Saline-alkali tolerant endophytic bacillus subtilis and application thereof in improvement of saline-alkali soil

Abstract

The invention provides a salt-alkali-tolerant endophytic bacillus subtilis strain and application thereof in improvement of saline-alkali soil, and belongs to the technical field of biological bacteria. According to the invention, a salt and alkali tolerant endophytic bacillus strain NXO3 is obtained from stems and leaves of suaeda salsa, and is identified as bacillus subtilis (bacillus subtilis); the strain has the capabilities of dissolving phosphorus, fixing nitrogen and generating indoleacetic acid (IAA) and polyglutamic acid, and has a remarkable inhibition effect on a plurality of plant pathogenic bacteria such as fusarium neosporum, colletotrichum gloeosporioides, fusarium graminearum, fusarium oxysporum and cavity microsporum. The agricultural microbial agent containing 0.3 billion / g of NXO3 is prepared through formula optimization. The bacillus subtilis NXO3 has a remarkable saline-alkaline tolerance function, a plant growth promoting effect and a biocontrol effect on plant diseases, and the emergence rate and the yield of crops in saline-alkaline land can be increased.

Description

Technical Field

[0001] The invention belongs to the technical field of biological bacteria, and specifically relates to a salt-alkali tolerant endophytic Bacillus subtilis and application thereof in improving saline-alkali land. Background Art

[0002] Saline soil refers to a type of soil in which the concentration of soluble salt in the soil solution is too high, which hinders crop growth. In China, the widespread distribution of saline soil poses a severe challenge to local agricultural production and the ecological environment.

[0003] In recent years, with the deepening of microbiological research, people have found that microorganisms play an indispensable role in the improvement of saline-alkali land. Sun Mingzhen screened multifunctional microorganisms from saline-alkali soil in the Yellow River Delta, which can improve soil enzyme activity, promote the formation of large soil aggregates, further inhibit soil capillary salt return, and promote salt leaching. AbdelFattah et al. used arbuscular mycorrhizal fungi to improve the growth and tolerance of wheat in saline soil. Under saline conditions, inoculation of mycorrhizal fungi can increase the growth of wheat plants, alkaline phosphatase and soluble protein content, and the N, P, K, and Mg content in mycorrhizal plants increases while the Na content decreases, which helps to reduce salt damage to plant growth. Wheat plants show a high dependence on mycorrhizal fungi in saline soil. Barua et al. isolated nitrogen-fixing bacteria from coastal saline-alkali land and applied them to the field to observe their effects on rice production. They found that nitrogen-fixing bacteria combined with organic fertilizers can significantly increase crop nitrogen absorption, plant height, leaf number and rice yield. Yan Huijun et al. applied microbial fertilizers to vegetables grown in saline-alkali land. The results showed that the application of microbial fertilizers had a certain effect on saline-alkali soil microbial biomass, soil volume quality and soil salinity. Compared with no fertilizer, chemical fertilizer and substrate treatment, the total number of soil bacteria treated with microbial fertilizers increased significantly, the soil volume quality decreased, and the salt content of the cultivated layer soil decreased significantly. Song Yuzhen et al.'s experiment on the application of microbial fertilizers in afforestation of soda saline-alkali soil in the Songnen Plain showed that trees and shrubs treated with active microbial fertilizers were significantly better than control trees in terms of survival rate, preservation rate, biomass and other aspects, and the pH was reduced but not significantly.

[0004] Therefore, exploring strategies to promote plant growth and improve their salt tolerance is crucial for the improvement of saline soil. In this process, microbial agents play a vital role. They can improve the physical and chemical properties of the soil by decomposing salt and alkaline substances in the soil, thereby improving the fertility and air permeability of the soil. These effects can promote the increase of available nitrogen content in the soil, reduce soil conductivity, regulate the structure of soil microbial communities, and then affect the nitrogen cycle process mediated by microorganisms in the soil, ultimately promoting plant growth and improving its tolerance to saline soil. By making full use of the potential of microbial agents, the soil quality of saline soil can be effectively improved, the yield of crops can be increased, and the sustainable development of agriculture can be promoted. Summary of the invention

[0005] In order to solve the above technical problems, the present invention separates a salt-alkali tolerant strain NXO3 from the strictly surface-sterilized Salicornia salsa by a selective culture method, detects its salt-alkali tolerance, antibacterial and growth-promoting effects by indoor experiments, and further verifies its crop growth-promoting function in a saline-alkali environment by potted and field experiments, in order to provide a solution for the improvement of saline-alkali land. Specifically, the present invention provides a Bacillus subtilis NXO3 with significant salt-alkali tolerance, plant growth promotion and biocontrol effects on plant diseases, which can improve the emergence rate and yield of crops in saline-alkali land.

[0006] The first object of the present invention is to provide a salt-alkali tolerant Bacillus subtilis NXO3, whose deposit number is CGMCC No.32127.

[0007] The second object of the present invention is to provide a primer set for identifying the above-mentioned Bacillus subtilis NXO3, and the nucleotide sequences of the primer set are shown in SEQ ID No.1 to SEQ ID No.2.

[0008] 16SF (SEQ ID No. 1): AGAGTTTGATCCTGGCTCAG;

[0009] 16SR (SEQ ID No. 2): TACGGTTACCTTGTTACGACTT.

[0010] The third object of the present invention is to provide a method for culturing the above-mentioned Bacillus subtilis NXO3, comprising inoculating the Bacillus subtilis NXO3 into a seed liquid culture medium, and shaking and culturing for 12 hours to obtain a seed liquid;

[0011] Inoculate the seed liquid into the fermentation medium at a rate of 3% and shake culture for 72 hours to obtain a fermentation liquid;

[0012] The seed liquid culture medium includes the following components in concentrations: 18.0-22.0 g / L of glucose, 3.7-7.0 g / L of yeast extract powder, 7.8-12.6 g / L of monosodium L-glutamate, 1.4-2.8 g / L of K2HPO4, and 0.20-0.31 g / L of MgSO4;

[0013] The fermentation medium comprises the following components in concentrations: 20.0-40.0 g / L of glucose, 6.2-9.8 g / L of yeast extract powder, 21.8-39.9 g / L of monosodium L-glutamate, 1.2-3.0 g / L of K2HPO4 and 0.20-0.31 g / L of MgSO4.

[0014] Preferably, the shaking culture conditions for culturing the seed solution are 37°C and 200 rpm;

[0015] The shaking culture conditions during fermentation were 37°C and 180 rpm.

[0016] The fourth object of the present invention is to provide an agricultural microbial agent, comprising bacterial mud obtained by centrifuging the fermentation liquid obtained by the above-mentioned culture method and a carrier.

[0017] Preferably, the carrier comprises diatomaceous earth, mature material, humic acid, unripe mineral powder, biochar and bentonite.

[0018] Preferably, the mass ratio of the bacterial mud to diatomaceous earth is 1:100;

[0019] Among the components of the agricultural microbial agent, the mass percentage of mature material is 20-30%, the mass percentage of humic acid is 15-20%, the mass percentage of unripe mineral powder is 25-30%, the mass percentage of biochar is 5-10%, and the mass percentage of bentonite is 10-15%.

[0020] Preferably, the concentration of Bacillus subtilis NXO3 in the agricultural microbial agent is 300 million / g.

[0021] The fifth object of the present invention is to provide the use of the above-mentioned Bacillus subtilis NXO3 or the fermentation liquid obtained by the above-mentioned culturing method or the above-mentioned agricultural microbial agent in at least one of the following: (1) dissolving phosphate;

[0022] (2) Nitrogen fixation;

[0023] (3)Production of IAA;

[0024] (4) Promote seed germination;

[0025] (5) Increased crop yields;

[0026] (6) Salt and alkali resistance;

[0027] (7) Antibacterial.

[0028] Preferably, the antibacterial activity includes inhibiting Fusarium neosporum, Colletotrichum, Fusarium graminearum, Fusarium oxysporum and Microbisporus.

[0029] Beneficial effects: The present invention obtains a salt-alkali resistant endophytic Bacillus strain NXO3 from the stems and leaves of Suaeda salsa, which is identified as Bacillus subtilis, and has the ability to dissolve phosphorus, fix nitrogen, produce indoleacetic acid (IAA) and polyglutamic acid, and has a significant inhibitory effect on a variety of plant pathogens such as Fusarium oxysporum, anthracnose, Fusarium graminearum, Fusarium oxysporum and Microbisporus. Among them, the inhibition rate of anthracnose is as high as 69.52%. Under the alkaline stress condition of 0.24% sodium bicarbonate solution, the germination rate of wheat seeds treated with 20% NXO3 fermentation liquid for 72 hours reached 86.67%, and the germination index of cucumber seeds was 158.86%, which were significantly higher than the control group (the germination rate of wheat seeds was 66.67%, and the germination index of cucumber seeds was 117.19%). The agricultural microbial agent containing 300 million / g NXO3 was prepared by formula optimization. Potted experiments in 0.3% salt soil showed that the wheat germination rate treated with 300 million / g NXO3 agricultural microbial agent could reach 92%, significantly higher than the control group of agent carrier particles. In the mild coastal saline-alkali land test field in Changli County (salt content 0.1-0.3%, pH 7.15-7.31), when 50kg / mu of agricultural microbial agent (300 million / g NXO3) was applied, the peanut germination rate could reach 83.15% and the yield per mu was 158.76kg / mu, while the control group was 75.53% and 139.36kg / mu respectively. The germination rate and yield of the treated group were significantly higher than those of the control group. In the experimental field of mild to moderate saline-alkali land in Huanghua, Cangzhou (salt content 0.1-0.5%), when 80kg / mu of agricultural microbial agent (300 million / g NXO3) was applied, the peanut yield per mu was 385.71kg / mu, the peanut yield per mu of the blank control group (agent carrier particles) was 308.90kg / mu, and the peanut yield per mu of the conventional control group was 354.88kg / mu. The peanut yield per mu of the treatment group was significantly higher than that of the control group. The results confirmed that Bacillus subtilis NXO3 has significant salt-alkali tolerance, plant growth promotion and biocontrol effects on plant diseases, and can increase the emergence rate and yield of crops in saline-alkali land.

[0030] Biological deposit information

[0031] Bacillus subtilis NXO3 is deposited in the General Microbiology Center of China Culture Collection Administration, and the specific address is Institute of Microbiology, Chinese Academy of Sciences, No. 1 Beichen West Road, Chaoyang District, Beijing; the deposit date is September 30, 2024, and the deposit number is CGMCC No.32127. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 The morphology and function of NXO3, A: single colony of NXO3; B: Gram staining of NXO3; C: nitrogen fixation function of NXO3; D: IAA production ability of NXO3; E: phosphate solubilization function of NXO3;

[0033] Figure 2 The antagonistic effect of NXO3 strain on Fusarium neosporum;

[0034] Figure 3 The inhibitory effects of NXO3 on the pathogenic microorganisms in Table 2-1 are shown in order. In the figure, F: Anthracis sp.; K: Colletotrichumincanum.; G: F.graminearum; L: F.oxysporum; H: Didymella americana; M: Alternaria tenuissima; I: F.solani; N: Lasiodiplodia theobromae; J: F.equiseti;

[0035] Figure 4 Phylogenetic tree based on 16SrDNA for strain NXO3;

[0036] Figure 5 Heat map for ANI / AAI analysis of strain NXO3;

[0037] Figure 6 is the circular genome map of strain NXO3;

[0038] Figure 7 The effect of different concentrations of fermentation liquid on the germination rate of wheat. In the figure, ck: sodium bicarbonate solution fertilizer; treatment 1: 80% fermentation liquid fertilizer;

[0039] Figure 8 is the cucumber seed germination index;

[0040] Fig. 9 It is the germination rate of wheat potted under saline-alkali conditions. DETAILED DESCRIPTION

[0041] In the present invention, especially the materials and methods used in the examples, unless otherwise specified, are common materials and methods in the art:

[0042] Test materials: Salt-water alkali canopy from the Red Beach Wetland in Panjin City, Liaoning Province.

[0043] Test pathogens: Fusarium neocosmosporiellum, Anthracis sp., Colletotrichumincanum, F. graminearum, F. oxysporum, Didymella americana, Alternaria tenuissima, F. solani, Lasiodiplodia theobromae) and Fusarium equiseti were provided by the Microbiology Laboratory of Hebei University of Science and Technology, and all strains have been published in the literature (He Wanwan, Hu Pengju, Feng Lina, et al. Discovery of new symptoms of peanut fruit rot and analysis of its occurrence factors [J]. Journal of Peanut Science, 2023, 52(03): 28-34+55. DOI: 10.14001 / j.issn.1002-4093.2023.03.004.; Xu Limei, He Dan, Wang Gang, et al. Antagonistic bacteria of Fusarium graminearum Bacillus Isolation and identification of Fusarium oxysporum from tomato in Shandong Province[J]. Journal of Shandong Agricultural Sciences, 2019, 51(12): 78-81. DOI: 10.14083 / j.issn.1001-4942.2019.12.016. ; Lei Zaojuan, Wu Yaming, Liu Zihuan, et al. Isolation and identification of Alternaria tenuifolia from Huanghua winter jujube[J]. Journal of Plant Protection Journal of Chinese Academy of Sciences, 2020, 40(04):17-20.; Yang Dongya, Qi Ruixue, Li Zhaoxuan, et al. Screening, identification and growth-promoting effect of antagonistic Bacillus against Fusarium solani of cucumber[J]. Bulletin of Biotechnology, 2023, 39(02):211-220. DOI:10.13560 / j.cnki.biotech.bull.1985.2022-0522.; Zhao Xueyi, Chai Junfa, Zhang Xuanyi, et al. Identification of Fusarium equisetifolia and determination of its pathogenicity to peach aphid[J]. Chinese Journal of Biological Control, 2023, 39(01):69-76. DOI:10.16409 / j.cnki.2095-039x.2022.07.002.)

[0044] The test bacterial agent carrier particles were provided by Hebei Jingan Fertilizer Technology Co., Ltd.

[0045] PDA medium: 200.0 g peeled potatoes, 20.0 g glucose, 20.0 g agar, 1000.0 mL distilled water, natural pH;

[0046] Salt-alkali tolerant LB screening medium: yeast extract powder 5.0 g, peptone 10.0 g, NaCl 30.0 g, agar 20.0 g, distilled water 1000.0 mL, pH 9.0;

[0047] Potassium-dissolving bacteria isolation medium: Na2HPO4 2.0 g, FeCl3 5.0 mg, sucrose 5.0 g, MgSO4·7H2O 5.0 mg, feldspar powder 10.0 g, CaCO3 1.0 g, agar 2.0 g, distilled water 1000.0 mL, pH 7.3;

[0048] Inorganic phosphorus-dissolving bacterial isolation medium: (NH4)2SO40.50 g, MgSO40.30 g, glucose 10.0 g, NaCl0.30 g, FeSO40.018 g, Ca3(PO4)210.0 g, MnSO40.123 g, agar 20.0 g, distilled water 1000.0 mL, pH 7.2;

[0049] Seed culture medium: glucose 20.0 g / L, yeast extract powder 5.0 g / L, L-glutamic acid monosodium salt 10.0 g / L, K2HPO4 2.0 g / L, MgSO4 0.25 g / L;

[0050] Liquid fermentation medium: glucose 30.0 g / L, yeast extract powder 8.0 g / L, L-glutamic acid monosodium salt 30.0 g / L, K2HPO4 2 g / L, MgSO4 0.25 g / L.

[0051] The primers designed for 16S rDNA in the embodiment of the present invention are 16SF and 16SR, with an annealing temperature of 55° C., and were commissioned to be synthesized by Shanghai Biotech Co., Ltd.

[0052] 16SF (SEQ ID No. 1): AGAGTTTGATCCTGGCTCAG;

[0053] 16SR (SEQ ID No. 2): TACGGTTACCTTGTTACGACTT.

[0054] In order to further illustrate the present invention, a salt-alkali tolerant endophytic Bacillus subtilis provided by the present invention and its application in saline-alkali land improvement are described in detail below in conjunction with examples, but they should not be construed as limiting the scope of protection of the present invention.

[0055] Example 1

[0056] 1.1 Screening of endophytic strains of Suaeda salsa

[0057] The endophytic bacteria of Suaeda salsa were isolated according to the method of Pei Shulan et al. (Pei Shulan, Liu Dong, Liu Huiqin, et al. Screening, identification and antibacterial activity determination of wild endophytic bacteria of Jujube jujube[J]. Acta Phytophylacica Sinica, 2018, 45(04).). The isolated strains were purified by plate streak method, and 20% glycerol bacterial suspension was prepared and stored in a -20℃ refrigerator for later use.

[0058] 1.2 Preliminary verification of phosphorus dissolving and nitrogen fixing capabilities

[0059] The strain was activated by the plate streak method. A bacterial cake with a diameter of 0.75 cm was inverted on a nitrogen-free culture medium, an organic phosphorus-solubilizing bacteria isolation medium, and an inorganic phosphorus-solubilizing bacteria isolation medium, and cultured at 30°C to observe the growth status and the formation of transparent circles.

[0060] 1.3 Determination of colony characteristics and cell morphology

[0061] The purified strain was incubated at 37°C for 24 hours, and the edge characteristics, viscosity, shape and color of the colony were observed according to the manual of "Bacterial Identification". The bacterial size, spore production and other characteristics were observed microscopically by Gram staining.

[0062] like Figure 1 As shown, a salt-tolerant bacterium with the ability to dissolve phosphorus, fix nitrogen, produce IAA (indoleacetic acid) and produce polyglutamic acid was isolated from the stems and leaves of the strictly surface-sterilized salt-field alkali canopy, and was named NXO3. After culturing on the salt-alkali tolerant LB screening medium at 37°C for 24 hours, the colonies were round, with irregular edges, wavy, opaque, milky white, rough surface, irregular edges, Gram-positive, rod-shaped, spore-producing, and the size of the bacteria was 0.7-1.1×2.0-7.0μm.

[0063] 1.4 Determination of active metabolites

[0064] The Salkowski colorimetric method (Xing Danrun. Isolation and identification of biocontrol bacteria for peanut fruit rot and field control of bacterial fertilizers [D]. Hebei University of Science and Technology, 2023.) was used to determine whether the strain could secrete IAA. The ethanol precipitation method (Fang Junnan, Lei Juan, Xu Lishan, et al. Research progress in the production of γ-polyglutamic acid by microbial fermentation [J]. Journal of Applied and Environmental Biology, 2018) was used to determine the ability to produce polyglutamic acid: three times the volume of 95% ethanol was added to the fermentation supernatant, polyglutamic acid was placed in an oven at 40°C and dried to constant weight, and weighed on a high-precision electronic analytical balance, and the mass concentration of polyglutamic acid was calculated according to the formula C = m / V.

[0065] 1.5 Identification of antibacterial effect

[0066] Fusarium graminearum, Fusarium oxysporum, Fusarium equisetum, Fusarium graminearum, Fusarium solani, Colletotrichum incanum, Alternaria tenuissima, Diplodia theobromin, Microbispora and colletotrichumincanum were used as indicator bacteria, and the antibacterial effect of functional strains was identified by plate confrontation method. Each strain was repeated three times and cultured at 28℃ for 7 days. The inhibitory effect of biocontrol bacteria on pathogens was observed. When the control colony grew all over the culture dish, the diameter of the inhibition zone was measured by the cross method to calculate the inhibition rate.

[0067] Antibacterial rate (%) = (average diameter of colonies in the control group - average diameter of colonies in the test group) / average diameter of colonies in the control group × 100

[0068] From Table 1 and Figures 2-3 It can be seen that the average inhibition rate of strain NXO3 against colletotrichumincanum, Fusarium graminearum, Fusarium oxysporum, and Microbisporus is 60.00%-70.00%, among which the average inhibition rate against anthracnose is as high as 69.52%, and the average inhibition rate against Alternaria tenuissima, Fusarium solani, Diplosporium theobroma, and Fusarium equisetum is 50.00%-60.00%, indicating that it has a significant inhibitory effect on the tested pathogens and has a broad-spectrum antibacterial effect.

[0069] Table 1 Antibacterial activity of NXO3 against other pathogenic microorganisms

[0070]

[0071] 1.6 Physiological and biochemical identification

[0072] The physiological and biochemical functions of the functional strains were verified using HBI Bacillus biochemical identification strips (HBIG14, Qingdao High-Tech Industrial Park Haibo Biotechnology Co., Ltd.) according to the instructions.

[0073] The results of the HBI identification card are shown in Table 2. The VP and propionate of the functional strain were negative, while the rest were positive. It could not be identified as Bacillus subtilis, Bacillus amyloliquefaciens, or Bacillus velez, and further identification was required.

[0074] Table 2 Physiological and biochemical characteristics of strain NXO3

[0075]

[0076] Note: “+” represents positive, and “-” represents negative.

[0077] 1.7 Mass spectrometry

[0078] The functional strains were determined by mass spectrometry using the formic acid method (Xingtai Center for Disease Control and Prevention).

[0079] 1.8 Molecular biological identification of functional strains

[0080] The genomic DNA of the strain was extracted by boiling, and the 16SrDNA was amplified with universal primers 16SF and 16SR. The product was sent to Shanghai Bioengineering Technology Service Co., Ltd. for sequencing. The sequencing results were spliced ​​with DNAMAN 6.0 and then compared with BLASTn. The functional strain was sequenced at Shanghai Meiji Biomedical Technology Co., Ltd., and the functional strain was analyzed by ANI / AAI using cloud tools to determine its taxonomic status.

[0081] After splicing and vector removal analysis using software DNAMAN 7.0, BLAST comparison analysis was performed in NCBI. The results are as follows Figure 4 The strain NXO3 has a sequence similarity of 99.86% with Bacillus subtilis (NR_027552.1, NR_113265.1) and a sequence similarity of 99.86% with Bacillus velez (M7634546.1). However, it still cannot be identified as Bacillus subtilis or Bacillus velez, and further identification is required.

[0082] ANI / AAI analysis is mainly used to evaluate the relationship between species at the whole genome level. Generally, the ANI / AAI value between species is above 95%. Figure 5 It can be seen that the ANI / AAI values ​​of the functional strain NXO3 and the whole genome of Bacillus subtilis are both above 95%, and the ANI / AAI values ​​of the functional strain NXO3 and other bacterial genera are all below 90%, so the functional strain NXO3 is identified as Bacillus subtilis.

[0083] 1.9 Prediction and analysis of stress resistance, growth promotion and salt-alkali tolerance genes of strain NXO3

[0084] The total genome size of strain NXO3 was 4431,343 bp, with a GC content of 43.47%. A total of 4610 genes were predicted (e.g. Figure 6 ), including the tryptophan-dependent IAA biosynthesis pathway and the betaine biosynthesis pathway, encoded by the gene clusters trpABCDE and betaineBI, which are involved in the biosynthesis of tryptophan, IAA and betaine stress-resistant growth-promoting metabolites (Table 3). In addition, Na+ / H+ antiporters and K+-Cl+ co-transporters related to salt tolerance were also found, encoded by genes ktrB and nhaC.

[0085] Table 3 NXO3 related genes for improving plant growth and enhancing salt and alkali tolerance

[0086]

[0087]

[0088] 1.10 Preparation of Bacillus subtilis NXO3 agricultural microbial agent

[0089] Transfer the activated bacteria to the seed liquid culture medium, shake and culture at 37℃ and 200rpm for 12h, and use it as seed liquid for later use. Inoculate the seed liquid into the fermentation medium at a 3% inoculation rate, shake and culture at 37℃ and 180rpm for 72h. Collect the fermentation liquid and bacterial mud after centrifugation.

[0090] The bacterial sludge of the functional strain and diatomaceous earth are mixed in a ratio of 1:100, dried, and then adhered to the surface of the bacterial agent carrier particles (composted material (20% to 30%); humic acid (15% to 20%); unripe mineral powder (25% to 30%); biochar (5% to 10%); bentonite (10% to 15%)) at a concentration of 300 million / g to prepare an agricultural microbial agent with an effective live bacteria count of 300 million / g.

[0091] 1.11 Determination of seed germination of Bacillus subtilis NXO3 fermentation broth under saline-alkali conditions

[0092] Weigh 10.00 g of fresh sample (microbial agent carrier particles) and place it in a 250 mL conical flask. After converting the moisture content of the sample, add 3 g / L sodium bicarbonate solution at a solid-liquid ratio (mass / volume) of 1:10 to collect the extract. The treatment group mixed the extract and fermentation broth in a ratio of 4:1, and the control group mixed the extract and water in a ratio of 4:1.

[0093] Place 1 or 2 filter papers in a culture dish, place 10 full and uniformly sized wheat seeds, add 10 mL of the mixed liquid, and culture in a (25±2)℃ incubator in the dark for 24 / 48 / 72 h to measure the seed germination rate and seed root length.

[0094] Seed germination index, expressed in %, is calculated according to the formula

[0095] Note: A1—the percentage of germinated seeds in the total number of seeds cultured with the extract of the microbial agent carrier particles, in percentage; A2—the average root length of all seeds cultured with the extract of the microbial agent carrier particles, in millimeters; B1—the percentage of germinated seeds in the total number of seeds cultured with water, in percentage; B2—the average root length of all seeds cultured with water, in millimeters.

[0096] The results are as follows Figure 7 As shown, under the stress of 2.4 g / L sodium bicarbonate solution, the germination rates of wheat seeds in 20% fermentation liquid in three time periods were 60.00%, 83.33% and 86.67%, respectively, while those in the control treatment were 20%, 53.3% and 66.7%, respectively. The treatment groups were significantly higher than the control (p < 0.05).

[0097] The results are as follows Figure 8 As shown, under the stress of 2.4 g / L sodium bicarbonate solution, the germination index of cucumber seeds cultured in 20% fermentation liquid for 48 hours was 158.86%, while the germination index of control cucumber seeds was 117.19%, which was significantly higher in the treatment group than in the control group (p < 0.05).

[0098] 1.12 Potted verification of wheat germination rate under saline-alkali conditions

[0099] 25.4gNaCl, 30.8gNa2SO4, 18.25gNaHCO3 and 11.59gNa2CO3 were added to 1kg of ordinary loam and mixed to prepare 0.3% saline-alkali soil. Potted experiments were carried out in the cultivation room of Hebei Changshengguo Fertilizer Research Institute Co., Ltd. The treatment groups were mixed with saline-alkali soil at 80kg / mu, 120kg / mu and 160kg / mu of fertilizer respectively. 0.3% saline-alkali soil without agricultural microbial agents and agent carrier particles was used as the blank control. The amount of soil in each pot was about 1kg. After adjusting the soil moisture, wheat seeds were sown at 25 seeds / pot, cultured at room temperature for 14 days, and the emergence rate was counted. Each treatment was repeated 3 times.

[0100] The results are as follows Fig. 9 As shown, the wheat germination rates of the control group at fertilizer rates of 80kg / mu, 120kg / mu and 160kg / mu were 0%, 0% and 8% respectively, while the wheat germination rates of the treatment groups were 92%, 40% and 32% respectively, which were significantly higher than those of the control treatment.

[0101] 1.13 Effect of agricultural microbial agents on improving peanut cultivation in slightly saline-alkali land in Changli coastal area

[0102] The experimental site was Liangfeng Marine Ecological Technology Development Co., Ltd. in Qinhuangdao City, Hebei Province. The peanut variety was Jihua 572. The soil was slightly saline and alkaline with a salt content of 0.1-0.3% and a pH of 7.15-7.31. The randomized block method was used for the plot test, with each plot having an area of ​​16m 2 On May 17, the ground was planted without film covering. Peanut seeds were mixed with 10% clothianidin + 10% chlorpyrifos. The treatment group was splattered with 50 kg / mu of agricultural microbial agent containing 300 million / g Bacillus subtilis NXO3 and then rotary tilled. A control group was set up with 50 kg / mu of microbial agent carrier particles. Each treatment was repeated 3 times. Manual weeding was carried out without spraying 3 times. The soil moisture mainly depends on rainfall.

[0103] Agricultural microbial agents include: compost; humic acid; mature mineral powder; biochar; Bacillus subtilis (effective live bacteria count ≥ 300 million / g).

[0104] It can be seen from Table 4 that the peanut germination rate and yield of the peanuts treated with the agricultural microbial agent containing Bacillus subtilis NXO3 were 83.15% and 158.76 kg / mu, while those of the control treatment were 75.53% and 139.36 kg / mu, respectively. The peanut germination rate and yield of the treatment group were significantly higher than those of the control group (p < 0.05), and the yield increase rate was 13.92%, which indicates that the agricultural microbial agent containing Bacillus subtilisNXO3 has an improving effect on slightly saline-alkali soil.

[0105] Table 4 Peanut germination rate under different treatments

[0106]

[0107] 1.14 Effect of agricultural microbial agents on improving peanut cultivation in mild to moderate saline-alkali land in Huanghua, Cangzhou

[0108] The test site was Huanghua saline-alkali land in Cangzhou City, Hebei Province. The peanut variety was Jihua 572. The salt content was 0.1-0.5%, which was a mild to moderate saline-alkali land. The randomized block method was used for the plot test. Each plot had an area of ​​15m 2 On May 22, ridge-forming, film-covering and sowing were carried out. The treatment group was smeared with 80 kg / mu of agricultural microbial agent containing 300 million / g Bacillus subtilis NXO3 and then tilled, the conventional control group was smeared with 80 kg / mu of compound microbial fertilizer (500 million / g Bacillus subtilis) and then tilled, and the blank control group was smeared with 80 kg / mu of microbial agent carrier particles and then tilled. Each treatment was repeated 3 times, and the field management was conventional management.

[0109] Agricultural microbial agents include: compost; humic acid; mature mineral powder; biochar; Bacillus subtilis (effective live bacteria count ≥ 300 million / g).

[0110] As shown in Table 5, the peanut yield per mu of the blank control group was 305.90 kg / mu, the peanut yield per mu of the conventional control group was 354.88 kg / mu, and the peanut yield per mu treated with the agricultural microbial agent containing Bacillus subtilis NXO3 was 385.71 kg / mu. The yield increase rate was 26.09% compared with the blank control, and the yield increase rate was 8.69% compared with the conventional control. The treatment group was significantly higher than the control group (p < 0.05) (Table 4), which indicates that the agricultural microbial agent containing Bacillus subtilis NXO3 has an improving effect on light to moderate saline-alkali soil.

[0111] Table 5 Peanut yield under different treatments

[0112]

[0113]

[0114] The present invention isolates a salt-alkali tolerant endophytic Bacillus subtilis (Bacillus subtilis) having the functions of promoting crop growth and inhibiting plant pathogens from the stems and leaves of Suaeda salsa. The application of agricultural microbial agents containing Bacillus subtilis NXO3 on mild (salt content 0.1-0.3%) and mild to moderate (salt content 0.1-0.5%) soil can significantly improve the emergence rate and yield of peanuts, providing a solution for the improvement of saline-alkali land. In terms of the application of functional strains, the present invention first uses diatomaceous earth to adsorb the fermented bacteria of Bacillus subtilis NXO3 to prepare bacterial powder, and then prepares it into an agricultural microbial agent through an adhesion process with bacterial agent carrier particles with synergistic enhancement function. The main components of the bacterial agent carrier particles include decomposed materials, humic acid, mature mineral powder and biochar. These raw materials have certain functions in the improvement of saline-alkali land, and the NXO3 strain has a synergistic effect through formula optimization.

[0115] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A salt- and alkali-tolerant Bacillus subtilis NXO3, whose deposit number is CGMCC No.32127.

2. A primer set for identifying the Bacillus subtilis NXO3 according to claim 1, characterized in that: The nucleotide sequences of the primer sets are shown in SEQ ID No.1 to SEQ ID No.

2.

3. The method for culturing Bacillus subtilis NXO3 according to claim 1, characterized in that: The method comprises inoculating the Bacillus subtilis NXO3 into a seed liquid culture medium and performing shaking culture for 12 hours to obtain a seed liquid; Inoculate the seed liquid into the fermentation medium at a rate of 3% and shake culture for 72 hours to obtain a fermentation liquid; The seed liquid culture medium includes the following components in concentrations: 18.0-22.0 g / L of glucose, 3.7-7.0 g / L of yeast extract powder, 7.8-12.6 g / L of monosodium L-glutamate, 1.4-2.8 g / L of K2HPO4, and 0.20-0.31 g / L of MgSO4; The fermentation medium comprises the following components in concentrations: 20.0-40.0 g / L of glucose, 6.2-9.8 g / L of yeast extract powder, 21.8-39.9 g / L of monosodium L-glutamate, 1.2-3.0 g / L of K2HPO4 and 0.20-0.31 g / L of MgSO4.

4. The culture method according to claim 3, characterized in that: The shaking culture conditions for culturing the seed solution were 37°C and 200 rpm; The shaking culture conditions during fermentation were 37°C and 180 rpm.

5. An agricultural microbial agent, characterized in that: The method comprises bacterial mud and a carrier obtained by centrifuging the fermentation liquid obtained by the culture method according to claim 3 or 4.

6. The agricultural microbial agent according to claim 5, characterized in that: The carrier comprises diatomaceous earth, mature material, humic acid, unripe mineral powder, biochar and bentonite.

7. The agricultural microbial agent according to claim 6, characterized in that: The mass ratio of the bacterial mud to diatomaceous earth is 1:100; Among the components of the agricultural microbial agent, the mass percentage of mature material is 20-30%, the mass percentage of humic acid is 15-20%, the mass percentage of unripe mineral powder is 25-30%, the mass percentage of biochar is 5-10%, and the mass percentage of bentonite is 10-15%.

8. The agricultural microbial agent according to claim 7, characterized in that: The concentration of Bacillus subtilis NXO3 in the agricultural microbial agent is 300 million / g.

9. Use of the Bacillus subtilis NXO3 of claim 1 or the fermentation liquid obtained by the culture method of claim 3 or 4 or the agricultural microbial agent of any one of claims 5 to 8 in at least one of the following: (1) phosphate solubilization; (2) Nitrogen fixation; (3)Production of IAA; (4) Promote seed germination; (5) Increased crop yields; (6) Salt and alkali resistance; (7) Antibacterial.

10. The use according to claim 9, characterized in that: The antibacterial activity includes inhibiting Fusarium graminearum, Fusarium oxysporum, Fusarium oxysporum and Microbisporum.

Images