or greater identity, or 98% or greater identity, or 99% or greater identity.

[0010] Furthermore, the protein mutant is a protein obtained by replacing the 64th amino acid residue of the original protein from phenylalanine (F) to serine (S), that is, the protein mutant is the protein shown in SEQ ID No.4.

[0011] In a second aspect, the present invention claims protection for a nucleic acid molecule encoding the protein mutant described in the first aspect above.

[0012] Furthermore, the nucleic acid molecule comprises (or is) any one of the following: (B1) DNA molecule shown in SEQ ID No. 3; (B2) a DNA molecule that hybridizes with the DNA molecule defined in (B1) under stringent conditions and encodes the protein mutant; (B3) A DNA molecule having more than 80% identity with any of the DNA sequences defined in (B1) to (B2) and encoding the protein mutant.

[0013] The term "identity" as used herein refers to sequence similarity to a natural nucleic acid sequence. Identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0014] The 80% or more identity may specifically be 81% or more, 82% or more, 83% or more, 84% or more, 85% or more, 86% or more, 87% or more, 88% or more, 89% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more identity.

[0015] The stringent conditions may be hybridization and membrane washing in a solution of 0.1×SSPE (or 0.1×SSC), 0.1% SDS at 65°C.

[0016] In a third aspect, the present invention claims an expression cassette, a recombinant vector or a recombinant microorganism containing the nucleic acid molecule described in the second aspect above.

[0017] Furthermore, the vector may be a plasmid, a cosmid, a phage or a viral vector.

[0018] Further, the expression cassette is composed of a promoter, the nucleic acid molecule whose expression is driven by the promoter, and a transcription termination sequence; the promoter is functionally connected to the nucleic acid molecule, and the nucleic acid molecule is connected to the transcription termination sequence. Further, the expression cassette may also include an enhancer.

[0019] Furthermore, the recombinant microorganism is a recombinant microorganism containing the expression cassette or the recombinant vector.

[0020] The microorganism may be yeast, bacteria, algae or fungi. Among them, the bacteria may be Corynebacterium glutamicum ( Corynebacterium glutamicum )、Brevibacterium lactofermentum、Brevibacterium flavum( brevibacterium flavum )、Corynebacterium pekinensis( Corynebacterium pekinense ), Brevibacterium ammoniaphagen, Corynebacterium scutellariae, or Pantoea ammoniaca ( Pantoea ). Further, the bacterium is Corynebacterium glutamicum. Further, the Corynebacterium glutamicum is Corynebacterium glutamicum ( Corynebacterium glutamicum ) ATCC13032 or Corynebacterium glutamicum ( Corynebacterium glutamicum )YP097158.

[0021] In the present invention, the recombinant microorganism is a recombinant bacterium.

[0022] Furthermore, the recombinant bacteria are recombinant bacteria.

[0023] Furthermore, the recombinant bacterium may be a gene in the genome of the recipient bacterium that has the highest identity with the gene encoding the original protein described in the first aspect above (e.g. NCgl1764 The original protein encoding gene (i.e. NCgl1764 The nucleotide sequence of the gene is shown in SEQ ID No. 1.

[0024] Specifically, the gene in the genome of the recipient bacterium that has the highest identity with the gene encoding the original protein described in the first aspect above (such as NCgl1764 The gene) can be replaced with the nucleic acid molecule described in the second aspect above by mutating position 191 of SEQ ID No. 1 in the genome of the recipient bacteria from T to C (other nucleotide sequences remain unchanged).

[0025] In a specific embodiment of the present invention, the gene in the genome of the recipient bacterium that has the highest identity with the gene encoding the original protein described in the first aspect above (e.g. NCgl1764 The gene) is replaced with the nucleic acid molecule described in the second aspect above by introducing the recombinant vector pK18-NCgl1764 into the recipient bacterium T191C The recombinant vector pK18-NCgl1764 T191C To transfer the pK18mobsacB vector Xba I and / BamH The small fragment between the I recognition sites was replaced with the DNA fragment shown in positions 37-1271 of SEQ ID No.5, and the other sequences of the pK18mobsacB vector were kept unchanged to obtain a recombinant vector. Recombinant vector pK18-NCgl1764 T191C A mutant gene having SEQ ID No. 3 (the reverse complementary sequence of positions 611-835 of SEQ ID No. 5 is SEQ ID No. 3) NCgl1764 T191C .

[0026] Furthermore, the recombinant bacterium may also be obtained by introducing the nucleic acid molecule described in the second aspect above or the expression cassette or recombinant vector described in the third aspect above into a recipient bacterium.

[0027] In a specific implementation case of the present invention, the recombinant bacterium is a recombinant Corynebacterium glutamicum.

[0028] In a fourth aspect, the present invention claims protection for any of the following applications: (C1) Use of the protein mutant described in the first aspect above, the nucleic acid molecule described in the second aspect above, or the expression cassette or recombinant vector or recombinant microorganism described in the third aspect above in the production of L-amino acids; (C2) Use of the protein mutant described in the first aspect above, the nucleic acid molecule described in the second aspect above, or the expression cassette or recombinant vector described in the third aspect above in increasing the production of L-amino acids in bacteria; (C3) Use of the protein mutant described in the first aspect above, the nucleic acid molecule described in the second aspect above, or the expression cassette or recombinant vector described in the third aspect above in constructing an engineered strain producing L-amino acid.

[0029] In a fifth aspect, the present invention claims protection for any of the following methods: Method I: A method for increasing bacterial L-amino acid production, comprising the following steps: increasing the expression and / or activity of the protein mutant described in the first aspect above in a recipient bacterium to achieve an increase in the bacterial L-amino acid production.

[0030] Method II: A method for constructing an L-amino acid producing engineered strain, comprising the following steps: increasing the expression and / or activity of the protein mutant described in the first aspect above in a recipient bacterium to obtain the L-amino acid producing engineered strain.

[0031] Furthermore, increasing the expression and / or activity of the protein mutant in the recipient bacteria can be achieved by any of the following methods: (D1) the gene in the genome of the recipient bacterium that has the highest identity with the gene encoding the original protein described in the first aspect above (the wild-type gene, such as NCgl1764 gene)) is replaced with the nucleic acid molecule described in the second aspect above (mutated gene NCgl1764 T191C ); (D2) Introducing the nucleic acid molecule described in the second aspect above or the expression cassette or recombinant vector described in the third aspect above into the recipient bacterium.

[0032] Furthermore, in (D1), the gene encoding the original protein (i.e. NCgl1764 The nucleotide sequence of the gene is shown in SEQ ID No.1.

[0033] Specifically, in (D1), the gene in the genome of the recipient bacterium that has the highest identity with the gene encoding the original protein described in the first aspect above (e.g. NCgl1764 gene ) can be replaced with the nucleic acid molecule described in the second aspect above by mutating position 191 of SEQ ID No.1 in the genome of the recipient bacteria from T to C (other nucleotide sequences remain unchanged).

[0034] In a specific embodiment of the present invention, the gene in the genome of the recipient bacterium that has the highest identity with the gene encoding the original protein described in the first aspect above (e.g. NCgl1764 The gene) is replaced with the nucleic acid molecule described in the second aspect above by introducing the recombinant vector pK18-NCgl1764 described above into the recipient bacterium. T191C achieved (homologous recombination).

[0035] Furthermore, in the method, the gene in the genome of the recipient bacterium that has the highest identity with the gene encoding the original protein described in the first aspect above (such as NCgl1764 After the gene) is replaced with the nucleic acid molecule described in the second aspect above, the method further comprises the step of fermenting the obtained recombinant bacteria. The L-amino acid (such as L-lysine) can be obtained from the fermentation product.

[0036] The fermentation culture can be carried out by a person skilled in the art using methods in the prior art, or by optimizing and improving the fermentation method through routine experiments. The fermentation culture can be carried out in a suitable culture medium under fermentation conditions known in the art. The culture medium may contain: a carbon source, a nitrogen source, trace elements and combinations thereof. During the culture, the pH of the culture can be adjusted (e.g., the pH is controlled to be 7.0). During the culture, the temperature of the culture can be 30 to 40° C. (e.g., 30° C.). During the culture, the rotation speed is controlled (e.g., the rotation speed is controlled to be 220 rpm). During the culture, the fermentation time can be controlled (e.g., the fermentation time is controlled to be 48 h).

[0037] In a specific embodiment of the present invention, the formula of the culture medium used in the fermentation culture is shown in Table 2, and the balance is water. When the fermentation culture is carried out, the fermentation control process is shown in Table 3. In the above aspects, the bacterium is a bacterium having the ability to produce L-amino acid (such as L-lysine).

[0038] "Bacteria capable of producing L-amino acids (such as L-lysine)" means that the bacteria have the following abilities: the ability to produce and accumulate L-amino acids (such as L-lysine) in the bacteria using external substances (such as culture medium), and further the ability to secrete L-amino acids (such as L-lysine) into the culture system. Thus, L-amino acids (such as L-lysine) can be collected when the bacteria are cultured in the culture medium.

[0039] The bacteria may be wild-type bacteria collected naturally or modified bacteria.

[0040] "Modified bacteria" refers to modified bacteria obtained by artificially mutating and / or inducing mutations in naturally collected wild-type bacteria.

[0041] Specifically, the bacterium may be Corynebacterium glutamicum. In a specific embodiment of the present invention, the Corynebacterium glutamicum is Corynebacterium glutamicum ( Corynebacterium glutamicum ) ATCC13032 or Corynebacterium glutamicum ( Corynebacterium glutamicum )YP097158.

[0042] Accordingly, the recombinant microorganism (recombinant bacteria) claimed in the third aspect above is specifically the recombinant bacteria NCgl1764 T191C or recombinant strain YPL-NCgl1764 T191C .

[0043] The recombinant bacterium NCgl1764 T191C and Corynebacterium glutamicum ( Corynebacterium glutamicum ) ATCC13032 is only different in that: the recombinant bacteria NCgl1764 T191C To introduce Corynebacterium glutamicum ( Corynebacterium glutamicum ) The NCgl1764 gene (SEQ ID No.1) in the ATCC13032 genome was replaced by the mutant gene NCgl1764 T191C A strain is obtained by mutating the 191st position of SEQ ID No. 1 from T to C and keeping other sequences unchanged.

[0044] The recombinant bacteria YPL-NCgl1764 T191C With the Corynebacterium glutamicum ( Corynebacterium glutamicum ) The difference between YP097158 and YP097158 is that the recombinant bacteria YPL-NCgl1764 T191C In order to Corynebacterium glutamicum )YP097158 genome NCgl1764 Gene (SEQ ID No.1) is replaced by the mutated gene NCgl1764 T191C A strain is obtained by mutating the 191st position of SEQ ID No. 1 from T to C and keeping other sequences unchanged.

[0045] In the above aspects, the L-amino acid is L-lysine.

[0046] The NCgl1764 protein mutant of the present invention can be used to produce a variety of products, including but not limited to lysine in the examples, and the products produced can also be glutamic acid, valine, glycine, alanine, leucine, isoleucine, methionine, proline, tryptophan, serine, tyrosine, cysteine, phenylalanine, asparagine, glutamine, threonine, aspartic acid, arginine, histidine, shikimic acid, protocatechuic acid, succinic acid, α-ketoglutaric acid, citric acid, ornithine, citrulline, etc. When various products are produced, the coding gene of the NCgl1764 protein mutant of the present invention is placed in the synthesis pathway of the target product, and the gene in the synthesis pathway is expressed to achieve the production of the target product.

[0047] Experiments have shown that in Corynebacterium glutamicum NCgl1764 Point mutation NCgl1764 in the gene coding region T191C (i.e., the NCgl1764 The wild-type sequence of the gene coding region is replaced by the mutant sequence shown in SEQ ID No. 3), which can significantly increase the yield of L-lysine (p<0.01). The present invention has important significance for the yield of L-lysine.

[0048] Depositing instructions Classification name: Corynebacterium glutamicum ( Corynebacterium glutamicum ); Reference biological material: YP097158; Depository: General Microbiology Center, China Microbiological Culture Collection Administration; Abbreviation of depository institution: CGMCC; Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing; Deposit date: August 16, 2016; The registration number of the Collection Center is: CGMCC No.12856. DETAILED DESCRIPTION

[0049] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0050] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0051] The Corynebacterium glutamicum ( Corynebacterium glutamicum )ATCC13032 is the ATCC number 13032 Corynebacterium glutamicum ( Corynebacterium glutamicum ). Hereinafter referred to as Corynebacterium glutamicum ATCC13032.

[0052] The Corynebacterium glutamicum ( Corynebacterium glutamicum )YP097158 was deposited in the General Microbiological Center of China Microorganism Culture Collection Administration on August 16, 2016, with the deposit number CGMCC No. 12856. Hereinafter referred to as Corynebacterium glutamicum YP097158.

[0053] Example 1: Construction of a NCgl1764 Genetically engineered strains 1. Build includes NCgl1764 T191C Recombinant vector for gene point mutation Based on the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, two pairs of amplification NCgl1764 The primers for the gene coding region were used to replace the wild-type gene in Corynebacterium glutamicum YP097158 (sequencing confirmed that the wild-type gene was retained on the chromosome of this strain). NCgl1588 gene coding region) and wild-type Corynebacterium glutamicum strain ATCC13032 NCgl1764 A point mutation was introduced into the gene coding region (SEQ ID No. 1), wherein the point mutation NCgl1764 The 191st thymine (T) in the nucleotide sequence of the gene (SEQ ID No.1) is mutated to cytosine (C), and the DNA molecule shown in SEQ ID No.3 is obtained (the mutated NCgl1764 Gene, named NCgl1764 T191C ).

[0054] The DNA molecule shown in SEQ ID No.1 encodes a protein with an amino acid sequence of SEQ ID No.2, and the protein is named protein NCgl1764. The DNA molecule shown in SEQ ID No.3 encodes a protein with an amino acid sequence of SEQ ID No.4, and the mutant protein is named NCgl1764. F64S , the 64th serine (S) in SEQ ID No.4 was mutated from phenylalanine (F).

[0055] The recombinant vector was constructed using NEBuilder assembly technology. The primers were designed as follows (synthesized by Shanghai Invitrogen). The bases in bold red are the mutation positions: P1: 5'-CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG agctcaccggttttctcatc-3'; P2: 5'-caacgctgtacctttCtttgctgatgggtgcaac-3'; P3: 5'-gttgcacccatcagcaaaGaaaggtacagcgttg-3'; P4: 5'- CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC agctatgaatgctgcgtagg-3'.

[0056] Note: The underlined parts of P1 and P4 are the sequences contained in the pK18mobsacB vector.

[0057] Construction method: Using Corynebacterium glutamicum ATCC13032 as template, KAPA HiFi HotStart DNA polymerase (Cat. No. KK2501, Kapa Biosystems) was used to perform PCR amplification with primer pairs P1 / P2 and P3 / P4 to obtain two mutated bases with sizes of 660 bp and 683 bp, respectively. NCgl1764 The DNA fragment of the gene coding region was named NCgl1764 Up by primer pair P1 / P2, and NCgl1764 Down by primer pair P3 / P4.

[0058] PCR amplification system: 5×HiFi with Mg 2+ Buffer 10μL, dNTP Mixture (10 mM) 1.5μL, upstream and downstream primers (10pM) 1.6μL each, KAPA HiFi HotStart (1U / μL) 0.5μL, add ddH2O to a total volume of 50μL.

[0059] PCR amplification program: pre-denaturation at 95°C for 5 min, (denaturation at 98°C for 20 s; annealing at 60°C for 15 s; extension at 72°C for 30 s; 30 cycles), over-extension at 72°C for 5 min.

[0060] The two DNA fragments (NCgl1764 Up and NCgl1764 Down) were separated by agarose gel electrophoresis and recovered by QIAquick gel recovery kit (Cat. No. 28706, QIAGEN GmbH). Xba I / BamHI) The purified pK18mobsacB plasmid (BioVector NTCC Type Culture Collection Center, the plasmid contains a kanamycin resistance marker) was connected with the NEBuilder HiFi DNA Assembly Cloning Kit (Cat. No. E2621S, New England Biolabs) at 50°C for 30 min. The single clone grown after the ligation product was transformed was identified by PCR using primers PNCgl1764-1 / PNCgl1764-4. The one that could amplify a fragment of 1309 bp (SEQ ID No. 5) was the positive recombinant vector pK18-NCgl1764 T191C The recombinant vector contains a kanamycin resistance marker. T191C The recombinant vector pK18-NCgl1764 containing the correct point mutation (T191C) was sent to a sequencing company for sequencing identification. T191C Save for later use.

[0061] This recombinant vector pK18-NCgl1764 T191C Contains a mutation site (T191C), which will lead to the NCgl1764 The 191st thymine (T) in the gene coding region mutated to cytosine (C), which ultimately caused the 64th proline (F) in the encoded protein to become serine (S).

[0062] Recombinant vector pK18-NCgl1764 T191C Description of the structure: pK18mobsacB vector Xba I and BamH The fragment (small fragment) between the I recognition sites was replaced with the DNA fragment shown in positions 37 to 1271 of SEQ ID No. 5, and the other sequences of the pK18mobsacB vector were kept unchanged to obtain the recombinant vector. Recombinant vector pK18-NCgl1764 T191C Containing the mutant gene shown in SEQ ID No.3 (the reverse complementary sequence of positions 611-835 of SEQ ID No.5 is SEQ ID No.3) NCgl1764 T191C .

[0063] 2. Construction of the gene NCgl1764 T191C Engineered strains The allelic replacement plasmid (pK18-NCgl1764 T191C ) were transformed into wild-type Corynebacterium glutamicum strains ATCC13032 and YP097158 by electroporation (sequencing confirmed that the chromosomes of these strains retained the wild-typeNCgl1764 Gene coding region), and cultured on a solid culture plate containing kanamycin (50 mg / L) for 40 hours. The single colonies produced by the culture were identified by the primers P1 / P4 (see step 1 for the specific sequence), and the strains that could amplify the 1309 bp size band were positive strains. The positive strains were streaked and cultured on a medium containing 15% sucrose (the medium was a medium obtained by increasing the sucrose concentration in the medium in Table 1 to 150 g / L), and the single colonies produced by the culture were cultured on a medium containing kanamycin and a medium without kanamycin, respectively. The strains that grew on a medium without kanamycin but did not grow on a medium containing kanamycin (i.e., positive strains that underwent homologous recombination with the genome) were further amplified by PCR using primers P1 / P4 (see step 1 for the specific sequence), and the multiple DNA fragments (1309 bp, SEQ ID No. 5) obtained were sequenced. By sequence alignment, the strains with a mutation in the base sequence (T191C) were positive strains with successful allelic substitution. The positive strain obtained from Corynebacterium glutamicum ATCC13032 was named as the recombinant strain NCgl1764. T191C The positive strain obtained from Corynebacterium glutamicum YP097158 was named as recombinant strain YPL-NCgl1764 T191C .

[0064] Recombinant bacteria NCgl1764 T191C and recombinant strain YPL-NCgl1764 T191C Gene containing the mutation shown in SEQ ID No.3 NCgl1764 T191C , and express the protein shown in SEQ ID No.4.

[0065] Recombinant bacteria NCgl1764 T191C The only difference from Corynebacterium glutamicum ATCC13032 is that the recombinant strain NCgl1764 T191C In order to transform the Corynebacterium glutamicum ATCC13032 NCgl1764 The gene (SEQ ID No.3) was replaced by NCgl1764 T191C The strain was obtained by amplifying the gene (SEQ ID No. 4) and keeping other sequences unchanged.

[0066] Recombinant bacteria YPL-NCgl1764 T191C The only difference from Corynebacterium glutamicum YP097158 is that the recombinant strain YPL-NCgl1764 T191C To transform the Corynebacterium glutamicum YP097158 NCgl1764 The gene (SEQ ID No.3) was replaced by NCgl1764 T191CThe strain was obtained by amplifying the gene (SEQ ID No. 4) and keeping other sequences unchanged.

[0067] Table 1. Composition of culture medium (solvent is water) and culture conditions

[0068] Example 2, NCgl1764 T191C L-Lysine shake flask fermentation of mutant strains The recombinant bacteria NCgl1764 constructed in Example 1 T191C and recombinant strain YPL-NCgl1764 T191C , and the original strains of Corynebacterium glutamicum YP097158 and ATCC13032 were fermented in 500 mL baffled shake flasks with the culture medium shown in Table 2 and the control conditions shown in Table 3. After the fermentation, the L-lysine production was detected by SBA-biosensor analyzer. Each strain was repeated three times, and the L-lysine production data were analyzed by one-way analysis of variance. The experimental results showed that P<0.05 (*) indicated a significant difference, and P<0.01 (**) indicated an extremely significant difference.

[0069] Table 2. Shake flask fermentation medium formula (solvent is water)

[0070] Table 3. Fermentation control conditions

[0071] The results are shown in Table 4. Corynebacterium glutamicum ) NCgl1764 After site-directed mutagenesis (T191C) was performed in the gene coding region to change its sequence, the result was helpful to increase the production of L-lysine.

[0072] Table 4. NCgl1764 T191C Results of shake flask fermentation experiment of L-lysine with mutant strains

[0073] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. A protein mutant, characterized in that: The protein mutant comprises any of the following: (A1) The protein obtained by replacing the 64th amino acid residue of the original protein from F to other amino acids; (A2) a protein derived from bacteria and having more than 95% identity with the protein defined in (A1) and related to the production of L-amino acids by bacteria; (A3) a protein derived from (A1) or (A2) related to the production of L-amino acids by bacteria, obtained by substituting and / or deleting and / or adding one or more amino acid residues to the protein defined in (A1) or (A2); (A4) A fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of any of the proteins defined in (A1) to (A3); The amino acid sequence of the original protein comprises SEQ ID No.

2.

2. The protein mutant according to claim 1, characterized in that: The protein mutant is a protein obtained by replacing the 64th amino acid residue of the original protein from F to S.

3. A nucleic acid molecule encoding the protein mutant according to claim 1 or 2.

4. The nucleic acid molecule according to claim 3, characterized in that: The nucleic acid molecule comprises any of the following: (B1) DNA molecule shown in SEQ ID No. 3; (B2) a DNA molecule that hybridizes with the DNA molecule defined in (B1) under stringent conditions and encodes the protein mutant; (B3) A DNA molecule having a sequence identity of more than 95% with any one of (B1) to (B2) and encoding the protein mutant.

5. An expression cassette, recombinant vector or recombinant microorganism containing the nucleic acid molecule according to claim 3 or 4.

6. The recombinant bacterium according to claim 5, characterized in that: The recombinant microorganism is a recombinant bacterium; Furthermore, the recombinant bacteria is recombinant Corynebacterium glutamicum.

7. Any of the following applications: (C1) Use of the protein mutant according to claim 1 or 2, the nucleic acid molecule according to claim 3 or 4, or the expression cassette or recombinant vector or recombinant microorganism according to claim 5 or 6 in the production of L-amino acids; (C2) Use of the protein mutant according to claim 1 or 2, the nucleic acid molecule according to claim 3 or 4, or the expression cassette or recombinant vector according to claim 5 or 6 for increasing the production of L-amino acids in bacteria; (C3) Use of the protein mutant according to claim 1 or 2, the nucleic acid molecule according to claim 3 or 4, or the expression cassette or recombinant vector according to claim 5 or 6 in constructing an engineered strain producing L-amino acids.

8. Either of the following methods: Method I: A method for increasing the production of L-amino acids in bacteria, comprising the following steps: increasing the expression and / or activity of the protein mutant of claim 1 in a recipient bacterium to achieve an increase in the production of L-amino acids in the bacteria; Method II: A method for constructing an L-amino acid producing engineered strain, comprising the following steps: increasing the expression and / or activity of the protein mutant of claim 1 in a recipient bacterium to obtain the L-amino acid producing engineered strain.

9. The method according to claim 8, characterized in that: Improving the expression and / or activity of the protein mutant in the recipient bacteria is achieved by any of the following methods: (D1) replacing the gene in the genome of the recipient bacterium that has the highest identity with the gene encoding the original protein in claim 1 with the nucleic acid molecule of claim 3 or 4; (D2) introducing the nucleic acid molecule of claim 3 or 4 or the expression cassette or recombinant vector of claim 5 into the recipient bacterium; Furthermore, in (D1), the nucleotide sequence of the gene encoding the original protein is shown in SEQ ID No.

1.

10. The recombinant bacterium, use or method according to any one of claims 6 to 9, characterized in that: The bacteria are Corynebacterium bacteria; Further, the bacteria is Corynebacterium glutamicum; and / or The L-amino acid is L-lysine.

Images