Recombinant human coronavirus NL63 genome, primer group, recombinant vector, recombinant strain, and preparation method and application of recombinant human coronavirus NL63

Abstract

The invention belongs to the technical field of recombinant viruses and biological medicines, and particularly relates to a recombinant human coronavirus NL63 genome, a primer group, a recombinant vector, a recombinant strain, a preparation method of the recombinant human coronavirus NL63 and application of the recombinant human coronavirus NL63. The ORF3 coding region of the genome of the human coronavirus NL63 is modified, the enhanced green fluorescent protein gene EGFP is inserted into the genome of the human coronavirus NL63 in a partial substitution mode, the obtained virus has good genetic stability, and the stability of the virus can be continuously kept for at least 10 generations. According to the invention, the HCoV-NL63Amserdex I strain infectious clone carrying the EGFP reporter gene is constructed on the basis of a YAC / BAC reverse genetic technology for the first time, and the recombinant virus is successfully rescued from the HCoV-NL63Amserdex I strain infectious clone.

Description

Technical Field

[0001] The present invention belongs to the technical field of recombinant viruses and biomedicine, and specifically relates to a recombinant human coronavirus NL63 genome, a primer set, a recombinant vector, a recombinant strain, a preparation method of the recombinant human coronavirus NL63 and applications thereof. Background Art

[0002] Human coronavirus NL63 (HCoV-NL63) belongs to the alpha genus of coronaviruses and is widely distributed worldwide. It is a new coronavirus associated with respiratory diseases in young children, the elderly, and patients with weakened immune systems. Infection with HCoV-NL63 usually causes mild respiratory illness similar to the common cold, manifested by cough, nosebleeds, shortness of breath, fever, and hypoxia, which can resolve on its own. HCoV-NL63 also often co-occurs with obstructive laryngitis (wheezing). It is estimated that HCoV-NL63 accounts for about 4.7% of common respiratory diseases. As a low pathogenic human coronavirus, HCoV-NL63 is characterized by having the same receptor hACE2 as the highly pathogenic SARS-CoV and SARS-CoV-2. This feature makes the HCoV-NL63 infection animal model potentially useful in screening drugs targeting ACE2. Once effective drugs are screened, these drugs may have broad applicability to highly pathogenic SARS-CoV and SARS-CoV-2. The rapid construction of recombinant viruses carrying reporter genes through reverse genetics technology will provide an important technical means for achieving high-throughput, visual, and safe operation research on coronaviruses.

[0003] The coronavirus genome is 30kDa in length, making it the largest RNA virus known to date. Due to the complexity of its genome, the assembly and modification of the full-length genome is time-consuming and laborious. Although a variety of methods for constructing infectious clones of human coronaviruses have been developed, including vaccinia virus vector method, in vitro ligation method, bacterial artificial chromosome method (BAC), yeast artificial chromosome method (YAC), circular polymerase extension reaction (CPER), and the latest reported infectious subgenomic amplicon (ISA) technology. However, due to the different toxicity and stability of different coronavirus infectious clones to the host, it is difficult to achieve complete technical replication, and there are still great challenges in constructing accurate full-length RNA transcripts in vitro.

[0004] Reporter genes are an important tool in the field of modern molecular biology research for analyzing the potential interactions between cis-elements and trans-acting factors in the flanking regions of structural genes. They are widely used in gene expression regulation, signal transduction, promoter analysis, receptor function identification, gene therapy, and drug screening. Green fluorescent protein is a protein with spontaneous fluorescence, with a maximum excitation wavelength of 395nm and a maximum emission wavelength of 509nm. Enhanced green fluorescent protein (EGFP) replaces the 64th amino acid of GFP from phenylalanine to leucine, and the fluorescence level is enhanced by 6 times, with a maximum excitation wavelength of 488nm and a maximum emission wavelength of 510nm. Whether from the perspective of sensitivity or convenience of detection, EGFP reporter genes are now widely used in many fields such as biological research, imaging, molecular biology, and biomedicine.

[0005] At present, studies on the construction of HCoV-NL63 infectious clones based on in vitro ligation technology platforms have been reported. For example, some studies constructed and successfully rescued HCoV-NL63 infectious clones carrying GFP reporter genes in 2008. The study used in vitro ligation technology, reverse transcribed HCoV-NL63 full-length RNA under the action of T7 promoter, and electro-transfected LLC-MK2 cells to rescue recombinant HCoV-NL63. However, although this construction method can rescue recombinant viruses, it has low genetic stability, cumbersome and time-consuming steps, and the in vitro transcription RNA step has high requirements on experimental personnel and environment. Summary of the invention

[0006] The purpose of the present invention is to provide a recombinant human coronavirus NL63 genome, a primer set, a recombinant vector, a recombinant strain, a preparation method of recombinant human coronavirus NL63 and its application. By cloning and rescuing the recombinant human coronavirus NL63 genome, a recombinant coronavirus NL63 that efficiently expresses enhanced green fluorescent protein is obtained, and has high genetic stability, which can be used for antiviral drug screening and vaccine preparation research.

[0007] The present invention provides a recombinant human coronavirus NL63 genome, which comprises a human coronavirus NL63 genome, an enhanced green fluorescent protein gene EGFP inserted into the human coronavirus NL63 genome, a CMV promoter inserted into the front end of the 5'UTR of the human coronavirus NL63 genome, and an HDV ribozyme and a BGH termination signal inserted into the tail of the 3'UTR of the human coronavirus NL63 genome;

[0008] The enhanced green fluorescent protein gene EGFP replaces the nucleotide sequence encoding the 1st to 154th amino acids in the ORF3 region of the human coronavirus NL63 genome.

[0009] Preferably, the nucleotide sequence of the replaced ORF3 region is as shown in SEQ ID NO:44.

[0010] The present invention also provides a primer set for cloning the recombinant human coronavirus NL63 genome described in the above technical solution, wherein the primer set includes a primer pair F1, a primer pair F2, a primer pair F3, a primer pair F4, a primer pair F5, a primer pair F6, a primer pair F7, a primer pair F8, a primer pair F9, a primer pair F10, a primer pair F11 and a primer pair EGFP; the nucleotide sequences of the upstream primer F1-F and the downstream primer F1-R of the primer pair F1 are shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively; the nucleotide sequences of the upstream primer F2-F and the downstream primer F2-R of the primer pair F2 are shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively; the nucleotide sequences of the upstream primer F3-F and the downstream primer F3-R of the primer pair F3 are shown in SEQ ID NO: 5 and SEQ ID NO: 6, respectively. ID NO:6; the nucleotide sequences of the upstream primer F4-F and the downstream primer F4-R of the primer pair F4 are shown in SEQ ID NO:7 and SEQ ID NO:8, respectively; the nucleotide sequences of the upstream primer F5-F and the downstream primer F5-R of the primer pair F5 are shown in SEQ ID NO:9 and SEQ ID NO:10, respectively; the nucleotide sequences of the upstream primer F6-F and the downstream primer F6-R of the primer pair F6 are shown in SEQ ID NO:11 and SEQ ID NO:12, respectively; the nucleotide sequences of the upstream primer F7-F and the downstream primer F7-R of the primer pair F7 are shown in SEQ ID NO:13 and SEQ ID NO:14, respectively; the nucleotide sequences of the upstream primer F8-F and the downstream primer F8-R of the primer pair F8 are shown in SEQ ID NO:15 and SEQ ID NO:16, respectively; the nucleotide sequences of the upstream primer F9-F and the downstream primer F9-R of the primer pair F9 are shown in SEQ ID NO:17 and SEQ ID NO:18, respectively. NO:17 and SEQ ID NO:18; the nucleotide sequences of the upstream primer F10-F and the downstream primer F10-R of the primer pair F10 are shown in SEQ ID NO:19 and SEQ ID NO:20, respectively; the nucleotide sequences of the upstream primer F11-F and the downstream primer F11-R of the primer pair F11 are shown in SEQ ID NO:21 and SEQ ID NO:22, respectively; the nucleotide sequences of the upstream primer EGFP-F and the downstream primer EGFP-R of the primer pair EGFP are shown in SEQ ID NO:23 and SEQ ID NO:24, respectively.

[0011] The present invention also provides a kit for cloning the recombinant human coronavirus NL63 genome described in the above technical solution, wherein the kit comprises the primer set and PCR amplification reagent described in the above technical solution.

[0012] The present invention also provides a recombinant vector, which includes a basic vector and a recombinant human coronavirus NL63 genome inserted into the basic vector; the recombinant human coronavirus NL63 genome is the recombinant human coronavirus NL63 genome described in the above technical solution or the recombinant human coronavirus NL63 genome cloned using the primer set described in the above technical solution or the recombinant human coronavirus NL63 genome cloned using the kit described in the above technical solution.

[0013] Preferably, the basic vector comprises the YAC / BAC shuttle plasmid pYES1L.

[0014] The present invention also provides a recombinant strain, which includes a basic strain and a recombinant vector introduced into the basic strain, and the recombinant vector is the recombinant vector described in the above technical solution.

[0015] The present invention also provides the use of the recombinant human coronavirus NL63 genome described in the above technical solution, the primer set described in the above technical solution, the kit described in the above technical solution, the recombinant vector described in the above technical solution, or the recombinant strain described in the above technical solution in preparing a recombinant human coronavirus NL63 that efficiently expresses enhanced green fluorescent protein.

[0016] The present invention also provides a method for preparing a recombinant human coronavirus NL63 that efficiently expresses enhanced green fluorescent protein based on the primer set described in the above technical solution, comprising the following steps:

[0017] The pBAC-OC43-ns2DelRLUC plasmid was PCR amplified with primer pair F1 and primer pair F11, respectively, to obtain two fragments containing the transcription element;

[0018] The cDNA of human coronavirus NL63 was amplified by PCR using primer pair F2, primer pair F3, primer pair F4, primer pair F5, primer pair F6, primer pair F7, primer pair F8, primer pair F9 and primer pair F10, respectively, to obtain 9 gene fragments of the full-length gene of human coronavirus NL63;

[0019] The plasmid carrying the enhanced green fluorescent protein gene is amplified by PCR using the primer pair EGFP to obtain the enhanced green fluorescent protein gene EGFP;

[0020] The linearized basic vector is mixed with the two segments containing the transcription element, the nine gene segments of the full-length gene of the human coronavirus NL63, and the enhanced green fluorescent protein gene EGFP, and then transformed into yeast competent cells for recombinant expression to obtain a recombinant vector;

[0021] The recombinant vector is subjected to virus rescue to obtain the recombinant coronavirus NL63 that efficiently expresses enhanced green fluorescent protein.

[0022] The present invention also provides the use of the recombinant human coronavirus NL63 genome described in the above technical solution, the primer set described in the above technical solution, the kit described in the above technical solution, the recombinant vector described in the above technical solution, the recombinant strain described in the above technical solution, or the recombinant human coronavirus NL63 that efficiently expresses enhanced green fluorescent protein prepared by the preparation method described in the above technical solution in antiviral drug screening and / or vaccine preparation.

[0023] Beneficial effects:

[0024] The present invention provides a recombinant human coronavirus NL63 genome, the recombinant human coronavirus NL63 genome includes a human coronavirus NL63 genome, an enhanced green fluorescent protein gene EGFP inserted into the human coronavirus NL63 genome, a CMV promoter inserted into the front end of the 5'UTR of the human coronavirus NL63 genome, and an HDV ribozyme and a BGH termination signal inserted into the tail of the 3'UTR of the human coronavirus NL63 genome; the enhanced green fluorescent protein gene EGFP replaces the nucleotide sequence encoding the 1st to 154th amino acids in the ORF3 region of the human coronavirus NL63 genome. The present invention transforms the ORF3 coding region of the human coronavirus NL63 genome, and inserts the enhanced green fluorescent protein gene EGFP into the human coronavirus NL63 genome by partial replacement. The obtained virus has good genetic stability, and its stability can be maintained for at least 10 generations. The present invention is the first to construct an infectious clone of the HCoV-NL63 Amsterdam I strain carrying an EGFP reporter gene based on YAC / BAC reverse genetic technology, and successfully rescue the recombinant virus; and the operation is simple and easy to promote. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0026] Figure 1The rapid construction and verification results of the full-length infectious clone pYES1L-HCoV-NL63-EGFP of the HCoV-NL63 Amsterdam I strain carrying the EGFP reporter gene in Example 1; wherein A is the overall research design process of pYES1L-HCoV-NL63-EGFP, B is 12 PCR amplification fragments of the HCoV-NL63 infectious clone carrying EGFP, C is a nucleic acid gel electrophoresis image of the PCR product of the yeast monoclonal colony verified by colony PCR for positive clones, and D is a nucleic acid gel electrophoresis image of the PCR product of the Escherichia coli monoclonal colony culture amplification small extract verified by colony PCR for positive clones;

[0027] Figure 2 The rescue and verification results of the HCoV-NL63 Amsterdam I strain recombinant virus rHCoV-NL63-EGFP carrying the EGFP reporter gene in Example 2; wherein A is a flowchart of the rescue of the recombinant virus, B is the change in the number of nucleic acid copies in the cell supernatant after transfection of the HCoV-NL63 infectious clone carrying EGFP, C is the Western blotting method to detect the infectivity of rHCoV-NL63-EGFPP5 in LLC-MK2 cells, and D is the indirect immunofluorescence method to detect the infectivity of rHCoV-NL63-EGFP P5 in LLC-MK2 cells;

[0028] Figure 3 The in vitro biological characteristics of the recombinant virus rHCoV-NL63-EGFP in LLC-MK2 cells in Example 3; wherein A is a comparison of the plaque size morphology of the recombinant virus and NL63-WT on LLC-MK2 cells, B is the expression of EGFP from the first day to the seventh day after the recombinant virus infected LLC-MK2 cells, C is the CPE of the recombinant virus from the first day to the seventh day after the infection of LLC-MK2 cells, D is the rHCoV-NL63-EGFP re-replication kinetics analyzed by the expression of EGFP, and E is the half tissue infection dose method (TCID 50 )'s recombinant virus rHCoV-NL63-EGFP and the parent virus HCoV-NL63Amsterdam I replication kinetics;

[0029] Figure 4The results of the genetic stability study of the recombinant virus rHCoV-NL63-EGFP in Example 3; wherein A is the EGFP expression of the P1, P3, P5, P7 and P9 generations of the recombinant virus rHCoV-NL63-EGFP in LLC-MK2 cells, B is the EGFP expression analysis results of the P1, P3, P5, P7 and P9 generations of the recombinant virus rHCoV-NL63-EGFP, and C is the TCID of the P1, P3, P5, P7 and P9 generations of the recombinant virus rHCoV-NL63-EGFP in LLC-MK2 cells. 50 Titration analysis results, D is the expression of EGFP and NP proteins of the P1, P3, P5, P7 and P9 generations of the recombinant virus rHCoV-NL63-EGFP after infecting LLC-MK2 cells, E is the gray value analysis of the expression of EGFP protein of the recombinant virus rHCoV-NL63-EGFP after infecting LLC-MK2 cells;

[0030] Figure 5 The in vivo biological characteristics of the recombinant virus rHCoV-NL63-EGFP in Example 4; wherein A is the weight change of BALB / c young mice challenged with rHCoV-NL63-EGFP recombinant virus drops, B is the viral load of mouse lung tissue after rHCoV-NL63-EGFP recombinant virus intranasal drops, and C is the pathological diagnosis of mouse lung tissue after rHCoV-NL63-EGFP recombinant virus intranasal drops;

[0031] Figure 6 The present invention is an application of the recombinant virus rHCoV-NL63-EGFP in the pharmacodynamic evaluation of remdesivir (RDV) in Example 5; wherein A is a fluorescence expression diagram of EGFP of the recombinant virus under the action of different concentrations of remdesivir, B is the EGFP activity result of remdesivir against the recombinant virus rHCoV-NL63-EGFP quantitatively determined by the EGFP reporter gene, and C is the EGFP activity result of remdesivir against rHCoV-NL63-EGFP EC quantitatively determined by the EGFP reporter gene. 50 result. DETAILED DESCRIPTION

[0032] The invention provides a recombinant human coronavirus NL63 genome, which comprises a human coronavirus NL63 genome, an enhanced green fluorescent protein gene EGFP inserted into the human coronavirus NL63 genome, a CMV promoter inserted into the front end of a 5'UTR of the human coronavirus NL63 genome, and an HDV ribozyme and a BGH termination signal inserted into the tail of a 3'UTR of the human coronavirus NL63 genome; the enhanced green fluorescent protein gene EGFP replaces a nucleotide sequence encoding amino acids 1 to 154 in an ORF3 region of the human coronavirus NL63 genome.

[0033] In the present invention, as an embodiment, the nucleotide sequence of the CMV promoter of the present invention is a nucleotide sequence obtained by amplifying pBAC-OC43-ns2DelRLUC with primer pair F1; the nucleotide sequences of the upstream primer and the downstream primer of the primer pair F1 are shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively; the pBAC-OC43-ns2DelRLUC is disclosed in the following document [Shen L, Yang Y, Ye F, Liu G, Desforges M, Talbot PJ, Tan W. Safe and Sensitive Antiviral Screening Platform Based on Recombinant Human CoronavirusOC43 Expressing the Luciferase Reporter Gene. Antimicrob Agents Chemother. 2016Aug 22;60(9):5492-503.doi:10.1128 / AAC.00814-16.PMID:27381385; PMCID:PMC4997878.].

[0034] As an embodiment, the nucleotide sequence of the HDV ribozyme and BGH termination signal of the present invention is the nucleotide sequence obtained by amplifying pBAC-OC43-ns2DelRLUC with primer pair F11; the nucleotide sequences of the upstream primer and the downstream primer of the primer pair F11 are shown in SEQ ID NO:21 and SEQ ID NO:22, respectively.

[0035] As an implementation manner, the nucleotide sequence of the replaced ORF3 region is shown in SEQ ID NO:44, specifically: 5'-ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAAGGTGACCACTATGTCGTTTTAGGTGGTGAAACTATTACTTTTGTTTCTTTTGATGACCTTTATGTTGCTATTAGAGGTTCTTGTGAAAAGAACCTACAACTTATGCGTAAGGTTGACTTGTATAATGGTGCTGTCATTTACATTTTTGCCGAAGAGCCTGTTGTTGGTATAGTCTACTCTTCTCAACTATACGAAGATGTTCCTTCGATTAATTGA-3'.

[0036] The present invention also provides a primer set for cloning the recombinant human coronavirus NL63 genome described in the above technical solution, wherein the primer set includes a primer pair F1, a primer pair F2, a primer pair F3, a primer pair F4, a primer pair F5, a primer pair F6, a primer pair F7, a primer pair F8, a primer pair F9, a primer pair F10, a primer pair F11 and a primer pair EGFP; the nucleotide sequences of the upstream primer F1-F and the downstream primer F1-R of the primer pair F1 are shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively; the nucleotide sequences of the upstream primer F2-F and the downstream primer F2-R of the primer pair F2 are shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively; the nucleotide sequences of the upstream primer F3-F and the downstream primer F3-R of the primer pair F3 are shown in SEQ ID NO: 5 and SEQ ID NO: 6, respectively. ID NO:6; the nucleotide sequences of the upstream primer F4-F and the downstream primer F4-R of the primer pair F4 are shown in SEQ ID NO:7 and SEQ ID NO:8, respectively; the nucleotide sequences of the upstream primer F5-F and the downstream primer F5-R of the primer pair F5 are shown in SEQ ID NO:9 and SEQ ID NO:10, respectively; the nucleotide sequences of the upstream primer F6-F and the downstream primer F6-R of the primer pair F6 are shown in SEQ ID NO:11 and SEQ ID NO:12, respectively; the nucleotide sequences of the upstream primer F7-F and the downstream primer F7-R of the primer pair F7 are shown in SEQ ID NO:13 and SEQ ID NO:14, respectively; the nucleotide sequences of the upstream primer F8-F and the downstream primer F8-R of the primer pair F8 are shown in SEQ ID NO:15 and SEQ ID NO:16, respectively; the nucleotide sequences of the upstream primer F9-F and the downstream primer F9-R of the primer pair F9 are shown in SEQ ID NO:17 and SEQ ID NO:18, respectively. NO:17 and SEQ ID NO:18; the nucleotide sequences of the upstream primer F10-F and the downstream primer F10-R of the primer pair F10 are shown in SEQ ID NO:19 and SEQ ID NO:20, respectively; the nucleotide sequences of the upstream primer F11-F and the downstream primer F11-R of the primer pair F11 are shown in SEQ ID NO:21 and SEQ ID NO:22, respectively; the nucleotide sequences of the upstream primer EGFP-F and the downstream primer EGFP-R of the primer pair EGFP are shown in SEQ ID NO:23 and SEQ ID NO:24, respectively.

[0037] The present invention also provides a kit for cloning the recombinant human coronavirus NL63 genome described in the above technical solution, and the kit includes the primer set and PCR amplification reagent described in the above technical solution. The present invention does not specifically limit the source and specifications of the PCR amplification reagent, and a PCR amplification reagent of conventional sources and specifications in the art can be used. As an embodiment, the kit of the present invention also includes bacterial artificial chromosome method (BAC) related reagents and / or yeast artificial chromosome method (YAC) related reagents, that is, the present invention uses BAC, YAC or BAC and YAC to clone the genome of the recombinant coronavirus NL63. The present invention does not specifically limit the composition of the artificial chromosome method related reagents and yeast artificial chromosome method related reagents, and conventional artificial chromosome method related reagents and yeast artificial chromosome method related reagents in the art can be used.

[0038] The present invention also provides a recombinant vector, comprising a basic vector and a recombinant human coronavirus NL63 genome inserted into the basic vector; the recombinant human coronavirus NL63 genome is the recombinant human coronavirus NL63 genome described in the above technical solution or the recombinant human coronavirus NL63 genome cloned using the primer set described in the above technical solution or the recombinant human coronavirus NL63 genome cloned using the kit described in the above technical solution. As an embodiment, the basic vector of the present invention can be a plasmid vector; as another embodiment, the basic vector of the present invention can be a YAC / BAC shuttle plasmid pYES1L.

[0039] The present invention also provides a recombinant strain, the recombinant strain comprising a basic strain and a recombinant vector introduced into the basic strain, the recombinant vector being the recombinant vector described in the above technical solution. As an embodiment, the basic strain of the present invention may be a yeast; as another embodiment, the yeast of the present invention may be a competent MaV203 yeast.

[0040] The present invention also provides the use of the recombinant human coronavirus NL63 genome described in the above technical solution, the primer set described in the above technical solution, the kit described in the above technical solution, the recombinant vector described in the above technical solution, or the recombinant strain described in the above technical solution in preparing a recombinant human coronavirus NL63 that efficiently expresses enhanced green fluorescent protein.

[0041] The present invention also provides a method for preparing a recombinant human coronavirus NL63 that efficiently expresses enhanced green fluorescent protein based on the primer set described in the above technical solution, comprising the following steps:

[0042] The pBAC-OC43-ns2DelRLUC plasmid was PCR amplified with primer pair F1 and primer pair F11, respectively, to obtain two fragments containing the transcription element;

[0043] The cDNA of human coronavirus NL63 was amplified by PCR using primer pair F2, primer pair F3, primer pair F4, primer pair F5, primer pair F6, primer pair F7, primer pair F8, primer pair F9 and primer pair F10, respectively, to obtain 9 gene fragments of the full-length gene of human coronavirus NL63;

[0044] The plasmid carrying the enhanced green fluorescent protein gene is amplified by PCR using the primer pair EGFP to obtain the enhanced green fluorescent protein gene EGFP;

[0045] The linearized basic vector is mixed with the two segments containing the transcription element, the nine gene segments of the full-length gene of the human coronavirus NL63, and the enhanced green fluorescent protein gene EGFP, and then transformed into yeast competent cells for recombinant expression to obtain a recombinant vector;

[0046] The recombinant vector is subjected to virus rescue to obtain the recombinant coronavirus NL63 that efficiently expresses enhanced green fluorescent protein.

[0047] In the present invention, as an embodiment, the plasmid carrying the enhanced green fluorescent protein gene of the present invention can be a pT7-6×His-EGFP-Mcr-1 plasmid.

[0048] As an embodiment, the PCR amplification system of the present invention includes the following components: 2× PrimeSTAR Buffer 50 μL, upstream primer and downstream primer 4 μL each, template cDNA 100 ng and ddH2O 40 μL. The PCR amplification program of the present invention is: 98°C 2 min; 98°C 10 s, 55°C 15 s, 72°C 15 s, 35 cycles; 72°C 30 s.

[0049] As an embodiment, the linearized plasmid vector of the present invention is a linearized YAC / BAC shuttle plasmid pYES1L. As an embodiment, the yeast competent cell of the present invention is a MaV203 yeast competent cell. As an embodiment, the present invention adopts a lithium acetate transformation method to transform the yeast competent cell, and the specific process is not particularly limited, and the conventional lithium acetate transformation process in the art can be used.

[0050] As an embodiment, after the transformation, the present invention further comprises inoculating the transformed yeast competent cells into a tryptophan-deficient solid culture medium to screen positive clone plasmids, thereby obtaining the recombinant plasmid.

[0051] As an embodiment, the present invention transfects the recombinant vector into a co-cultured cell line of LLC-MK2 cells and 293T-ACE2 cells for culture. When obvious green fluorescence is observed, the virus supernatant is collected to obtain the recombinant coronavirus NL63 that efficiently expresses enhanced green fluorescent protein. The present invention does not specifically limit the specific process of the transfection, and the conventional cell transfection steps in the art can be used.

[0052] The preparation method of the present invention can not only successfully rescue the recombinant coronavirus NL63 that efficiently expresses enhanced green fluorescent protein, but also the obtained recombinant coronavirus has good genetic stability for at least 10 consecutive generations.

[0053] Based on the above advantages, the present invention also provides the use of the recombinant human coronavirus NL63 genome described in the above technical solution, the primer set described in the above technical solution, the kit described in the above technical solution, the recombinant vector described in the above technical solution, the recombinant strain described in the above technical solution, or the recombinant human coronavirus NL63 prepared by the preparation method described in the above technical solution with high efficiency in expressing enhanced green fluorescent protein in antiviral drug screening and / or vaccine preparation. As an embodiment, the antiviral drug of the present invention can be an anti-coronavirus drug; as another embodiment, the anti-coronavirus drug can be an anti-human coronavirus drug; as another embodiment, the anti-coronavirus drug can be an anti-human coronavirus NL63 drug. As an embodiment, the vaccine can be a vaccine for preventing coronavirus; as another embodiment, the vaccine can be a vaccine for preventing human coronavirus; as another embodiment, the vaccine can be a vaccine for preventing human coronavirus NL63.

[0054] The present invention provides a convenient and economical technical support means for realizing visualization and high throughput of anti-coronavirus drug and vaccine research.

[0055] In order to further illustrate the present invention, the technical solution provided by the present invention is described in detail below in conjunction with the accompanying drawings and embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0056] Example 1

[0057] The steps for rapid construction of an infectious clone of HCoV-NL63 Amsterdam I strain carrying the EGFP reporter gene are as follows:

[0058] 1.1 Obtaining the fragment of the full-length infectious clone carrying the EGFP gene

[0059] For the specific construction flow chart, see Figure 1A. In this example, the YAC / BAC shuttle plasmid pYES1L was used as a vector to genetically modify the HCoV-NL63Amsterdam I full genome sequence (NCBI Reference Sequence: NC_005831.2). The CMV early promoter was added to the front end of the 5'UTR of the genome sequence (amplified with primer F1, and the upstream primer and downstream primer sequences of primer F1 are shown in Table 1), and the HDV ribozyme and BGH termination signal were designed and added to the 3'UTR tail (the HDV ribozyme and BGH termination signal were amplified with primer F11, and the upstream primer and downstream primer sequences of primer F11 are shown in Table 1), the nucleotides encoding the 1st to 154th amino acids in the ORF3 region were deleted, and EGFP was inserted in the region (the nucleotide sequence of the ORF3 region after deleting the 1st to 154th amino acids in the ORF3 region and inserting EGFP in the region is shown in SEQ ID NO: 44). To ensure effective connection between gene fragments, 40 bp to 100 bp of homologous sequences were retained between adjacent fragments.

[0060] Based on this design, specific primers were designed (Table 1) to divide the full-length genome sequence into 12 fragments, including F1 to F11 and EGFP, for amplification.

[0061] Viral RNA Mini kit (Qiagen, Cat. No. 52904) was used to extract HCoV-NL63 Amsterdam I RNA (HCoV-NL63 Amsterdam I was kindly provided by Professor Lia Van der Hoek of the University of Amsterdam, the Netherlands, and preserved by our laboratory. References Zhu N, Wang W, Liu Z, Liang C, Wang W, Ye F, Huang B, Zhao L, Wang H, Zhou W, Deng Y, Mao L, Su C, Qiang G, Jiang T, Zhao J, Wu G, Song J, Tan W. Morphogenesis and cytopathic effect of SARS-CoV-2 infection in human airway epithelial cells. Nat Commun. 2020 Aug 6; 11(1):3910.doi:10.1038 / s41467-020-17796-z.PMID:32764693;PMCID:PMC7413383.). The full-length cDNA of HCoV-NL63 Amsterdam I was prepared by reverse transcription using the Invitrogen Superscript IV reverse transcription system. The reaction system was: 4 μL of 5×SSIV Buffer and 16 μL of template RNA. The reaction procedure was: 25°C for 10 min, 50°C for 10 min, and 85°C for 5 min. After cooling, it was placed in a -20°C refrigerator for later use.

[0062] When amplifying the F1 and F11 fragments, pBAC-OC43-ns2DelRLUC was used as a template (constructed and preserved by the inventor team and disclosed in the following literature: Shen L, Yang Y, Ye F, Liu G, Desforges M, Talbot PJ, Tan W. Safe and Sensitive Antiviral Screening Platform Based on Recombinant Human Coronavirus OC43 Expressing the Luciferase Reporter Gene. Antimicrob Agents Chemother. 2016 Aug 22; 60(9): 5492-503. doi: 10.1128 / AAC.00814-16. PMID: 27381385; PMCID: PMC4997878.), and two pairs of primers F1-F / F1-R and F11-F / F11-R were used for amplification respectively; when amplifying the F2 to F10 fragments, HCoV-NL63 Amsterdam I cDNA was used as template, and 9 pairs of primers F2-F / F2-R, F3-F / F3-R, F4-F / F4-R, F5-F / F5-R, F6-F / F6-R, F7-F / F7-R, F8-F / F8-R and F9-F / F9-R were used for amplification; the reaction system was: 2× PrimeSTAR Buffer 50μL, 4μL of upstream and downstream primers, 100ng of template and 40μL of ddH2O. The reaction procedure was: 98℃2min; 98℃10s, 55℃15s, 72℃15s, 35 cycles; 72℃30s. The fragments obtained by PCR were purified and the concentration was determined using the Qubit kit.

[0063] When amplifying the EGFP fragment, the pT7-6×His-EGFP-Mcr-1 (purchased from Wuhan Miaoling Biotechnology Co., Ltd.) plasmid was used as a template and primers EGFP-F / EGFP-R were used for amplification. The system and procedure of the PCR amplification are the same as those of the above technical solution and will not be repeated here. The 12 subgenomes obtained by amplification are as follows: Figure 1 As shown in B.

[0064] Table 1 Primers for construction of HCoV-NL63 Amsterdam I infectious clone

[0065]

[0066]

[0067] 1.2 Recombination of full-length cDNA fragments in yeast system

[0068] MaV203 yeast competent cells were used as hosts, and the β-glucan in the cell wall was destroyed by lithium oxyacetate treatment, making the cell wall fragile, thereby allowing exogenous DNA to effectively penetrate the cell wall and enter the cytoplasm. In the yeast cells, the homologous sequences of the exogenous DNA were recombined and assembled into a full-length plasmid.

[0069] Add a mixture containing 100 ng of each of the linearized vector pYES1L, F1-F11, and EGFP DNA fragments to MaV203 yeast competent cells, and flick the tube wall to mix. Then, add PEG / LiAc solution and gently invert and mix 6-8 times, and incubate at 30°C for 30 minutes; add 36 μL DMSO and gently invert and mix 5-8 times, and incubate at 42°C for 20 minutes; after the heat shock treatment, centrifuge at 1800 rpm for 5 minutes, and carefully discard the supernatant. Then, add 1 mL of YPDA medium and shake at 30°C for 1 hour; resuspend by centrifugation and apply to SD / Trp solid medium, and culture at 30°C.

[0070] 1.3 Identification and amplification of yeast positive clones

[0071] Primers were designed for the fragment junction (Table 2), single colony lysed yeast was picked, and colony PCR verification was performed using the primers designed in Table 2 to screen out positive clones. The PCR product at the junction was as follows: Figure 1 As shown in C; the positive colonies were further amplified and the plasmids were extracted using a yeast plasmid extraction kit and quantified using a Qubit kit.

[0072] Due to the low copy number of yeast, in order to increase the concentration of plasmid, the YAC plasmid was transformed into E. coli for amplification. In this study, a Bio-Red electroporator was used with the parameters set to 1.2 kV, 200 Ω and 25 μF. The recombinant plasmid was introduced into the Stbl4 E. coli electroporation competent cells and evenly coated on the LB plate containing spectinomycin (concentration 0.05 mg / mL) resistance. After incubation at 30 ° C, the colony PCR technology was used for verification. The PCR product at the junction was as follows Figure 1 As shown in D. The positive clones screened were amplified on a large scale and then used to extract the plasmid, which was quantitatively analyzed using the Qubit kit. The obtained plasmid was named pYES1L-HCoV-NL63-EGFP.

[0073] Table 2 Colony PCR primer list

[0074]

[0075]

[0076] Example 2

[0077] Rescue of HCoV-NL63 Amsterdam I recombinant virus carrying EGFP

[0078] 2.1 Transfection of recombinant virus

[0079] In this study, LLC-MK2 and 293T-ACE2 cells were co-cultured to rescue the HCoV-NL63 Amsterdam I recombinant virus carrying EGFP ( Figure 2 (A).

[0080] First, add 1.5 mL of 2 × 10 5 10 cells / mL LLC-MK2 cell suspension and 0.5 mL 2×10 5 / mL of 293T-ACE2 cell suspension. Subsequently, the cells were cultured overnight in a 37°C constant temperature incubator with 5% CO2. When the cell confluency reached about 75%, Lipofectamine 3000 reagent was used for plasmid transfection. After that, 100 μL of supernatant was aspirated every day to monitor the dynamic changes in the number of viral nucleic acid copies. 72 hours after transfection, it was replaced with fresh DMEM maintenance solution containing 2% FBS, and the cells were transferred to a 33°C constant temperature incubator with 5% CO2 and continued to be cultured for 72 hours. The virus solution obtained after freezing and thawing the cells and supernatant was defined as the P0 generation and named rHCoV-NL63-EGFP.

[0081] 2.2 Passaging and amplification of recombinant viruses

[0082] When LLC-MK2 cells grow to a confluence of 90%, the virus solution is diluted to a multiplicity of infection (MOI) of 0.1, inoculated into the cells, and cultured in a 33°C constant temperature incubator containing 5% CO2. When about 90% of the cells are observed to have obvious pathological changes, the cell supernatant is harvested. Centrifuge at 4°C, 3000rpm for 10 minutes, harvest the supernatant and store it in a -80°C refrigerator for later use.

[0083] 2.3 Titration of recombinant virus

[0084] In this example, LLC-MK2 cells were used to measure the virus titer in a 96-well plate. 3×10 4 100 μL / well of cells were cultured in an incubator at 5% CO2 and 37°C until the cell density reached 80% to 90% confluence. Serum-free DMEM was used as the diluent, and the virus stock solution was diluted to 1×10 2 ~1×10 6Multiple wells were set at each concentration, and 100 μL of virus dilution was added to each well. At the same time, a control group was set up, and 100 μL of serum-free DMEM was added to each group. After virus inoculation, the cytopathic effect was observed and recorded daily. On the 8th day after inoculation, the number of wells with cytopathic effect at each concentration was counted, and the TCID of the virus was calculated using the Reed-Muench formula. 50 value.

[0085] 2.4 Recombinant virus nucleic acid extraction and RT-qPCR detection

[0086] Viral RNA Mini kit (Qiagen, Cat. No. 52904) was used to extract viral RNA according to the instructions. The N gene was used as the detection target, and the primer and probe sequences were shown in Table 3. TM RT-qPCR was performed according to the instructions of One-Step RT-qPCR Reagents kit. The nucleic acid copy number was calculated by the standard curve CT = 39.432-3.489lg (copies / μL). The RT-qPCR results showed that the viral nucleic acid copy number in the supernatant of the P0 generation could be increased from 10 on the first day to 10 on the first day. 3.72 RNA copies / μL increased to 10 on day 8 6.36 RNA copies / μL indicates that the virus has replicated ( Figure 2 (middle B).

[0087] Table 3 Primer probes for HCoV-NL63 N gene

[0088]

[0089] 2.5 Western Blot (WB) analysis to verify viral protein expression

[0090] Western blot analysis: P0 virus was inoculated into LLC-MK2 cells at 0.1 MOI. After 144 hours of infection, the infected cell pellets were collected, subjected to SDS-PAGE gel electrophoresis, and electrotransferred to nitrocellulose membranes. Subsequently, the NC membrane was blocked with 5% skim milk-PBS buffer at room temperature for 2 hours. The membrane was incubated with a 1:1000 dilution of the primary antibody (HCoV-NL63 N protein polyclonal antibody, purchased from Sino Biological, 40641-T46-100) at 4°C overnight. After incubation, the membrane was washed 3 times with PBST (phosphate buffer containing Tween-20) for 10 minutes each time. Then, the secondary antibody (Goat anti-RabbitIgG (H+L) Secondary Antibody HRP, purchased from Thermo Fisher, 31460) was diluted 1:1000 and incubated at room temperature in the dark for 1 hour. After incubation, the membrane was washed again with PBST in the dark for 3 times for 10 minutes each time. Amersham TM ImageQuant TM The 800 instrument scans and images the membrane to detect the expression level of the target protein. The expression of green fluorescent protein was observed after LLC-MK2 cells were infected with the recombinant virus carrying the EGFP reporter gene ( Figure 2 Middle C), indicating that the recombinant virus was successfully rescued, and the virus was named rHCoV-NL63-EGFP (rNL63-EGFP).

[0091] 2.6 Verification of viral protein expression by indirect immunofluorescence assay (IFA)

[0092] LLC-MK2 cells were infected with wild type (NL63-WT, i.e. HCoV-NL63Amsterdam I, the same abbreviations below have the same meanings here) or recombinant virus (rNL63-EGFP) at a ratio of MOI = 0.1, and washed once with pre-cooled phosphate buffer (PBS) after 72h. 100 μL of 4% paraformaldehyde solution was added to each well and fixed for 30 minutes at room temperature. After fixation, the fixative was discarded and the residual paraformaldehyde was removed by three PBS washes. 100 μL of PBS solution containing 0.1% TritonX-100 was added to each well and permeabilized for 10 minutes at room temperature. Washed three times with PBS again, and 100 μL of blocking solution containing 10% normal goat serum was added to each well and incubated at room temperature for 30 minutes. After blocking, 50 μL of primary antibody diluted to 1:1000 was added to each well and incubated overnight at 4°C. The primary antibody was removed the next day and washed three times with PBS. Then, 50 μL of fluorescent secondary antibody diluted to 1:1000 was added to each well and incubated for 45 min at room temperature in the dark. Washed three times with PBS, 100 μL of 5 μg / mL DAPI solution was added to each well for staining for 10 min. After washing with PBS again, the slides were sealed with glycerol-carbonate buffer. Finally, the samples were observed and analyzed in detail using a Leica TCS FP8 confocal microscope.

[0093] Immunofluorescence identification was performed on the fifth-generation recombinant virus rHCOV-NL63-EGFP to evaluate the expression of its NP protein and EGFP protein. The results showed that after the wild-type virus HCoV-NL63 Amsterdam I (NL63-WT) infected LLC-MK2 cells, only the red fluorescence signal of the NP protein could be specifically detected. In contrast, the recombinant virus rHCOV-NL63-EGFP can not only specifically recognize the NP protein to display a red fluorescence signal, but also directly observe the expression of green fluorescent protein ( Figure 2 (middle D).

[0094] Example 3

[0095] In vitro biological characteristics of HCoV-NL63 Amsterdam I recombinant virus carrying EGFP

[0096] 3.1 Plaque assay of recombinant viruses

[0097] LLC-MK2 cells were plated at 4 × 10 5The cells were inoculated into a 12-well plate at a density of 10 cells and cultured to 80%; the virus was diluted 10 times, and 400 μL of the corresponding dilution of virus solution was added to each well. It was adsorbed at 33°C for 2h, and the virus solution was discarded. The culture medium was discarded from the negative wells, and sterile Avicel was diluted 1 times with 4% 2×DMEM, 1 mL per well, and incubated at 33°C in a 5% CO2 incubator for 8 days. The covering solution was discarded, and 1 mL / well of 4% paraformaldehyde was added to fix for 30 minutes. 1 mL / well of crystal violet was added, discarded after 10 minutes, and slowly rinsed with PBS. After drying, the results were observed. The results showed that compared with the wild type, the plaques of rNL63-EGFP were significantly smaller ( Figure 3 The results suggest that the partial deletion of ORF3 may have an impact on the biological characteristics of HCoV-NL63, so it is necessary to further study its biological characteristics in vivo.

[0098] 3.2 Determination of recombinant virus growth kinetics

[0099] LLC-MK2 cells were plated at 6 × 10 per well. 5 The cells were seeded at a density of 25 cm 2 When the cells grow to 90% confluence in the culture flask, count the cells and infect them with 0.1 MOI of wild-type or recombinant virus, and incubate them overnight at 33°C in a 5% CO2 incubator. On the second day, add 2 mL of DMEM maintenance solution containing 2% FBS to each well, and collect 100 μL of supernatant and add 100 μL of maintenance solution every 24 hours. For the recombinant virus rNL63-EGFP, directly observe the expression of EGFP fluorescence ( Figure 3 B), and the fluorescence quantitative detection of EGFP was performed using an enzyme-labeled instrument ( Figure 3 D), the expression of EGFP fluorescence was monitored for 7 consecutive days; for the parent virus NL63-WT and the recombinant virus rNL63-EGFP, the CPE method was used to count the positive and negative wells ( Figure 3 C), Reed-Muench formula to calculate the TCID of the virus 50 TCID 50 ), and the experiment was repeated three times to draw the virus growth kinetics curve.

[0100] The results of analyzing the virus replication dynamics using EGFP reporter gene expression showed that although neither the recombinant virus nor the wild-type virus caused obvious cytopathic effects in LLC-MK2 cells, the expression of EGFP could be observed within 24 hours after infection with the recombinant virus. As time went by, the fluorescence signal gradually increased, reaching the most significant level on the 6th day ( Figure 3 Middle B); The quantitative detection results of EGFP protein expression are consistent with the fluorescence image results ( Figure 3 (middle D).

[0101] TCID 50 The results of the analysis of viral replication kinetics showed that the recombinant virus rNL63-EGFP also showed a rapid proliferation rate from 48h to 72h after infection, with the titer increasing from the initial 10 3.43 TCID 50 / mL increased to 10 4.47 TCID 50 / mL, and reached the replication peak on the 6th day with a titer of 10 5.18 TCID 50 / mL, wild-type NL63-WT proliferated most rapidly from 72h to 96h after infection, with the titer increasing from the initial 10 2.58 TCID 50 / mL quickly increased to 10 4.02 TCID 50 / mL, and reached its replication peak on the 6th day, with a titer of 10 5.54 TCID 50 / mL, and the replication kinetics of the two were similar ( Figure 3 Middle E).

[0102] 3.2 Analysis of genetic stability of recombinant viruses

[0103] LLC-MK2 cells were infected with the recombinant virus at a dose of 0.1 MOI and passaged for 10 generations. The titers of viruses of different generations and the expression of EGFP protein were detected by immunofluorescence of NP protein, and the expression and quantification of EGFP protein to evaluate the stability of the recombinant virus.

[0104] Western blot analysis, the virus was inoculated into LLC-MK2 cells at 0.1 MOI. After 144 hours of infection, the infected cell pellets were collected, subjected to SDS-PAGE gel electrophoresis, and electrotransferred to nitrocellulose membranes. Subsequently, the NC membrane was blocked with 5% skim milk-PBS buffer at room temperature for 2 hours. The membrane was incubated with a 1:1000 dilution of the primary anti-HCoV-NL63 N protein polyclonal antibody (purchased from Sino Biological, 40641-T46-100) at 4°C overnight. After incubation, the membrane was washed 3 times with PBST (phosphate buffer containing Tween-20) for 10 minutes each time. Then, the secondary antibody (Goat anti-Rabbit IgG (H+L) Secondary Antibody HRP, purchased from Thermo Fisher, 31460) was diluted 1:1000 and incubated at room temperature in the dark for 1 hour. After incubation, the membrane was washed again with PBST in the dark for 3 times for 10 minutes each time. Amersham TM ImageQuant TMThe 800 instrument scans and images the membrane to detect the expression level of the target protein.

[0105] The results of the EGFP protein expression test of the P1, P3, P5, P7 and P9 generations of the recombinant virus rNL63-EGFP showed that each generation of the virus could effectively express the EGFP protein ( Figure 4 The quantitative analysis results of EGFP fluorescence intensity are consistent with the expression results ( Figure 4 (B) TCID 50 The titer determination results showed that the titer of the recombinant virus increased from 10 4.92 TCID 50 / mL significantly increased to 10 in P9 5.40 TCID 50 / mL, and maintained a stable expansion trend in subsequent passages ( Figure 4 In addition, the results of the identification of the viral NP protein and the reporter gene EGFP protein showed that specific bands could be observed at the positions of 43kDa and 27kDa in cells infected with each generation of the virus ( Figure 4 D). The results of relative quantitative grayscale values ​​of EGFP protein showed that all generations of viruses can effectively express EGFP protein ( Figure 4 Middle E).

[0106] Example 4

[0107] In vivo biological characteristics of HCoV-NL63 Amsterdam I recombinant virus carrying EGFP

[0108] 12-week-old BALB / c mice were purchased from Beijing Sibeifu Biotechnology Co., Ltd. The mice were randomly divided into groups, and wild-type HCoV-NL63 was used as a control. 5 TCID 50 / mL was used to infect wild NL63-WT or rNL63-EGFP, and 30μL / mouse was infected. The mice were weighed and the status of the mice was observed daily. The mice were killed, and the lung tissues were taken. Each tissue was divided into two equal parts. One part was placed in a homogenization tube, and after weighing, PBS containing protease inhibitors was added at 100mg / 500μL, and then placed in a tissue homogenizer at 4°C for homogenization. The homogenate product was then centrifuged at 5000rpm for 10min to collect the supernatant, and 100μL was taken for nucleic acid extraction. The viral load in the lung tissue was detected by RT-PCR, and the rest was frozen and stored at -80°C. The other part was used for mouse lung tissue pathology diagnosis, which was completed by Professor Yang Lifeng's team from the College of Veterinary Medicine of China Agricultural University.

[0109] The experimental results showed that mice infected with rNL63-EGFP recombinant virus regained weight faster than mice infected with NL63-WT ( Figure 5 However, there was no significant difference in the viral load in lung tissue between the two groups of mice ( Figure 5 The NL63-WT group mainly showed the characteristics of interstitial pneumonia. The lesions were mild on the first day after infection, slightly aggravated on the third and fifth days after infection, and significantly alleviated on the seventh day. The trend of lung lesions and lesion severity in the rNL63-EGFP group was similar to that in the NL63-WT group, and the lesions on the first, third, and fifth days after infection were slightly milder than those in the NL63-WT group ( Figure 5 This preliminary result further supports the hypothesis of this study that the partial deletion of ORF3 may have a certain impact on the biological characteristics of HCoV-NL63.

[0110] Example 5

[0111] Analysis of the application of recombinant viruses in the pharmacodynamic evaluation of remdesivir

[0112] In this study, NL63-WT was used as a control, and the pharmacodynamic evaluation results of rNL63-EGFP recombinant virus in the drug remdesivir (RDV) were evaluated in LLC-MK2 cells.

[0113] 5.1 Cytotoxicity assay (CC 50 )

[0114] In a 96-well plate, 3 × 10 4 LLC-MK2 cells were plated in a volume of 100 μL / well, and the cells reached 90% confluence. Remdesivir was diluted 5 times from the initial concentration (100 μM / mL), and 100 μL of drug diluent was added to each well, with three replicates for each drug concentration. At the same time, cell control wells and blank control wells were set up, and maintenance solution was added to each well. All wells were placed in a constant temperature incubator at 33°C and 5% CO2 for 72 hours. After the culture was completed, the CCK-8 kit was used to detect cell activity. The CCK-8 reagent was diluted with maintenance solution at a ratio of 1:10, the supernatant in the 96-well plate was discarded, and 100 μL of reagent diluent was added to each well. The culture plate was returned to the incubator and incubated for 1 to 4 hours to allow the reagent to fully react with the cells. Subsequently, the absorbance of each well was measured at a wavelength of 450 nm using an enzyme reader. When the OD value of the control well reached about 1.5, the inhibition rate of the drug on cell activity was calculated based on the measured data.

[0115] 5.2 Pharmacodynamic evaluation (EC 50 )

[0116] LLC-MK2 cells were plated at 3 × 10 4The cells were inoculated in a 96-well plate at a density of , and the cells grew to about 90%. Remdesivir was diluted 5 times from 100 μM, and 100 μL was added to each well. Three replicate wells were set for each concentration. At the same time, cell control wells and virus control wells were set up and cell maintenance solution was added respectively. The wells were placed in a constant temperature incubator at 33°C and 5% CO2 and incubated for 2 hours. The drug dilution solution was discarded, and the virus solution with MOI=0.1 was prepared. 100 μL / well was added to the cell plate and incubated in a 33°C incubator for 2 hours. The virus solution was discarded, 100 μL of the drug dilution solution of the corresponding concentration was added to each well, and maintenance solution was added to the virus control well. Continue to culture at 33°C for 72 hours. The viral RNA was extracted using the Tianlong Nucleic Acid Extraction Kit, and the primers and probes were used for detection as described in Table 3. Finally, Graphpad was used to calculate the 50% inhibitory concentration (EC 50 ), the virus inhibition rate curve was drawn, and three independent experiments were performed.

[0117] The antiviral efficacy of remdesivir was quantitatively analyzed by the expression of recombinant virus EGFP. The EGFP protein fluorescence results showed ( Figure 6 In A), the green fluorescence intensity gradually increased with the decrease of drug concentration, showing a dose-dependent effect; the results of quantitative analysis of EGFP expression were consistent with the results of EGFP protein fluorescence ( Figure 6 Middle B). Based on EGFP analysis, the EC of remdesivir against rNL62-EGFP in LLC-MK2 cells 50 0.2400μM( Figure 6 C), which is in the same order of magnitude as previous research results (EC 50 =0.77 μM).

[0118] It can be concluded from the above examples that the recombinant coronavirus of the present invention can efficiently express the EGFP gene, carry enhanced green fluorescent protein, and its growth curve is similar to that of the parent virus (wild-type virus), but its inserted reporter gene EGFP is relatively stable during continuous passage, and can be used for antiviral drug screening and vaccine preparation research.

[0119] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A recombinant human coronavirus NL63 genome, characterized in that: The recombinant human coronavirus NL63 genome includes the human coronavirus NL63 genome, an enhanced green fluorescent protein gene EGFP inserted into the human coronavirus NL63 genome, a CMV promoter inserted into the front end of the 5'UTR of the human coronavirus NL63 genome, and an HDV ribozyme and a BGH termination signal inserted into the tail of the 3'UTR of the human coronavirus NL63 genome; The enhanced green fluorescent protein gene EGFP replaces the nucleotide sequence encoding the 1st to 154th amino acids in the ORF3 region of the human coronavirus NL63 genome.

2. The recombinant human coronavirus NL63 genome according to claim 1, characterized in that The nucleotide sequence of the replaced ORF3 region is shown in SEQ ID NO:

44.

3. A primer set for cloning the recombinant human coronavirus NL63 genome according to claim 1 or 2, characterized in that: The primer set includes primer pair F1, primer pair F2, primer pair F3, primer pair F4, primer pair F5, primer pair F6, primer pair F7, primer pair F8, primer pair F9, primer pair F10, primer pair F11 and primer pair EGFP; the nucleotide sequences of the upstream primer F1-F and the downstream primer F1-R of the primer pair F1 are shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively; the nucleotide sequences of the upstream primer F2-F and the downstream primer F2-R of the primer pair F2 are shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively; the nucleotide sequences of the upstream primer F3-F and the downstream primer F3-R of the primer pair F3 are shown in SEQ ID NO: 5 and SEQ ID NO: 6, respectively; the nucleotide sequences of the upstream primer F4-F and the downstream primer F4-R of the primer pair F4 are shown in SEQ ID NO: 7 and SEQ ID NO: 8, respectively. NO:8; the nucleotide sequences of the upstream primer F5-F and the downstream primer F5-R of the primer pair F5 are shown in SEQ ID NO:9 and SEQ ID NO:10, respectively; the nucleotide sequences of the upstream primer F6-F and the downstream primer F6-R of the primer pair F6 are shown in SEQ ID NO:11 and SEQ ID NO:12, respectively; the nucleotide sequences of the upstream primer F7-F and the downstream primer F7-R of the primer pair F7 are shown in SEQ ID NO:13 and SEQ ID NO:14, respectively; the nucleotide sequences of the upstream primer F8-F and the downstream primer F8-R of the primer pair F8 are shown in SEQ ID NO:15 and SEQ ID NO:16, respectively; the nucleotide sequences of the upstream primer F9-F and the downstream primer F9-R of the primer pair F9 are shown in SEQ ID NO:17 and SEQ ID NO:18, respectively; the nucleotide sequences of the upstream primer F10-F and the downstream primer F10-R of the primer pair F10 are shown in SEQ ID NO:19 and SEQ ID NO:20, respectively. NO:19 and SEQ ID NO:20; the nucleotide sequences of the upstream primer F11-F and the downstream primer F11-R of the primer pair F11 are shown in SEQ ID NO:21 and SEQ ID NO:22, respectively; the nucleotide sequences of the upstream primer EGFP-F and the downstream primer EGFP-R of the primer pair EGFP are shown in SEQ ID NO:23 and SEQ ID NO:24, respectively.

4. A kit for cloning the recombinant human coronavirus NL63 genome according to claim 1 or 2, characterized in that: The kit comprises the primer set according to claim 3 and a PCR amplification reagent.

5. A recombinant vector, characterized in that: The recombinant vector comprises a basic vector and a recombinant human coronavirus NL63 genome inserted into the basic vector; the recombinant human coronavirus NL63 genome is the recombinant human coronavirus NL63 genome described in claim 1 or 2, or the recombinant human coronavirus NL63 genome cloned using the primer set described in claim 3, or the recombinant human coronavirus NL63 genome cloned using the kit described in claim 4.

6. The recombinant vector according to claim 5, characterized in that The basic vector includes the YAC / BAC shuttle plasmid pYES1L.

7. A recombinant strain, characterized in that: The recombinant strain comprises a basic strain and a recombinant vector introduced into the basic strain, and the recombinant vector is the recombinant vector according to claim 5 or 6.

8. Use of the recombinant human coronavirus NL63 genome according to claim 1 or 2, the primer set according to claim 3, the kit according to claim 4, the recombinant vector according to claim 5 or 6, or the recombinant strain according to claim 7 in preparing a recombinant human coronavirus NL63 that efficiently expresses enhanced green fluorescent protein.

9. A method for preparing a recombinant human coronavirus NL63 that efficiently expresses enhanced green fluorescent protein based on the primer set of claim 3, characterized in that: The steps include: The pBAC-OC43-ns2DelRLUC plasmid was PCR amplified with primer pair F1 and primer pair F11, respectively, to obtain two fragments containing the transcription element; The cDNA of human coronavirus NL63 was amplified by PCR using primer pair F2, primer pair F3, primer pair F4, primer pair F5, primer pair F6, primer pair F7, primer pair F8, primer pair F9 and primer pair F10, respectively, to obtain 9 gene fragments of the full-length gene of human coronavirus NL63; The plasmid carrying the enhanced green fluorescent protein gene is amplified by PCR using the primer pair EGFP to obtain the enhanced green fluorescent protein gene EGFP; The linearized basic vector is mixed with the two segments containing the transcription element, the nine gene segments of the full-length gene of the human coronavirus NL63, and the enhanced green fluorescent protein gene EGFP, and then transformed into yeast competent cells for recombinant expression to obtain a recombinant vector; The recombinant vector is subjected to virus rescue to obtain the recombinant coronavirus NL63 that efficiently expresses enhanced green fluorescent protein.

10. Use of the recombinant human coronavirus NL63 genome according to claim 1 or 2, the primer set according to claim 3, the kit according to claim 4, the recombinant vector according to claim 5 or 6, the recombinant strain according to claim 7, or the recombinant human coronavirus NL63 efficiently expressing enhanced green fluorescent protein prepared by the preparation method according to claim 9 in antiviral drug screening and / or vaccine preparation.

Images