Therapeutic methods for two-line therapy of CD19-targeted CAR T cells

Abstract

Provided are adoptive cell therapies involving the administration of doses of cells for the treatment of subjects having certain B-cell malignancies, as well as related methods, compositions, uses, and articles of manufacture. The cells typically express recombinant receptors, such as chimeric antigen receptors (CARs). In some embodiments, the disease or condition is large B-cell lymphoma (LBCL) that is relapsed or refractory to first-line chemical immunotherapy.

Description

Cross-references to related applications

[0001] This application claims priority to U.S. Provisional Application No. 63 / 354,670, filed June 22, 2022, entitled “Treatment Method for Second-Line Therapy of CD19-Targeted CAR T Cells,” and U.S. Provisional Application No. 63 / 455,920, filed March 30, 2023, entitled “Treatment Method for Second-Line Therapy of CD19-Targeted CAR T Cells,” the contents of which are incorporated herein by reference in their entirety. By referencing and incorporating into the sequence list

[0002] This application is submitted electronically along with the sequence list. The sequence list is provided as a file named 735042026440SeqList.xml, created on June 19, 2023, and is 76,793 bytes in size. Information from the electronic sequence list is incorporated herein by reference in its entirety. Technical Field

[0003] This disclosure relates in several aspects to adoptive cell therapy, which involves administering a dose of cells to treat a subject with certain B-cell malignancies, and related methods, compositions, uses, and articles thereof. The cells typically express recombinant receptors, such as chimeric antigen receptors (CARs). In some embodiments, the disease or condition is large B-cell lymphoma (LBCL), such as diffuse large B-cell lymphoma (DLBCL) (including DLBCL caused by indolent lymphomas), high-grade B-cell lymphoma, primary mediastinal large B-cell lymphoma, or grade 3B follicular lymphoma that is relapsed or refractory to first-line chemoimmunotherapy. Background Technology

[0004] Various immunotherapies and cell therapies can be used to treat diseases and conditions. For example, adoptive cell therapy can be beneficial in the treatment of cancer or other diseases or disorders, including those involving the administration of cells expressing chimeric receptors specific to the disease or disorder of interest, such as chimeric antigen receptors (CARs) and / or other recombinant antigen receptors, as well as other adoptive immune cell and adoptive T cell therapies. Improved methods are needed. This disclosure provides methods, uses, and articles of manufacture that meet the above needs. Summary of the Invention

[0005] This disclosure provides a method for treating a subject with large B-cell lymphoma (LBCL), the method comprising administering to the subject a dose of autologous CD19-targeted genetically modified T cells, wherein: (a) the LBCL is selected from the group consisting of unspecified diffuse large B-cell lymphoma (DLBCL), high-grade B-cell lymphoma, primary mediastinal large B-cell lymphoma, and grade 3B follicular lymphoma; (b) the dose comprises CD4+ cells expressing a chimeric antigen receptor (CAR) that binds to CD19. + T cells and CD8+ expressing the CAR. + T cells; (c) The dose is 44 × 10 6 Up to 120×10 6 (d) The subject: (i) was refractory within 12 months of initial therapy; or (ii) had relapsed within 12 months of initial therapy. In some embodiments, the initial therapy is first-line chemoimmunotherapy.

[0006] This disclosure provides a method for treating a subject with large B-cell lymphoma (LBCL), the method comprising administering to the subject a dose of autologous CD19-targeted genetically modified T cells, wherein: (a) the LBCL is selected from the group consisting of unspecified diffuse large B-cell lymphoma (DLBCL), high-grade B-cell lymphoma, primary mediastinal large B-cell lymphoma, and grade 3B follicular lymphoma; (b) the dose comprises CD4+ cells expressing a chimeric antigen receptor (CAR) that binds to CD19. + T cells and CD8+ expressing the CAR. + T cells; (c) The dose is 44 × 10 6 Up to 120×10 6 (d) CAR-positive live T cells; wherein the CAR-positive CD4 + T cells and the CAR-positive CD8 + T cells are CAR-positive live CD4+ cells at a ratio of approximately 1:1. + T cells and CAR-positive active CD8 + The proportion of live T cells administered to the subject; and (e) the subject: (i) was refractory within 12 months of initial therapy; or (ii) had relapsed within 12 months of initial therapy. In some embodiments, the initial therapy is first-line chemoimmunotherapy.

[0007] This disclosure provides a method for treating a subject with large B-cell lymphoma (LBCL), the method comprising administering to the subject a dose of autologous CD19-targeted genetically modified T cells, wherein: (a) the LBCL is selected from the group consisting of unspecified diffuse large B-cell lymphoma (DLBCL), high-grade B-cell lymphoma, primary mediastinal large B-cell lymphoma, and grade 3B follicular lymphoma; (b) the dose comprises CD4+ cells expressing a chimeric antigen receptor (CAR) that binds to CD19. + T cells and CD8+ expressing the CAR. + T cells; (c) The dose is 44 × 10 6 Up to 120×10 6 The subject (d) has CAR-positive live T cells; and the subject (i) has disease refractory to first-line chemoimmunotherapy; (ii) has relapsed within 12 months of first-line chemoimmunotherapy; (iii) has disease refractory to first-line chemoimmunotherapy and is ineligible for hematopoietic stem cell transplantation (HSCT); or (iv) has relapsed after first-line chemoimmunotherapy and is ineligible for hematopoietic stem cell transplantation (HSCT).

[0008] This disclosure provides a method for treating a subject with large B-cell lymphoma (LBCL), the method comprising administering to the subject a dose of autologous CD19-targeted genetically modified T cells, wherein: (a) the LBCL is selected from the group consisting of unspecified diffuse large B-cell lymphoma (DLBCL), high-grade B-cell lymphoma, primary mediastinal large B-cell lymphoma, and grade 3B follicular lymphoma; (b) the dose comprises CD4+ cells expressing a chimeric antigen receptor (CAR) that binds to CD19. + T cells and CD8+ expressing the CAR. + T cells; (c) The dose is 44 × 10 6 Up to 120×10 6 (d) CAR-positive live T cells; wherein the CAR-positive CD4 + T cells and the CAR-positive CD8 + T cells are CAR-positive live CD4+ cells at a ratio of approximately 1:1. + T cells and CAR-positive active CD8 + The proportion of T cells administered to the subject; and (e) the subject: (i) has disease refractory to first-line chemoimmunotherapy; (ii) has relapsed within 12 months of first-line chemoimmunotherapy; (iii) has disease refractory to first-line chemoimmunotherapy and is ineligible for hematopoietic stem cell transplantation (HSCT); or (iv) has relapsed after first-line chemoimmunotherapy and is ineligible for hematopoietic stem cell transplantation (HSCT).

[0009] In some implementations, the subject (i) has disease refractory to first-line chemoimmunotherapy. In some implementations, the subject (ii) has relapsed within 12 months of first-line chemoimmunotherapy. In some implementations, the subject (iii) has disease refractory to first-line chemoimmunotherapy and is ineligible for hematopoietic stem cell transplantation (HSCT). In some implementations, the subject (iv) has relapsed after first-line chemoimmunotherapy and is ineligible for hematopoietic stem cell transplantation (HSCT).

[0010] In some embodiments, the subject belongs to (i) or (iii), and the refractory disease is a primary refractory disease. In some embodiments, the subject belongs to (i), and the refractory disease is a primary refractory disease. In some embodiments, the subject belongs to (iii), and the refractory disease is a primary refractory disease.

[0011] In some embodiments, the subject belongs to (ii) or (iv), and the relapse of the subject occurs after the subject has achieved a complete response (CR) to first-line chemoimmunotherapy. In some embodiments, the subject belongs to (ii), and the relapse of the subject occurs after the subject has achieved a complete response (CR) to first-line chemoimmunotherapy. In some embodiments, the subject belongs to (iv), and the relapse of the subject occurs after the subject has achieved a complete response (CR) to first-line chemoimmunotherapy.

[0012] In some embodiments, the subject belongs to (ii) or (iv), and the subject's relapse occurs after the subject has achieved a partial response (PR) to first-line chemoimmunotherapy. In some embodiments, the subject belongs to (ii), and the subject's relapse occurs after the subject has achieved a partial response (PR) to first-line chemoimmunotherapy. In some embodiments, the subject belongs to (iv), and the subject's relapse occurs after the subject has achieved a partial response (PR) to first-line chemoimmunotherapy.

[0013] In some embodiments, the subject is classified as (iv), and the subject's relapse occurs within 12 months of the first-line chemoimmunotherapy. In some embodiments, the subject is classified as (iv), and the subject's relapse occurs more than 12 months after the first-line chemoimmunotherapy.

[0014] This disclosure also provides a method for treating a subject with large B-cell lymphoma (LBCL), the method comprising administering to the subject a dose of autologous CD19-targeted genetically modified T cells, wherein: (a) the LBCL is selected from the group consisting of unspecified diffuse large B-cell lymphoma (DLBCL), high-grade B-cell lymphoma, primary mediastinal large B-cell lymphoma, and grade 3B follicular lymphoma; (b) the dose comprises CD4+ cells expressing a CD19-binding chimeric antigen receptor (CAR). + T cells and CD8+ expressing the CAR. + T cells; (c) The dose is 44 × 10 6 Up to 120×10 6 (d) The subject has CAR-positive live T cells; and (d) the subject has a disease that is refractory to first-line chemoimmunotherapy.

[0015] This disclosure also provides a method for treating a subject with large B-cell lymphoma (LBCL), the method comprising administering to the subject a dose of autologous CD19-targeted genetically modified T cells, wherein: (a) the LBCL is selected from the group consisting of unspecified diffuse large B-cell lymphoma (DLBCL), high-grade B-cell lymphoma, primary mediastinal large B-cell lymphoma, and grade 3B follicular lymphoma; (b) the dose comprises CD4+ cells expressing a CD19-binding chimeric antigen receptor (CAR). + T cells and CD8+ expressing the CAR. + T cells; (c) The dose is 44 × 10 6 Up to 120×10 6 (d) CAR-positive live T cells; wherein the CAR-positive CD4 + T cells and the CAR-positive CD8 + T cells are CAR-positive live CD4+ cells at a ratio of approximately 1:1. + T cells and CAR-positive CD8 + The proportion of T cells administered to the subject; and (e) the subject has a disease refractory to first-line chemoimmunotherapy.

[0016] This disclosure also provides a method for treating a subject with large B-cell lymphoma (LBCL), the method comprising administering to the subject a dose of autologous CD19-modified T cells, wherein: (a) the LBCL is selected from the group consisting of unspecified diffuse large B-cell lymphoma (DLBCL), high-grade B-cell lymphoma, primary mediastinal large B-cell lymphoma, and grade 3B follicular lymphoma; (b) the dose comprises CD4+ cells expressing a chimeric antigen receptor (CAR) that binds to CD19.+ T cells and CD8+ expressing the CAR. + T cells; (c) The dose is 44 × 10 6 Up to 120×10 6 (d) The subject had CAR-positive live T cells; and the subject had relapsed within 12 months of first-line chemoimmunotherapy.

[0017] This disclosure also provides a method for treating a subject with large B-cell lymphoma (LBCL), the method comprising administering to the subject a dose of autologous CD19-targeted genetically modified T cells, wherein: (a) the LBCL is selected from the group consisting of unspecified diffuse large B-cell lymphoma (DLBCL), high-grade B-cell lymphoma, primary mediastinal large B-cell lymphoma, and grade 3B follicular lymphoma; (b) the dose comprises CD4+ cells expressing a CD19-binding chimeric antigen receptor (CAR). + T cells and CD8+ expressing the CAR. + T cells; (c) The dose is 44 × 10 6 Up to 120×10 6 (d) CAR-positive live T cells; wherein the CAR-positive CD4 + T cells and the CAR-positive CD8 + T cells are CAR-positive live CD4+ cells at a ratio of approximately 1:1. + T cells and CAR-positive live CD8 + The proportion of T cells administered to the subject; and (e) the subject relapsed within 12 months of first-line chemoimmunotherapy.

[0018] This disclosure also provides a method for treating a subject with large B-cell lymphoma (LBCL), the method comprising administering to the subject a dose of autologous CD19-targeted genetically modified T cells, wherein: (a) the LBCL is selected from the group consisting of unspecified diffuse large B-cell lymphoma (DLBCL), high-grade B-cell lymphoma, primary mediastinal large B-cell lymphoma, and grade 3B follicular lymphoma; (b) the dose comprises CD4+ cells expressing a CD19-binding chimeric antigen receptor (CAR). + T cells and CD8+ expressing the CAR. + T cells; (c) The dose is 44 × 10 6 Up to 120×10 6 (d) The subject has CAR-positive live T cells; and the subject has a disease refractory to first-line chemoimmunotherapy and does not meet the criteria for hematopoietic stem cell transplantation (HSCT).

[0019] This disclosure also provides a method for treating a subject with large B-cell lymphoma (LBCL), the method comprising administering to the subject a dose of autologous CD19-targeted genetically modified T cells, wherein: (a) the LBCL is selected from the group consisting of unspecified diffuse large B-cell lymphoma (DLBCL), high-grade B-cell lymphoma, primary mediastinal large B-cell lymphoma, and grade 3B follicular lymphoma; (b) the dose comprises CD4+ cells expressing a CD19-binding chimeric antigen receptor (CAR). + T cells and CD8+ expressing the CAR. + T cells; (c) The dose is 44 × 10 6 Up to 120×10 6 (d) CAR-positive live T cells; wherein the CAR-positive CD4 + T cells and the CAR-positive CD8 + T cells are CAR-positive live CD4+ cells at a ratio of approximately 1:1. + T cells and CAR-positive active CD8 + The proportion of T cells administered to the subject; and (e) the subject has a disease refractory to first-line chemoimmunotherapy and is ineligible for hematopoietic stem cell transplantation (HSCT).

[0020] This disclosure also provides a method for treating a subject with large B-cell lymphoma (LBCL), the method comprising administering to the subject a dose of autologous CD19-targeted genetically modified T cells, wherein: (a) the LBCL is selected from the group consisting of unspecified diffuse large B-cell lymphoma (DLBCL), high-grade B-cell lymphoma, primary mediastinal large B-cell lymphoma, and grade 3B follicular lymphoma; (b) the dose comprises CD4+ cells expressing a CD19-binding chimeric antigen receptor (CAR). + T cells and CD8+ expressing the CAR. + T cells; (c) The dose is 44 × 10 6 Up to 120×10 6 (d) The subject had CAR-positive live T cells; and the subject had relapsed after first-line chemoimmunotherapy and was ineligible for hematopoietic stem cell transplantation (HSCT).

[0021] This disclosure also provides a method for treating a subject with large B-cell lymphoma (LBCL), the method comprising administering to the subject a dose of autologous CD19-targeted genetically modified T cells, wherein: (a) the LBCL is selected from the group consisting of unspecified diffuse large B-cell lymphoma (DLBCL), high-grade B-cell lymphoma, primary mediastinal large B-cell lymphoma, and grade 3B follicular lymphoma; (b) the dose comprises CD4+ cells expressing a CD19-binding chimeric antigen receptor (CAR). + T cells and CD8+ expressing the CAR. + T cells; (c) The dose is 44 × 10 6 Up to 120×10 6 (d) CAR-positive live T cells; + T cells and the CAR-positive CD8 + T cells are CAR-positive live CD4+ cells at a ratio of approximately 1:1. + T cells compared to CAR-positive active CD8 + The proportion of T cells administered to the subject; and (e) the subject has relapsed after first-line chemoimmunotherapy and is ineligible for hematopoietic stem cell transplantation (HSCT).

[0022] In some embodiments, the subject's relapse occurs within 12 months of receiving the first-line chemoimmunotherapy. In some embodiments, the subject's relapse occurs more than 12 months after receiving the first-line chemoimmunotherapy.

[0023] In some embodiments, the dose is 90 × 10 6 Up to 110×10 6 CAR-positive live T cells. In some embodiments, the dose is 110 × 10⁶. 6 One CAR-positive live T cell.

[0024] In some embodiments, the LBCL is a DLBCL. In some embodiments, the LBCL is an unspecified DLBCL. In some embodiments, the unspecified DLBCL is a DLBCL caused by indolent lymphoma. In some embodiments, the LBCL is a high-grade B-cell lymphoma. In some embodiments, the LBCL is a primary mediastinal large B-cell lymphoma. In some embodiments, the LBCL is a grade 3B follicular lymphoma.

[0025] In some implementations, the subject is ineligible for HSCT due to comorbidities or age.

[0026] In some embodiments, the subject is ineligible for HSCT due to comorbidities. In some embodiments, the comorbidities include impaired lung function. In some embodiments, the comorbidities include an adjusted pulmonary carbon monoxide diffusion capacity (DLCO) of about 60% or less. In some embodiments, the comorbidities include impaired cardiac function. In some embodiments, the comorbidities include a left ventricular ejection fraction (LVEF) of less than about 50%. In some embodiments, the comorbidities include impaired renal function. In some embodiments, the comorbidities include a calculated creatinine clearance of less than about 60 mL / min. In some embodiments, the comorbidities include impaired liver function. In some embodiments, the comorbidities include aspartate aminotransferase (AST) levels approximately twice the upper limit of normal (ULN). In some embodiments, the comorbidities include alanine aminotransferase (ALT) levels approximately twice the upper limit of normal (ULN). In some embodiments, the comorbidities include an Eastern Cooperative Oncology Group (ECOG) performance status of 2.

[0027] In some embodiments, the subject is ineligible for HSCT due to age. In some embodiments, the subject is an adult. In some embodiments, the subject is at least 18 years old. In some embodiments, the subject is not 75 years old or older. In some embodiments, the subject is ineligible for HSCT because they are 70 years old or older.

[0028] In some implementations, the first-line chemoimmunotherapy is rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisone (R-CHOP). In some implementations, R-CHOP is administered to the subject in a 14-day cycle (R-CHOP14). In some implementations, R-CHOP is administered to the subject in a 21-day cycle (R-CHOP21). In some implementations, the first-line chemoimmunotherapy is a modified R-CHOP in which rituximab is replaced with another anti-CD20 monoclonal antibody. In some implementations, polotutuzumab is used instead of oxutuzumab and vincristine.

[0029] In some embodiments, the first-line chemoimmunotherapy is rituximab, dexamethasone, cytarabine, and cisplatin (R-DHA). In some embodiments, the first-line chemoimmunotherapy is rituximab, ifosfamide, carboplatin, and etoposide (R-ICE). In some embodiments, the first-line chemoimmunotherapy is rituximab, gemcitabine, dexamethasone, and cisplatin (R-GDP). In some embodiments, the first-line chemoimmunotherapy is administered to the subject for three cycles.

[0030] In some implementations, first-line chemoimmunotherapy is administered to the subject for 3-8 cycles. In some implementations, first-line chemoimmunotherapy is administered to the subject for more than 4 cycles. In some implementations, first-line chemoimmunotherapy is administered to the subject for 6 cycles or approximately 6 cycles.

[0031] In some implementations, first-line chemoimmunotherapy is rituximab, doxorubicin, cyclophosphamide, vincristine, bleomycin, and prednisone (R-ACVBP). In other implementations, first-line chemoimmunotherapy is dose-adjusted etoposide, prednisone, vincristine, cyclophosphamide, doxorubicin, and rituximab (DA-EPOCH-R).

[0032] In some implementations, the subject does not have primary central nervous system (CNS) lymphoma.

[0033] In some implementations, the CAR-positive CD4 + T cells and the CAR-positive CD8 + T cells are administered to the subject in a separate composition ratio. In some embodiments, the CAR-positive CD8 is included. + The composition of T cells contains CAR-positive CD4. + The composition containing T cells was previously administered to the subject. In some embodiments, a CD8-containing CAR-positive T-cell antibody was administered. + The administration of the T cell composition and the presence of CAR-positive CD4 + The cell composition is administered at intervals not exceeding about 12 hours, 6 hours, 4 hours, 2 hours, 1 hour, or 30 minutes. In some embodiments, CD8 containing the CAR-positive cell is administered. + The administration of the T cell composition and the presence of CAR-positive CD4 + The T-cell composition is administered at intervals not exceeding approximately 30 minutes. In some embodiments, CD8+ containing the CAR-positive T-cell is administered. + The administration of the T cell composition and the presence of CAR-positive CD4 + The T-cell composition is administered at intervals of approximately 15 minutes or less.

[0034] In some embodiments, the dose of autologous CD19-targeted genetically modified T cells is provided in a formulation containing a cryoprotectant. In some embodiments, the formulation contains... In some embodiments, the formulation comprises dimethyl sulfoxide (DMSO). In some embodiments, the formulation comprises albumin, optionally human albumin.

[0035] In some embodiments, the dose of autologous CD19-targeted genetically modified T cells is cryopreserved before administration to the subject. In some embodiments, the cryopreserved dose of autologous CD19-targeted genetically modified T cells is thawed before administration to the subject. In some embodiments, the dose of autologous CD19-targeted genetically modified T cells is administered to the subject within 2 hours of thawing. In some embodiments, the dose of autologous CD19-targeted genetically modified T cells is administered to the subject via intravenous infusion.

[0036] In some embodiments, the CAR includes an extracellular antigen-binding domain that binds to CD19, a transmembrane domain, and an intracellular signaling domain. In some embodiments, the extracellular antigen-binding domain is a single-chain variable fragment (scFv) derived from an FMC63 monoclonal antibody. In some embodiments, the transmembrane domain is a CD28 transmembrane domain. In some embodiments, the intracellular signaling domain includes a 4-1BB co-stimulatory domain and a CD3ζ activation domain. In some embodiments, the CAR includes, in N-terminus to C-terminus, an FMC63 monoclonal antibody-derived single-chain variable fragment (scFv), an IgG4 hinge region, a 47-CD28 transmembrane domain, a 4-1BB (CD137) co-stimulatory domain, and a CD3ζ activation domain.

[0037] In some embodiments, the extracellular antigen-binding domain comprises the amino acid sequence shown in SEQ ID NO:43. In some embodiments, the transmembrane domain comprises the amino acid sequence shown in SEQ ID NO:8. In some embodiments, the 4-1BB co-stimulatory domain comprises the amino acid sequence shown in SEQ ID NO:12. In some embodiments, the CD3ζ signaling domain comprises the amino acid sequence shown in SEQ ID NO:13. In some embodiments, the CAR comprises the amino acid sequence shown in SEQ ID NO:59. In some embodiments, the given dose of autologous CD19-modified T cells express a non-functional truncated epidermal growth factor receptor (EGFRt).

[0038] In some embodiments, the method includes administering a lymphocyte clearance regimen of fludarabine and cyclophosphamide to the subject prior to administering the given dose of autologous CD19-targeted genetically modified T cells. In some embodiments, the subject has already received a lymphocyte clearance regimen of fludarabine and cyclophosphamide prior to administering the given dose of autologous CD19-targeted genetically modified T cells. In some embodiments, the lymphocyte clearance regimen includes fludarabine 30 g / m². 2 / day intravenous administration (IV) and cyclophosphamide 300g / m 2 / day IV, each lasting 3 days. In some embodiments, the lymphocyte clearance regimen is administered to the subject approximately 2 to approximately 7 days prior to the administration of the given dose of autologous CD19-targeted genetically modified T cells.

[0039] In some embodiments, the subject has administered acetaminophen before the administration of the given dose of autologous CD19-targeted genetically modified T cells. In some embodiments, the subject has administered acetaminophen between approximately 30 and 60 minutes prior to the administration of the given dose of autologous CD19-targeted genetically modified T cells. In some embodiments, the subject has administered approximately 650 mg of acetaminophen. In some embodiments, the acetaminophen is administered orally. In some embodiments, the acetaminophen is referred to as paracetamol.

[0040] In some embodiments, the subject has been administered an H1 antihistamine prior to the administration of the given dose of autologous CD19-targeted genetically modified T cells. In some embodiments, the subject has been administered an H1 antihistamine approximately 30 to 60 minutes prior to the administration of the given dose of autologous CD19-targeted genetically modified T cells. In some embodiments, the H1 antihistamine is diphenhydramine. In some embodiments, the subject has been administered diphenhydramine at a dose between approximately 25 mg and approximately 50 mg. In some embodiments, the H1 antihistamine is administered intravenously or orally. In some embodiments, the H1 antihistamine is administered intravenously. In some embodiments, the H1 antihistamine is administered orally.

[0041] In some embodiments, the subject's ECOG status is 0, 1, or 2. In some embodiments, the subject's ECOG status is 0. In some embodiments, the subject's ECOG status is 1. In some embodiments, the subject's ECOG status is 2. In some embodiments, the subject is not pregnant.

[0042] In some embodiments, the dose of autologous CD19-targeting genetically modified T cells is obtained from the subject via leukoablation. In some embodiments, the subject has been administered bridging therapy after leukoablation and before the administration of the dose of autologous CD19-targeting genetically modified T cells.

[0043] In some embodiments, the bridging therapy is chemotherapy or radiotherapy. In some embodiments, the bridging therapy is chemotherapy. In some embodiments, the bridging therapy is radiotherapy.

[0044] In some embodiments, the dose of autologous CD19-targeted genetically modified T cells is administered to the subject via inpatient administration. In some embodiments, the dose of autologous CD19-targeted genetically modified T cells is administered to the subject via outpatient administration.

[0045] This disclosure also provides CAR-positive CD4 + T cells and CAR-positive CD8 + T cells or CD4 cells containing CAR-positive cells + T cells and CAR-positive CD8 + The composition of engineered T cells is used to prepare a medicament for use in any method of treating LBCL. In some aspects, this disclosure also provides a dose of CAR-positive CD4+. + T cells and CAR-positive CD8 + The dose of engineered T cells or those containing CAR-positive CD4 + T cells and CAR-positive CD8 + The composition of engineered T cells is intended for use in any treatment of LBCL. Brief description of the attached figures

[0046] Figure 1A and Figure 1B This is a Kaplan-Meier plot showing the likelihood of event-free survival in patients with relapsed or refractory LBCL after first-line chemoimmunotherapy, treated with therapeutic CAR T-cell combination therapy (“CAR T”) or standard of care (SOC) therapy. Invention Details

[0047] Unless otherwise defined, all technical terms, annotations, and other technical and scientific terms or expressions used in this disclosure are intended to have the same meaning as commonly understood in relation to the claimed subject matter. In some cases, terms having a commonly understood meaning are defined in this disclosure for clarity and / or convenience of reference, and the inclusion of such definitions in this disclosure should not be construed as indicating a material difference from the commonly understood meaning.

[0048] All publications mentioned in this application, including patent documents, scientific articles, and databases, are incorporated herein by reference in their entirety, to the same extent that each individual publication is individually incorporated herein by reference. If any definition provided herein conflicts with or is inconsistent with any definition in the patents, applications, published applications, or other publications referenced herein, the definition provided herein shall prevail.

[0049] The chapter headings used in this publication are for organizational purposes only and should not be construed as limiting the subject matter described. 1. Methods and applications of cell therapy using genetically engineered cells

[0050] This disclosure provides methods and uses for engineered cells (e.g., T cells) and compositions thereof for treating a subject with a disease or condition that typically or includes large B-cell lymphoma (LBCL). In specific embodiments of any of the provided methods, the T cells are engineered with a chimeric antigen receptor (CAR) targeting CD19. In some aspects, the LBCL is selected from the group consisting of unspecified diffuse large B-cell lymphoma (DLBCL), high-grade B-cell lymphoma, primary mediastinal large B-cell lymphoma, and grade 3B follicular lymphoma. In some embodiments, the large B-cell lymphoma (LBCL) includes unspecified (NOS) diffuse large cell lymphoma (DLBCL). In some embodiments, the LBCL includes newly diagnosed lymphoma. In some embodiments, the high-grade B-cell lymphoma includes high-grade B-cell lymphoma having MYC and BCL2. In some embodiments, the high-grade B-cell lymphoma includes BCL6 rearrangements with DLBCL histology (double / triple hit lymphoma (DHL / THL)). In some embodiments, the LBCL includes T-cell / histiocytic abundant large B-cell lymphoma (THRBCL). In some aspects, the methods and uses provide for or achieve improved and / or more durable responses or efficacy and / or reduced risk of toxicity or other side effects, for example, in a specific treatment subject group, compared to certain alternative methods. In some embodiments, the methods are advantageous due to the administration of a specific number or relative number of engineered cells, the administration of a defined proportion of a specific type of cell, treatment of a specific patient population, such as a patient population with a specific risk profile, stage, and / or prior treatment history, and / or combinations thereof.

[0051] This disclosure also provides articles of manufacture and kits, for example, for use in the methods provided in this disclosure. In some embodiments, the articles of manufacture and kits also include instructions for use according to the methods provided in this disclosure.

[0052] In some embodiments, the method and use include administering to the subject cells in an adoptive cell therapy that express a genetically engineered (recombinant) cell surface receptor, typically a chimeric receptor that recognizes CD19, such as a chimeric antigen receptor (CAR). The cells are typically administered in a composition formulated for administration; the method generally involves administering to the subject one or more doses of the cells, the doses may include a specific number or relative number of cells or engineered cells, and / or a defined ratio or composition of two or more subtypes, such as CD4 versus CD8 T cells.

[0053] In some embodiments, the cells, populations, and compositions are administered to subjects with LBCL who have been treated, for example, with adoptive cell therapy (such as adoptive T-cell therapy). In some embodiments, the method involves treating a subject with LBCL with a dose of antigen receptor-expressing cells (e.g., CAR-expressing cells). In some aspects, the dose comprises CD4+ chimeric antigen receptor (CAR) cells that are positive for binding to CD19. + T cells and CD8+ expressing the CAR. + T cells, wherein the CAR-positive CD4 + T cells and the CAR-positive CD8 + T cells are CAR-positive live CD4+ cells at a ratio of approximately 1:1. + T cells and CAR-positive live CD8 + The proportion of T cells administered to the subject. In some aspects, the dose is 90 × 10⁻⁶. 6 Up to 110×10 6 One CAR-positive live T cell.

[0054] In some embodiments, the methods provided in this disclosure involve treating specific groups or subgroups of subjects, for example, subjects identified as having large B-cell lymphoma that is relapsed or refractory (R / R) to first-line chemoimmunotherapy. In some aspects, the subject has disease refractory to first-line chemoimmunotherapy. In some aspects, the subject has relapsed within 12 months of first-line chemoimmunotherapy. In some aspects, the subject has disease refractory to first-line chemoimmunotherapy and is ineligible for hematopoietic stem cell transplantation (HSCT). In some aspects, the subject has relapsed after first-line chemoimmunotherapy and is ineligible for hematopoietic stem cell transplantation (HSCT).

[0055] In some aspects, the subject has relapsed after first-line chemoimmunotherapy, and the relapse occurred after the subject achieved a complete response (CR) to first-line chemoimmunotherapy. In some aspects, the subject has relapsed after first-line chemoimmunotherapy, and the relapse occurred after the subject achieved a partial response (PR) to first-line chemoimmunotherapy. In some aspects, the subject is ineligible for HSCT due to comorbidities or age. In some aspects, the subject has relapsed within 12 months of first-line chemoimmunotherapy, and the relapse occurred after the subject achieved a complete response (CR) to first-line chemoimmunotherapy. In some aspects, the subject has relapsed within 12 months of first-line chemoimmunotherapy, and the relapse occurred after the subject achieved a partial response (PR) to first-line chemoimmunotherapy.

[0056] In some cases, the overall response rate (ORR; also referred to in some cases as the objective response rate) for the patient population targeted by the disease and / or therapy is less than 40%, and / or the complete response (CR; also referred to in some cases as complete remission) is less than 20%. In some embodiments, in chemotherapy-refractory LBCL (e.g., DLBCL), the ORR of the reference or available therapy or standard of care is about 26%, and the CR rate is about 8% (Crump et al. Outcomes in refractory aggressive diffuse large B-cell lymphoma (DLBCL): Results from the international SCHOLAR study. ASCO 2016 [Abstract 7516]). As found in this disclosure, the 1-year event-free survival probability of SOC is less than about 25%, while the 1-year event-free survival probability using the methods provided in this disclosure is about 45%. In some aspects, the methods, compositions, uses, and articles provided in this disclosure achieve improved and superior responses relative to available therapies. In some implementations, the improved or superior response is relative to the current standard of care (SOC). In some implementations, the current SOC for treating B-cell malignancies (such as LBCL) includes up to 3 cycles of chemotherapy-immunotherapy, followed by high-dose chemotherapy and autologous HSCT for patients achieving CR or PR. For example, in some implementations, the current SOC includes up to 3 cycles of rituximab, dexamethasone, cytarabine (AraC), and cisplatin (R-DHAP); rituximab, ifosfamide, carboplatin, and etoposide (R-ICE); or any one of rituximab, gemcitabine, dexamethasone, and cisplatin (R-GDP), followed by high-dose chemotherapy with carmustine, etoposide, cytarabine, and melphalan (BEAM) and hematopoietic stem cell transplantation (HSCT). (See, for example, Crump et al., J Clin Oncol. 2014; 32(31):3490-6; Gisselbrecht, et al., J Clin Oncol. 2010; 28(27):4184-90; van Imhoff et al., J Clin Oncol. 2017; 35(5):544-51).

[0057] Large B-cell lymphoma (LBCL) is the most common subtype of non-Hodgkin lymphoma (NHL). Approximately 60% of patients achieve a cure with first-line therapy; however, about 30% relapse, and about 10% are refractory to first-line treatment. Treatment options for patients with relapsed / refractory (R / R) disease, especially third-line or later (3L+) therapy, primarily include salvage chemotherapy (CT). Two chimeric antigen receptor (CAR) T-cell products and antibody-drug conjugates have been approved as third-line therapies. Based on systematic literature reviews (SLRs) of evidence regarding clinical outcomes in LBCL patients (including the novel therapies listed above), unmet medical needs in second-line and later (2L+) or 3L+ therapy for R / R LBCL have been identified.

[0058] Based on exemplary SLRs, 8,683 database records and additional sources were screened according to the Cochrane Manual of Systematic Reviews of Interventions and EU health technology assessment requirements, identifying 103 publications covering 78 independent studies. The evaluation identified randomized and non-randomized / observational studies in recurrent / recurrent (R / R) LBCL, including diffuse large B-cell lymphoma (DLBCL), grade 3B follicular lymphoma (FL3B), primary mediastinal large B-cell lymphoma (PMBCL), DLBCL transformed from indolent lymphoma, and R / R DLBCL with secondary central nervous system (SCNS) involvement. Data sources included EMBASE, MEDLINE, The Cochrane Library, and clinical conferences (ASCO, ESMO, EHA, ASH, ICML, AACR, and EORTC). The identified studies were characterized by treatment lines and R / R LBCL subtypes. OS, PFS, DOR, OR, and safety observed from the identified studies are described. Significant differences were found in disease subtypes, participant eligibility criteria, and follow-up duration among different studies.

[0059] Based on the exemplary SLR, survival outcomes were reported in 11 salvage CT and 2 CAR T-cell therapy studies in the 3L+ population. For salvage CT, the reported ORR ranged from 0% to 54%, while CR ranged from 5.6% to 31%. Median OS (mOS) ranged from 3 to 9 months, with one outlier study reporting an mOS of 20 months. Median PFS (mPFS) reported in the salvage CT studies ranged from 2 to 6 months. In CAR T-cell therapy, subjects treated with anti-CD19 CAR T-cell therapy (n=101) reported a CR rate of 58% with a median follow-up of 27.1 months, followed by a median DOR (mDOR) of 11.1 months. mPFS was 5.9 months, failing to reach mOS. At a median follow-up of 19.3 months, subjects treated with another anti-CD19 CAR T-cell therapy (n=115) achieved a CR of 40%, but failed to reach mDOR. The median overall survival (mOS) was 11.1 months for all patients who received infusions.

[0060] In the 2L+ transplant-eligible population (36 studies), the median overall survival (mOS) achieved by subjects receiving high-dose CT+HSCT ranged from 9 months to 5 years. In the ineligible population, 16 studies reported mOS ranging from 3 to 20 months. Studies involving mixed ineligible and ineligible populations (30 studies) reported mOS ranging from 1 to 17 months.

[0061] Several studies with limited sample sizes reported results for LBCL subtypes (such as PMBCL, SCNS lymphoma, DLBCL transformed from non-FL indolent lymphoma, and FL3B). In the 3L+ background, one study reported that median overall survival (mOS) was not achieved after a median of 6.6 months. In the 2L+ background, four studies reported median progression-free survival (mPFS) and median overall survival (mOS) ranging from 2–9 months and 10–16 months, respectively.

[0062] In studies evaluating the safety of rescue chemotherapy in relapsed / relapsed LBCL, neutropenia, leukopenia, thrombocytopenia, and infection were the most frequently reported adverse events (AEs), with neutropenia being the most frequently reported. In three studies reporting safety outcomes for CAR T-cell therapy, data showed that hematological AEs (possibly related to lymphocyte depletion CT), cytokine release syndrome, and neurotoxicity were the most frequently reported.

[0063] According to exemplary studies, less than 50% of patients with relapsed / refractory large B-cell lymphoma (LBCL) respond to third-line or subsequent treatment (Van Den Neste et al. Bone Marrow Transplant. 2016; 51:51-7; Gonzalez-Barca E et al. Bone Marrow Transplant 2019). High-dose chemotherapy combined with autologous hematopoietic stem cell transplantation (HSCT) remains the standard treatment for first-time relapse in eligible transplant recipients with chemosensitivity disease (National Comprehensive Cancer Network Clinical Practice Guidelines in Oncology. March 6, 2019). However, most patients are still not cured with this approach (Van Den Nesteet et al. Bone Marrow Transplant. 2016; 51:51-7; Gonzalez-Barca E et al. Bone Marrow Transplant 2019, National Comprehensive Cancer Network Clinical Practice Guidelines in Oncology. March 6, 2019, Gisselbrecht C et al. J Clin Oncol. 2010; 28:4184-90). In some studies, patients with chemotherapy-refractory disease have worse outcomes, with a complete response (CR) rate of 7% and an overall survival (OS) of 6 months (Crump et al. Blood. 2017; 130:1800-8). Adverse outcomes were associated with advanced age, central nervous system (CNS) involvement (Thanarajasingam et al. Br J Haematol. 2018; 183:149-52; Nabhan et al. J Clin Oncol. 2018; 36:7545) and comorbidities (Pfreundschuh Blood. 2010; 116:5103-10).

[0064] Certain CD19-targeting CAR-T cell therapies are available for the treatment of B-cell lymphoma, including axi-cel and tisagenlecleucel. In a demonstrative study, the complete remission (CR) rate (per investigator) achieved by subjects treated with axi-cel was 54%, with 40% achieving durable remission (median follow-up, 15.4 months) (Neelapu et al. N Engl Med. 2017. 377; 2531-44). The majority of subjects experienced CRS (93%) and nocturnal emission (NE) (64%), with median time to onset of 2 days and 5 days, respectively. The incidence of grade ≥3 CRS (Lee classification criteria (Lee et al. Blood. 2014; 124:188-95)) and NE was 13% and 28%, respectively, and 43% received tocilizumab treatment (27% received corticosteroids). In another exemplary study, approximately one-third of patients receiving tesalexadecimal maintained durable remission by year 1 (Schuster et al. N Engl J Med. 2019. 380: 45-56). The majority of subjects (58%) experienced CRS, while 21% experienced NE. 22% and 12% of patients reported grade ≥3 CRS (Pennsylvania classification, Porter et al. J Hematol Oncol. 2018; 11: 35) and NE, respectively (Schuster et al. N Engl J Med. 2019. 380: 45-56). Furthermore, these therapies did not include treatment for certain high-risk patients, including those with PMBCL, DLBCL transformed from other indolent lymphomas other than FL and FL3B, and patients with certain high-risk characteristics such as secondary CNS lymphoma, moderate renal / cardiac comorbidities, and those requiring bridging therapy.

[0065] SLR and an investigation of existing evidence indicate a significant and highly unmet need for additional treatment options that provide favorable benefit / risk and durable responses, a need that current therapies fail to meet in patients with 2L+ and 3L+ LBCL. Furthermore, data on rarer subtypes of LBCL are also limited. These findings reveal a significant treatment gap in R / RLBCL that must be addressed, and the necessity to improve existing treatments. This article provides implementation plans that can meet this need.

[0066] In some embodiments, the methods, uses, and articles relate to or are used to treat subjects who have a specific type of disease, diagnostic criteria, prior treatment, and / or response to prior treatment. In some embodiments, the methods relate to treating subjects who have relapsed after remission following one or more prior therapies or who have become refractory to one or more prior therapies, or who have relapsed or are refractory (R / R) to one or more prior therapies (such as one or more standard therapies). In some embodiments, the methods relate to treating subjects with LBCL that has relapsed or is refractory to first-line chemoimmunotherapy. In some embodiments, the subject has LBCL that has relapsed within 12 months of first-line chemoimmunotherapy. In some embodiments, the subject is ineligible for HSCT due to comorbidities or age.

[0067] In some embodiments, the subject has a B-cell malignancy, such as large B-cell lymphoma, e.g., relapsed / refractory (R / R) large B-cell lymphoma. In some embodiments, the subject has a large B-cell lymphoma, such as diffuse large B-cell lymphoma (DLBCL) (e.g., unspecified DLBCL (NOS; newly developed or from an indolent transformation) or other DLBCL). In some embodiments, the subject has an unspecified DLBCL. In some embodiments, the subject has an unspecified DLBCL (including DLBCL arising from indolent lymphoma). In some embodiments, the subject has an unspecified DLBCL (including DLBCL arising from newly developed lymphoma). In some embodiments, the subject has high-grade B-cell lymphoma. In some embodiments, the subject has high-grade B-cell lymphoma with MYC and BCL2. In some embodiments, the subject has high-grade B-cell lymphoma with BCL6 rearrangement in DLBCL histology (double / triple hit lymphoma (DHL / THL)). In some embodiments, the subject has primary mediastinal B-cell lymphoma (PMBCL). In some embodiments, the subject has grade 3B follicular lymphoma (FL3B). In some embodiments, the subject has LBCL, including T-cell / histiocytic abundant large B-cell lymphoma (THRBCL).

[0068] In certain embodiments, the method provided in this disclosure is based on the administration of a CD19-targeted CAR T-cell therapy, wherein the CAR contains a CD19-targeted scFv antigen-binding domain (e.g., from FMC63). The CAR also includes an intracellular signaling domain containing a signaling domain from CD3ζ, and incorporates a 4-1BB co-stimulatory domain, which is associated with lower CRS and NE incidence compared to constructs with CD28 (Lu et al. J Clin Oncol. 2018; 36:3041). In some embodiments, the method provided in this disclosure includes the separate transduction and amplification of CD8 in vitro. + and CD4 + T cell subsets were administered at an equal (approximately 1:1) targeted dose. In some implementations, the variability in the total dose and CD8+CAR+T cell dose administered was low, and these two parameters were associated with increased toxicity in previous studies (Neelapu et al. N Engl Med. 2017. 377; 2531-44; Turtle et al. Sci Transl Med. 2016; 8:355ra116; Hay et al. Blood. 2017; 130:2295-306).

[0069] In specific implementations, the provided methods can be used to treat specific LBCL subtypes or high-risk groups, such as elderly patients and patients with comorbidities in which current treatment options remain limited. For example, existing CAR T-cell therapies are associated with severe CAR T-cell-related toxicities, including cytokine release syndrome (CRS) and neurological events (NE), which may limit administration to specialized treatment centers (Yescarta Risk Assessment and Mitigation Strategy (REMS), Gilead Pharma, September 10, 2019; Kymriah Risk Assessment and Mitigation Strategy (REMS), Novartis, September 10, 2019) and affect use in refractory patients. CAR T-cell therapies with a favorable benefit / risk profile, particularly those with high efficacy and low incidence of severe CRS and NE, can be more broadly included in subject subgroups and administered / monitored in outpatient settings.

[0070] In certain embodiments, the provided method produces favorable results in subjects with LBCL, including some subjects previously excluded by other therapies, including other anti-CD19 CAR-T cell therapies. LBCL subjects in the subject group shown in this disclosure have produced durable responses to treatment with CD19-targeted CAR T-cells, including responses associated with increased in vivo expansion of CAR T-cells, and the CAR T-cells persisting long after infusion. In some embodiments, the provided method shows favorable results in patients with aggressive high-risk disease who have received extensive pretreatment, including chemotherapy-resistant patients or patients requiring immediate treatment with bridging therapy for disease control. The observations of this disclosure support treatment of patients with aggressive high-risk disease with CD19-targeted CAR T-cell therapy according to the provided method. For example, patients with PMBCL, DLBCL transformed from indolent lymphomas other than FL and FL3B, and patients with certain high-risk characteristics, such as secondary CNS lymphoma, moderate renal / cardiac comorbidities, and patients requiring bridging therapy, can be treated according to the provided method. In some embodiments, the provided method can be used to treat subjects who have received extensive pretreatment (e.g., using two, three, or more prior therapies to treat the disease). Subgroups treatable by the provided method may also include older subgroups aged 65 years or older, including subgroups >70 years and >75 years. Observations in this disclosure show that event-free survival (EFS), progression-free survival (PFS), objective response rate (ORR), complete response (CR), and duration of response (DOR), including durable responses, were observed in all subgroups, with a low incidence of severe CRS and nocturnal emission (NE).

[0071] In some embodiments, less than half of all subjects treated with the methods provided in this disclosure develop CRS or NE. In some embodiments, lower overall incidence and severity of CRS and NE, as well as later onset, support outpatient administration / monitoring of selected subjects. In some embodiments, safety and efficacy outcomes in subjects receiving the CAR T-cell composition in an outpatient setting are similar to those in the full-scale treated population. In some embodiments, chimeric antigen receptor (CAR) T-cell therapy is typically limited to inpatient treatment at university medical centers; however, the majority of patients with relapsed / refractory (R / R) diffuse large B-cell lymphoma (DLBCL) in the United States are treated at non-university medical centers where outpatient cancer therapy is commonly provided. In some embodiments of any of the methods provided in this disclosure, the infusion and administration of CAR T-cell therapy in an outpatient setting enables wider use of CAR T-cell therapy in community / non-university centers and improves accessibility.

[0072] In some embodiments, treatment using any of the methods provided in this disclosure results in higher durable EFS, PFS, and CR rates, and lower incidence of severe CRS and NE, in subjects with relapsed / refractory LBCL in this study. In some embodiments, clinically meaningful activity has been observed in subgroups of subjects with unmet medical needs, including uncommon LBCL histological subtypes and subgroups with poor prognostic characteristics. In some embodiments, lower incidence of severe CRS and NE, as well as later onset, are achieved with outpatient administration / monitoring. In some embodiments, the unique risk / benefit characteristics of any method provided in this disclosure may enable greater participation from a wider range of patients and potential treatment sites.

[0073] In some implementations, the method involves treating subjects with an Eastern Cooperative Oncology Group (ECOG) performance status (ECOG) of 0-1 or 0-2. In some implementations, the method can treat a poorly prognostic population of DLBCL patients or subjects who typically do not respond well to therapy or a specific reference therapy, such as those with one or more, such as two or three chromosomal translocations (e.g., so-called “double-hit” or “triple-hit” lymphomas; translocation of the MYC / 8q24 locus, typically associated with the t(14;18)(q32;q21)bcl-2 gene or / and the BCL6 / 3q27 chromosomal translocation; MYC / 8q24 locus translocation, typically associated with the t(14;18)(q32;q21)bcl-2 gene or / and the BCL6 / 3q27 chromosomal translocation; see, for example, Xu et al. (2013) Int J Clin Exp Pathol. 6(4):788–794), and / or those with relapse, such as relapse within 12 months of administration of autologous stem cell transplantation (ASCT), and / or those considered refractory to chemotherapy.

[0074] In some aspects, the provided implementation methods are based on the observation that, compared to certain available cell therapy approaches, the provided methods can achieve high response rates and high durability without increasing the risk of toxicity. In some implementation methods, the provided methods can prolong the durability of adoptive cells used in cell therapy and / or reduce the incidence of toxicity in subjects. In some implementation methods, the methods can be used to select subjects who are likely or more likely to respond to cell therapy for treatment, and / or determine appropriate dosage or administration regimens to obtain higher response rates and / or more durable responses while minimizing the risk of toxicity. The provided implementation methods and such methods can provide a basis for rational strategies that promote the safe and effective clinical application of adoptive cell therapies, such as CAR-T cell therapy.

[0075] In some respects, the subject has LBCL that is ineligible for transplantation (TNE), for example, the subject is ineligible for high-dose chemotherapy and hematopoietic stem cell transplantation (HSCT). In some respects, the subject is ineligible for HSCT due to comorbidities or age. Therefore, in some embodiments, the subject has TNE-relapsed / refractory (R / R) large B-cell NHL. In some respects, patients with relapsed or refractory LBCL who have failed first-line therapy with immunochemotherapy and are ineligible for high-dose chemotherapy and HSCT have a poor prognosis. In some respects, treatment options available to these subjects include platinum / gemcitabine or bendamustine-based treatments in combination with rituximab, with or without radiation therapy. However, in some respects, the long-term outcomes of available treatments remain poor due to the lack of curative options. The provided approach offers an improved treatment for such subjects.

[0076] In some embodiments, the antigen receptor (such as CAR) specifically binds to a target antigen associated with LBCL. In some embodiments, the antigen associated with the disease or disorder is CD19.

[0077] In some embodiments, the method includes administering the cells or a composition containing the cells to a subject, the subject being an adult. In some embodiments, the subject is 30, 40, 50, 60, or 70 years of age or older. In some embodiments, the subject is over 60 years of age. In some embodiments, the subject is over 70 years of age. In some embodiments, the subject is over 75 years of age. In some embodiments, the subject is not more than 75 years of age.

[0078] In some embodiments, the subject has received treatment with a therapy or agent targeting the disease or condition (e.g., large B-cell lymphoma) prior to administration of cells expressing the recombinant receptor. In some embodiments, the subject has previously received hematopoietic stem cell transplantation (HSCT), such as allogeneic HSCT or autologous HSCT. In some embodiments, the subject has a poor prognosis after standard therapy and / or has failed one or more prior therapies. In some embodiments, the subject has relapsed or is refractory to first-line chemoimmunotherapy. In some embodiments, the subject has relapsed after first-line chemoimmunotherapy. In some embodiments, the subject has relapsed within 12 months of receiving first-line chemoimmunotherapy. In some embodiments, the subject is refractory to first-line chemoimmunotherapy. In some embodiments, the first-line chemoimmunotherapy is rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisone (R-CHOP). In some embodiments, R-CHOP is administered to the subject in 14-day cycles (R-CHOP14). In some implementations, R-CHOP is administered to the subjects in 21-day cycles (R-CHOP21). In some implementations, first-line chemoimmunotherapy is rituximab, doxorubicin, cyclophosphamide, vincristine, bleomycin, and prednisone (R-ACVBP). In some implementations, first-line chemoimmunotherapy is dose-adjusted etoposide, prednisone, vincristine, cyclophosphamide, doxorubicin, and rituximab (DA-EPOCH-R).

[0079] In some embodiments, the first-line chemoimmunotherapy is rituximab, dexamethasone, cytarabine, and cisplatin (R-DHAP). In some embodiments, the first-line chemoimmunotherapy is rituximab, ifosfamide, carboplatin, and etoposide (R-ICE). In some embodiments, the first-line chemoimmunotherapy is rituximab, gemcitabine, dexamethasone, and cisplatin (R-GDP).

[0080] In some embodiments, in addition to lymph node dissection therapy and / or a dose of cells expressing antigen receptors, the subject has received or has previously received at least or about one, two, three, or four other therapies for the treatment of a disease or disorder, such as large B-cell lymphoma. In some embodiments, the subject has received or has previously received therapies including anthracyclines, CD20-targeting drugs, and / or ibrutinib.

[0081] In some embodiments, the subject has previously received chemotherapy or radiation therapy. In some aspects, the subject is refractory or unresponsive to other therapies or treatments. In some embodiments, the subject suffers from a persistent or relapsing disease, for example, following treatment with another therapy or intervention, including chemotherapy or radiation therapy.

[0082] In some embodiments, the subject is eligible for transplantation, such as for hematopoietic stem cell transplantation (HSCT), like allogeneic HSCT. In some embodiments, the subject is eligible for transplantation, such as for hematopoietic stem cell transplantation (HSCT), like autologous HSCT. In some such embodiments, although the subject is eligible, the subject has not previously received a transplant, even if the subject has received the engineered cells (such as CAR-T cells) provided in this disclosure or a composition containing said cells, prior to administration to the subject.

[0083] In some embodiments, the subject is ineligible for HSCT due to comorbidities or age. In some embodiments, the subject is ineligible for HSCT due to comorbidities. In some embodiments, the comorbidities include impaired lung function. In some embodiments, the comorbidities include an adjusted pulmonary carbon monoxide diffusing capacity (DLCO) of about 60% or less. In some embodiments, the comorbidities include impaired cardiac function. In some embodiments, the comorbidities include a left ventricular ejection fraction (LVEF) of less than about 50%. In some embodiments, the comorbidities include impaired renal function. In some embodiments, the comorbidities include a calculated creatinine clearance of less than about 60 mL / min. In some embodiments, the comorbidities include impaired liver function. In some embodiments, the comorbidities include aspartate aminotransferase (AST) levels approximately twice the upper limit of normal (ULN). In some embodiments, the comorbidities include alanine aminotransferase (ALT) levels approximately twice the upper limit of normal (ULN). In some embodiments, the comorbidities include an Eastern Cooperative Oncology Group (ECOG) performance status of 2.

[0084] In some embodiments, the subject is ineligible for HSCT due to age. In some embodiments, the subject is an adult. In some embodiments, the subject is at least 18 years old. In some embodiments, the subject is ineligible for HSCT because they are 70 years of age or older.

[0085] In some embodiments, the subject is ineligible for transplantation (also known as transplant ineligible, TNE), such as ineligible for hematopoietic stem cell transplantation (HSCT), such as allogeneic HSCT. In some embodiments, according to the embodiments provided in this disclosure, the subject is administered engineered cells (such as CAR-T cells) or a composition containing said cells.

[0086] In some embodiments, the subject is identified or has been identified as ineligible for high-dose chemotherapy at or immediately before the administration of the stated dose of cells. In any of these embodiments, the subject is identified or has been identified as ineligible for hematopoietic stem cell transplantation (HSCT) at or immediately before the administration of the stated dose of cells. In some embodiments, the subject is identified or has been identified as ineligible for both high-dose chemotherapy and hematopoietic stem cell transplantation (HSCT) at or immediately before the administration of the stated dose of cells.

[0087] In some embodiments, the subject has relapsed / refractory NHL and was identified or has been identified as ineligible for high-dose chemotherapy and hematopoietic stem cell transplantation (HSCT) at the time of or immediately prior to administration of the dose of cells, and the subject relapsed or became refractory after remission following a previous treatment of the disease or condition other than another dose of CAR-expressing cells.

[0088] In some embodiments, the subject is identified or has been identified as 70 years of age or older at or before administration of the stated dose of cells. In some embodiments, the subject is identified or has been identified as having an ECOG performance status of 2. In some embodiments, the subject is identified or has been identified as having impaired lung function, optionally with a pulmonary carbon monoxide diffusion capacity (DLCO) of 60% or less. In some embodiments, the subject is identified or has been identified as having impaired cardiac function, optionally with a left ventricular ejection fraction (LVEF) of less than or about 50%. In some embodiments, the subject is identified or has been identified as having impaired renal function, optionally with a calculated creatinine clearance of less than 60 mL / min or less than about 60 mL / min. In some embodiments, the subject is identified or has been identified as having impaired liver function, optionally with aspartate aminotransferase (AST) and alanine aminotransferase (ALT) levels more than twice the upper limit of normal (ULN) or about twice the upper limit of normal (ULN).

[0089] In some implementations, the subject has lymphoma involving or related to the central nervous system (CNS), and the subject has previously been treated with an anticonvulsant, such as levetiracetam.

[0090] In some embodiments, the method includes administering cells to a subject selected or identified as having high-risk large B-cell lymphoma or high-risk NHL. In some embodiments, the subject exhibits one or more cytogenetic abnormalities, such as those associated with B-cell malignancies, such as high-risk B-cell lymphoma or high-risk NHL. In some embodiments, the subject has high-grade B-cell lymphoma with MYC and BCL2. In some embodiments, the subject has high-grade B-cell lymphoma with BCL6 rearrangement in DLBCL histology (double / triple hit lymphoma (DHL / THL)). In some embodiments, the subject is selected or identified based on disease or condition, characterized or identified as: aggressive NHL, diffuse large B-cell lymphoma (DLBCL), primary mediastinal large B-cell lymphoma (PMBCL), T-cell / histiocytic abundant large B-cell lymphoma (TCHRBCL), Burkitt's lymphoma (BL), mantle cell lymphoma (MCL), and / or follicular lymphoma (FL). In certain embodiments, the subjects treated using the methods provided in this disclosure include subjects with aggressive large B-cell lymphoma or aggressive NHL, particularly diffuse large B-cell lymphoma (DLBCL), unspecified (NOS; from new onset or from indolent transformation), primary mediastinal B-cell lymphoma (PMBCL), or grade 3B follicular lymphoma (FL3B). In some embodiments, the subjects have follicular lymphoma (FL). In certain embodiments, the subjects treated using the methods provided in this disclosure include subjects with DLBCL transformed from follicular lymphoma (FL) or other indolent lymphomas. In certain embodiments, the subjects treated using the methods provided in this disclosure include subjects with DLBCL derived from indolent histological transformation (tDLBCL). In some embodiments, the subjects have DLBCL transformed from marginal zone lymphoma (MZL) or chronic lymphocytic leukemia (CLL) (such as Richter's lymphoma). In some implementations, the subject with CLL conversion may present with Richter's syndrome (RS), defined as the conversion of CLL to an aggressive lymphoma, most commonly diffuse large B-cell lymphoma (DLBCL) (see Parikh et al., Blood 2014 123:1647-1657).

[0091] In some embodiments, the subject has mantle cell lymphoma (MCL). In some embodiments, the MCL is characterized by the chromosomal translocation t(11:14)(q13;132) (Vose JM, et al. Am J Hematol. 2017.; 92:806-813). In some embodiments, the subject has adverse risk factors, including TP53 mutation and / or a high proliferation index (Ki67 > 30%). In some embodiments, the subject has adverse risk factors, including prior bone marrow involvement, prior pleural effusion, and / or CNS disease. In some embodiments, the subject has adverse risk factors including MCL variants. In some embodiments, the subject has an embryoid variant of MCL. In some embodiments, the subject has a pleomorphic variant of MCL. In some embodiments, the subject has mantle cell lymphoma (MCL) that has failed after ≥1 prior therapy regimen (relapsed / refractory, R / R). In some embodiments, the subject has mantle cell lymphoma (MCL) that has failed after one prior therapy regimen (relapsed / refractory, R / R). In some embodiments, the subject has mantle cell lymphoma (MCL) that has failed after 1, 2, 3, 4, 5, 6, or 7 prior therapy regimens (relapsed / refractory, R / R). In some embodiments, the subject has previously received ibrutinib and / or veneclade. In some embodiments, the subject has MCL that has relapsed after treatment with ibrutinib and / or veneclade. In some embodiments, the subject has received one or more prior immunochemotherapy regimens containing anthracyclines and CD20-targeting agents (such as R-CHOP).

[0092] In some embodiments, the subject has received one or more prior therapy routes containing rituximab, dexamethasone, cytarabine, and cisplatin (R-DHAP). In some embodiments, the subject has received one or more prior therapy routes containing rituximab, ifosfamide, carboplatin, and etoposide (R-ICE). In some embodiments, the subject has received one or more prior therapy routes containing rituximab, gemcitabine, dexamethasone, and cisplatin (R-GDP).

[0093] In some embodiments, the subject has received prior hematopoietic stem cell therapy (HSCT), such as allogeneic HSCT or autologous HSCT. In some embodiments, the subject has been diagnosed with MCLR / R disease expressing cyclin D1.

[0094] In some embodiments, the subject is being or has been treated with anthracyclines and one or more CD20-targeting agents at or before administration of a dose of cells. In some embodiments, the one or more CD20-targeting agents comprise rituximab. In some embodiments, the one or more CD20-targeting agents comprise R-CHOP (rituximab, cyclophosphamide, doxorubicin hydrochloride (hydroxydaunorubicin), vincristine sulfate (Acopine), and prednisone).

[0095] In some embodiments, the subject's performance status is poor. In some aspects, the treatment-seeking population includes subjects with an Eastern Cooperative Oncology Group Performance Status (ECOG) score of 0-2. In other aspects of any embodiment, the treatment-seeking subjects include subjects with an ECOG score of 0-1 or excluding those with an ECOG score of 2. In some aspects of any embodiment, the treatment-seeking subject has failed one prior therapy. In some aspects of any embodiment, the treatment-seeking subject has failed two or more prior therapies. In some embodiments, the subject does not have DLBCL transformed from marginal zone lymphoma (MZL) or chronic lymphocytic leukemia (CLL) (such as Richter's lymphoma). In some embodiments, the subject has characteristics corresponding to poor overall survival. In some embodiments, the subject has never achieved a complete response (CR), has never received an autologous stem cell transplant (ASCT), is refractory to one or more second-line therapies, has primary refractory disease, and / or has an ECOG performance status score of 2 or an ECOG score between 0 and 1. In some implementations, the subject is identified as, or has been identified as, having an ECOG performance status of 0 or 1.

[0096] In some embodiments, the subjects to be treated include a group of subjects with diffuse large B-cell lymphoma (DLBCL), new-onset lymphoma, or lymphoma transformed from indolent lymphoma (not specifically designated, NOS), primary mediastinal large B-cell lymphoma (PMBCL), and grade 3b follicular lymphoma (FL3B) who have failed two lines of therapy, and whose ECOG score is 0-2, and who may optionally have previously received allogeneic stem cell transplantation (SCT). In some embodiments, the subjects to be treated have follicular lymphoma (FL). In some embodiments, the subjects were identified or have been identified as having double / triple hit lymphoma at or before the administration of the dose of cells. In some embodiments, the subjects were identified or have been identified as having chemorefractory lymphoma, optionally chemorefractory DLBCL. In some embodiments, the subjects did not achieve complete remission (CR) in response to prior therapy. In some implementations, the subject relapses within one year or less after receiving an autologous stem cell transplant (ASCT).

[0097] In some implementations, the subjects to be treated include a group of subjects with diffuse large B-cell lymphoma (DLBCL), new-onset lymphoma or lymphoma transformed from indolent lymphoma (unspecified, NOS), primary mediastinal large B-cell lymphoma (PMBCL), and grade 3b follicular lymphoma (FL3B) after failure of first-line therapy.

[0098] In some aspects, this disclosure provides compositions, methods, and uses for administering defined cell therapy compositions at specific doses, which are associated with high response rates and / or high duration of response and low levels and / or low incidence of toxicity. In some embodiments, the administered composition or dose is a constant and / or fixed dose of cells and / or one or more cells having a specific phenotype, such as a precise constant dose, for example, a specific number of such cells or a number within a specific range and / or degree of variability or variance compared to a target number. In some embodiments, the administered composition or dose comprises a defined proportion of CD4. + and CD8 + Cells (e.g., CD4 in a 1:1 ratio) + :CD8 + CAR + T cells) and / or a proportion that is within a certain degree of variability compared to this proportion, for example, not exceeding + 10%, if not exceeding + 8%, for example, variability or variance not exceeding +10%, such as not exceeding + 8%. In some implementations, CD4 + and CD8+ Cells are individually formulated and administered. In some embodiments, administered cells exhibit consistent activity and / or function, such as cytokine production, apoptosis, and / or expansion. In some embodiments, the provided compositions exhibit highly consistent and defined activity with low variability between cells, e.g., low variability within the composition or between formulations in terms of cell number, cell function, and / or cell activity. In some embodiments, the consistency of said activity and / or function, such as low variability between formulations of the composition, can improve efficacy and / or safety. In some embodiments, administration of the defined compositions results in low product variability and low toxicity, such as low CRS or neurotoxicity, compared to administration of highly heterogeneous cell compositions. In some embodiments, the defined, consistent compositions also exhibit consistent cell expansion. This consistency aids in dose determination, therapeutic window assessment, dose-response evaluation, and identification of subject factors that may be related to safety or toxicity outcomes.

[0099] In some implementations, a durable response rate greater than 60% is achieved at 6 months in a cohort of subjects receiving a single infusion at a specific dose level. In some implementations, subjects in certain cohorts may achieve an overall response rate (ORR, sometimes also referred to as objective response rate) greater than 80%, a complete response rate (CR) greater than 60%, and / or a high durable CR rate at 6 months. In some implementations, subjects receiving the defined dose show improved safety outcomes, e.g., more than two-thirds of subjects do not experience any CRS or NT. In some respects, the incidence of serious CRS or serious NT is low. In some implementations, higher exposures (such as C) observed at the defined dose are observed. max and AUC 0-28 This is not associated with an increase in toxicity (such as CRS or NT). In some embodiments, specific factors of the subject (such as certain biomarkers) can be used to predict the risk of toxicity. In some embodiments, the provided implementation methods can be used to achieve high response rates and low toxicity risk.

[0100] In some embodiments, subjects treated with the provided compositions, articles, kits, methods, and uses may receive an agent (such as tocilizumab and / or dexamethasone) before or after administration of the cell therapy to reduce, treat, or prevent toxicity, not exceeding 25%, 20%, 15%, 10%, or 5%. In some embodiments, the subjects may not receive any prophylactic treatment before receiving engineered cells (such as CAR T cells).

[0101] In some implementations, the provided implementation offers advantages, such as allowing cell therapy administration on an outpatient basis. CAR T-cell therapy is typically administered in an inpatient setting, such as at a university medical center. However, many subjects with R / R diffuse large B-cell lymphoma are treated at medical centers that administer cancer therapy on an outpatient basis. In some respects, infusion and administration of CAR T-cell therapy in an outpatient setting can improve the use of such therapy, including broader outpatient treatment utilization in community / non-university centers. In some implementations, the administration of cell doses and / or lymph node dissection therapy is performed in a non-tertiary care center. In some implementations, the administration of said cell therapy, such as the T-cell dose administered according to the provided implementation, can be performed on an outpatient basis or without requiring the subject to be admitted, for example, if admission requires an overnight stay. In some implementations, such outpatient administration can increase accessibility, reduce costs, while maintaining high durable response rates and low toxicity. In some respects, outpatient treatment is advantageous for patients who have immunocompromised due to prior treatment (such as after lymph node dissection) and who face greater exposure risks in a hospitalized or inpatient setting. In some respects, outpatient treatment also expands treatment accessibility by increasing treatment options for subjects who may be unable to travel to inpatient settings, hospital environments, or transplant centers. In some implementations, the subjects are monitored in an outpatient setting after administration of a dose of cells, optionally via telephone contact and / or by a healthcare professional.

[0102] In some embodiments, the subjects receiving outpatient treatment using the provided compositions, articles, kits, methods, and uses maintain outpatient treatment for at least 3 days, or a certain proportion of the subjects, such as at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, or at least 95%, maintain outpatient treatment for at least 3 days. In some aspects, the subjects maintain outpatient treatment for at least 4, 5, 6, 7, 8 days, or longer. In some embodiments, the length of hospital stay for subjects treated using the provided compositions, articles, kits, methods, and uses is reduced, for example, by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, or at least 40%, compared to subjects treated using other compositions, articles, kits, methods, and uses.

[0103] In some embodiments, the methods, cells, and compositions can provide high durable response rates for subjects with different patient characteristics and / or tumor burdens. In some embodiments, the methods, cells, and compositions can provide high durable response rates for high-risk patients with poor prognosis while reducing the risk of adverse reactions or toxicity. In some embodiments, the methods and uses provide or achieve higher response rates and / or more durable responses or efficacy and / or reduced risk of toxicity or other side effects associated with cell therapy, such as neurotoxicity (NT) or cytokine release syndrome (CRS). In some aspects, the observations provided indicate a low incidence of severe NT (sNT) or severe CRS (sCRS) and a high proportion of patients without any toxicity (such as NT or CRS).

[0104] In some embodiments, at least 35%, at least 40%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, or at least 75% or more of the subjects treated according to the provided method and / or using the provided product or composition achieve a complete response (CR). In some embodiments, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of the subjects treated according to the provided method and / or using the provided product or composition achieve an objective response (OR). In some embodiments, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or more of the subjects treated according to the provided method and / or using the provided product or composition achieve CR or OR within one month, two months, or three months.

[0105] In some embodiments, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or more of the subjects treated according to the provided method and / or using the provided products or compositions maintain a response, such as a complete response (CR) or an adverse event (OR), for 3, 4, 5, 6, or longer periods after the initiation of cell therapy. In some embodiments, this response, such as CR or OR, lasts for at least 3, 4, 5, 6, 7, 8, or 9 months, such as in at least or at least about 60%, at least 70%, at least 80%, at least 90%, at least 95% or more of the subjects treated according to the provided method. In some embodiments, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or more of the subjects treated according to the provided method and / or using the provided products or compositions, or subjects who achieve CR at 1 month or 3 months, survive or remain progression-free for more than or more than about 3, 4, 5, 6, 7, 8, or 9 months.

[0106] In some embodiments, the responses observed in subjects treated according to the provided methods and / or the provided articles or compositions are associated with, or result in, a low risk of toxicity or a low risk of serious toxicity in the majority of treated subjects. In some embodiments, greater than or equal to about 30%, 35%, 40%, 50%, 55%, 60%, or more of the subjects treated according to the provided methods and / or using the provided articles or compositions do not exhibit any grade of CRS or any grade of neurotoxicity (NT). In some embodiments, greater than or equal to about 50%, 60%, 70%, 80%, or more of the subjects treated according to the provided methods and / or using the provided articles or compositions do not exhibit serious CRS or grade 3 or higher CRS. In some embodiments, greater than or equal to about 50%, 60%, 70%, 80%, or more of the subjects treated according to the provided methods and / or using the provided articles or compositions do not exhibit serious neurotoxicity or grade 3 or higher neurotoxicity, such as grade 4 or 5 neurotoxicity.

[0107] In some embodiments, at least or at least about 45%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of subjects treated according to the provided method and / or using the provided product or composition did not exhibit early-onset CRS or neurotoxicity, and / or did not develop CRS within 1, 2, 3, or 4 days after initiation of administration. In some embodiments, at least or at least about 45%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of subjects treated according to the provided method and / or using the provided product or composition did not develop neurotoxicity within 3, 4, 5, 6, or 7 days after initiation of administration. In some aspects, among the subjects treated according to the method and / or using the provided product or composition, the median time to onset of neurotoxicity is at or after the median peak or median time to remission of CRS in the subjects treated according to the method. In some cases, the median onset of neurotoxicity in subjects treated according to the method was greater than or greater than about 8, 9, 10 or 11 days.

[0108] In some implementations, compared to an exact, constant, or fixed amount, when applying from or from about 5 x 10 7 to or to approximately 1.5 x 10 8 , such as from or from about 5x10 7 to or to approximately 1x10 8 Total recombinant receptor-expressing T cells (e.g., CAR+ T cells), administered in a defined proportion as described in this disclosure, including CD4+ + and CD8 +Such results can be observed with T cell doses, including T cells, at a ratio of 1:1 or approximately, and / or with precise, constant, or fixed amounts of CAR. + T cells, or a specific type of CAR in a precise, constant, or fixed number. + T cells such as CD4 + CAR + T cells and / or CD8 + CAR + T cells, and / or any number of such cells within a specified variance range, such as not exceeding + or - (positive or negative, expressed as ± in some cases), 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15%, can be observed to produce such results. In some embodiments, this constant or fixed number of cells is or is approximately 2.5 x 10⁻⁶. 7 5×10 7 10x10 7 15x10 7 Or 20x10 7 For example, total CAR + T cells or CD8 + and / or CD4 + CAR + T cells. In some embodiments, the number of cells in the dose includes 5 x 102 7 CD4 + CAR + T cells (in some cases 2.5 x 10) 7 CD4 + CAR + T cells and 2.5x10 7 CD8 + CAR + T cells) or are composed of or substantially composed of them; in some embodiments, they include 10 × 10 7 CAR + T cells (in some cases 5x10) 7 CD4 + CAR + T cells and 5x10 7 CD8 + CAR + T cells) or are composed of or substantially composed of them. In some respects, the dose is 90 to 110 × 10⁻⁶. 6 CAR-positive live T cells. In some respects, the dose is 110 × 10⁶. 6CAR-positive live T cells. In some aspects, the number of cells administered is within a certain range of variance compared to the number of such cells in the above embodiments, such as within a range of ±5, 6, 7, 8, 9, or 10%, such as within a range of ±8%. In some aspects, the dose is within a range in which the number of cells (e.g., total CAR) can be observed. + T cell count or CD8 + and / or CD4 + CAR + The number of T cells is correlated (optionally linearly) with one or more outcomes indicating a treatment response, or its duration (e.g., the likelihood of achieving remission, complete response, and / or a specific duration of remission) and / or the duration of any of the foregoing. In some respects, it has been found that administration of higher doses of cells can lead to a greater response without or substantially affecting or altering the incidence or risk of toxicity (such as CRS or neurotoxicity) in the subject, or the degree of toxicity incidence or risk in the subject, such as severe CRS or severe neurotoxicity.

[0109] In some respects, the methods provided can achieve high or specific response rates (e.g., response rates in a population assessed at a certain period after administration, such as 3 months or 6 months), such as 40% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 40% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or 80% or 81%, 82%, 83%, 84% or 85% or more (e.g., ORR at 6 months). Or a 3-month ORR), and a CR rate of 30% or more, 35% or more, 40% or more, 45% or more, 40% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 71%, 72%, 73% or more, or about 75% or more (e.g., a CR rate at 6 months or 3 months), wherein the response rate is also durable, for example, lasting for a specific period of time or at least one specific period of time, for example, maintaining for more than 1, 3, or 6 months or longer or 9 months or longer after the start of therapy. In some embodiments, such response rate and durability are only obtained after a single administration or a certain dose of such therapy. In some embodiments, treating the subject by the provided method and / or using the provided articles or compositions also enables the subject to achieve a high response rate while not exhibiting a high incidence of toxicities, such as neurotoxicity or CRS, even at higher cellular doses. In some implementations, approximately or more than 50%, 55%, or 60% of subjects achieving such a response do not experience any level of toxicity, such as any level of CRS and / or neurotoxicity.

[0110] Therefore, in some embodiments, the provided methods, articles, and / or compositions may offer advantages over other available methods or solutions or treatments such as adoptive cell therapy. In particular, some of the provided embodiments offer advantages to patients with LBCL, achieving a higher proportion of durable responses while reducing the incidence of toxicity or side effects. Treatment

[0111] The treatment methods provided in this disclosure relate to the administration of engineered cells or compositions containing engineered cells (such as engineered T cells). Methods and uses of engineered cells (such as T cells) and / or compositions thereof are also provided, including methods for treating subjects with B-cell malignancies (such as large B-cell lymphoma (LBCL)), said methods involving the administration of engineered cells and / or compositions thereof. In some embodiments, the provided methods and uses, for example, in a specific group of subjects receiving treatment, may achieve improved and / or more durable responses or efficacy and / or a reduced risk of toxicity or other side effects, compared to certain alternative methods. In some aspects, methods for administering engineered cells or compositions containing engineered cells (such as engineered T cells) to subjects (such as subjects with a disease or disorder) are also provided. In some aspects, the use of engineered cells or compositions containing engineered cells (such as engineered T cells) for treating a disease or disorder is also provided. In some aspects, the use of engineered cells or compositions containing engineered cells (such as engineered T cells) for preparing a medicament for treating a disease or disorder is also provided. In some aspects, methods of administering engineered cells or compositions containing engineered cells (such as engineered T cells) are also provided for treating a disease or disorder, or for administering to a subject suffering from a disease or disorder. In some aspects, any method described herein uses the engineered cells or compositions containing engineered cells (such as engineered T cells). In some embodiments, the disease or disorder is relapsed or refractory large B-cell lymphoma (LBCL) to first-line chemoimmunotherapy.

[0112] Engineered cells expressing recombinant receptors (such as chimeric antigen receptors (CARs)) or compositions containing said engineered cells can be used for a variety of therapeutic, diagnostic, and preventative indications. For example, said engineered cells or compositions containing said engineered cells can be used to treat a variety of diseases and disorders in a subject. Such methods and uses include therapeutic methods and uses, for example, involving administering said engineered cells or compositions containing said engineered cells to a subject suffering from a B-cell malignancy (such as large B-cell lymphoma (LBCL)). In some embodiments, said engineered cells or compositions containing said engineered cells are administered in an effective amount to achieve treatment of said disease or disorder. Uses include using said engineered cells or compositions in such methods and treatments, and using said engineered cells or compositions in the preparation of medicaments to implement such therapeutic methods. In some embodiments, said methods are carried out by administering said engineered cells or compositions containing said engineered cells to a subject suffering from or suspected of having a B-cell malignancy (such as LBCL). In some embodiments, said methods thereby treat the subject's cellular malignancy disorder (such as LBCL).

[0113] General methods for administering cells for adoptive cell therapy are known and can be used in combination with the methods and compositions provided in this disclosure. For example, adoptive T-cell therapy methods described in, for example, U.S. Patent Application Publication No. 2003 / 0170238 by Gruenberg et al.; U.S. Patent Application Publication No. 4,690,915 by Rosenberg; Rosenberg (2011) Nat Rev Clin Oncol. 8(10):577-85); see also, for example, adoptive T-cell therapy methods described in Themeli et al. (2013) Nat Biotechnol. 31(10):928-933; Tsukahara et al. (2013) Biochem Biophys Res Commun 438(1):84-9; Davila et al. (2013) PLoS ONE 8(4):e61338.

[0114] In some embodiments, the disease or condition to be treated is a B-cell malignancy. In some embodiments, the disease or condition to be treated is large B-cell lymphoma (LBCL). In some embodiments, the LBCL is selected from the group consisting of diffuse large B-cell lymphoma (DLBCL), high-grade B-cell lymphoma, primary mediastinal large B-cell lymphoma, and grade 3B follicular lymphoma.

[0115] In some embodiments, the disease or condition treated according to the provided method, use, or product is DLBCL. In some aspects, DLBCL is an unspecified (NOS) type of DLBCL. In some embodiments, the DLBCL NOS is derived from indolent lymphoma.

[0116] In some embodiments, the DLBCL NOS subject treated according to any of the methods provided in this disclosure has DLBCL that is not a DLBCL with a major extranodal location, is not a large cell lymphoma with terminally differentiated B cells, or is not a B-cell tumor with features between DLBCL and other lymphomas.

[0117] In some implementations, subjects with DLBCL or NOS treated according to any of the provided methods are diagnosed with DLBCL that is not T-cell / histiocytic abundant large B-cell lymphoma (TCHRBCL), not primary central nervous system (CNS) DLBCL, not primary cutaneous DLBCL, not leg-type or Epstein-Barr virus (EBV) positive DLBCL (e.g., EBV-positive DLBCL in older adults), and in some cases, the DLBCL is not associated with chronic inflammation.

[0118] In some embodiments, the DLBCL, NOS subject treated according to any of the provided methods has high-grade B-cell lymphoma, which is not B-lymphocytic leukemia / lymphoma (B-LBL), is not Burkitt's lymphoma, or is not a high-grade B-cell lymphoma with MYC and BCL2 and / or BCL6 rearrangements. In some aspects, DLBCL is a DLBCL, NOS, and in some cases, can be characterized as a high-grade B-cell lymphoma that is not B-lymphocytic leukemia / lymphoma (B-LBL), a high-grade B-cell lymphoma that is not Burkitt's lymphoma, or a high-grade B-cell lymphoma that is not with MYC and BCL2 and / or BCL6 rearrangements.

[0119] In some implementations, the DLBCL or NOS subject treated according to any of the provided methods has DLBCL with germinal center B cell-like (GCB) and activated B cell-like (ABC) characteristics based on the molecular and / or cytogenetic characteristics of the cell of origin.

[0120] In some embodiments, the DLBCL is newly diagnosed or primary DLBCL. In some embodiments, the disease or condition (such as lymphoma, such as DLBCL) is derived from a different subtype of disease or condition, such as from an indolent lymphoma, such as follicular lymphoma (FL). In some embodiments, such other indolent lymphomas may include, for example, marginal zone B-cell lymphoma (MZL) and chronic lymphocytic leukemia / small cell lymphoma (CLL / SLL). In some embodiments, the disease or condition is DLBCL derived from follicular lymphoma (tFL); in some aspects, the disease or condition is DLBCL derived from another indolent lymphoma. In some embodiments, the subject is suspected or characterized as having transformed follicular lymphoma (tFL). In some embodiments, the disease or condition is DLBCL derived from FL. In some aspects, the disease or condition is DLBCL derived from an indolent lymphoma other than FL.

[0121] In some embodiments, the disease or condition requiring treatment, depending on the provided method, use, or product, is DLBCL derived from another indolent lymphoma, such as DLBCL derived from marginal zone lymphoma (tMZL) or DLBCL derived from chronic lymphocytic leukemia (tCLL; Richter's). In some cases, the disease or condition is DLBCL tMZL or DLBCL tCLL. In some embodiments, it is a disease or condition derived from an indolent lymphoma other than FL. In some embodiments, it is a DLBCL or large B-cell lymphoma, such as DLBCL or large B-cell lymphoma derived from FL or other indolent lymphomas. In some embodiments, the subject is characterized by having DLBCL derived from another indolent lymphoma, such as DLBCL tMZL or DLBCL tCLL.

[0122] In some implementations, the disease or condition is high-grade B-cell lymphoma.

[0123] In some implementations, the disease or condition is primary mediastinal B-cell lymphoma.

[0124] In some embodiments, the disease or condition is follicular lymphoma (FL). In some embodiments, if a subject has follicular lymphoma (FL), the subject is selected for treatment. In some embodiments, the FL manifests as or is associated with neoplastic follicles that exhibit attenuated cannulated areas, loss of polarization, and / or absence of morphological macrophages. In some embodiments, the FL is associated with a mixture of centrifugal and centroblastic cells. In some embodiments, the FL is not associated with centrifugal cells.

[0125] In some embodiments, the disease or condition is grade 3B FL. In some embodiments, the grade 3 FL shows or is associated with more than 15 centroblasts per high-power field (HPF). In some embodiments, the FL is associated with the co-expression of CD10, BCL6, and BCL2 within the follicle. In some embodiments, the FL is associated with, or is characterized by, the t(14;18) / IGH-BCL2 and / or BCL6 rearrangement. In some embodiments, the FL is associated with the t(14;18)(q32;q21) translocation. In some aspects, the t(14;18)(q32;q21) translocation places BCL2 expression under the control of the immunoglobulin (Ig) heavy locus (IGH) enhancer. In some aspects, t(14;18) is detected in approximately 90% of grade 1 and 2 FLs, 60% to 70% of grade 3A FLs, and 15% to 30% of grade 3B FL cases. In some embodiments, the FLs associated with BCL2 translocations t(2;18) and t(18;22) are also associated with BCL6 rearrangements. In some embodiments, the FLs associated with t(2;18) and t(18;22) translocations are also associated with BCL6 rearrangements. In some embodiments, the FLs are associated with the co-expression of CD10, BCL6, and BCL2 within the follicle and / or t(14;18) / (q32;q21)(IGH-BCL2) and / or BCL6 rearrangements.

[0126] In some embodiments, the FL relates to lymph nodes and / or the spleen, bone marrow, peripheral blood, and other sites outside the lymph nodes. In some embodiments, the FL relates to lymph nodes. In some aspects, exemplary features associated with the FL include those described in: Choi et al. (2018) Arch Pathol Lab Med 142:1330-1340; Luminari et al., (2012) Rev. Brad. Hematol. Hemoter., 34:54-59 and Salles (2007) ASH Education Book, 2007:216-25. In some respects, exemplary parameters for assessing disease burden in FL include hemoglobin levels (e.g., <12 g / dL or <10 g / dL), erythrocyte sedimentation rate (ESR), lactate dehydrogenase (LDH) levels, β2-microglobulin (B2M) values, gene expression, single nucleotide polymorphisms (SNPs; e.g., SNPs in IL-8, IL-2, IL-12B, and IL1RN), miRNA expression, and protein expression (e.g., CD68, STAT1, FOXP3, CD57) (Salles (2007) ASH Education Book, 2007: 216-25). In the case of FL, the extent or burden of disease can be assessed by the Ann Arbor staging system, tumor burden, large lesions, the number of extranodal disease sites (nodules or lymph nodes), and / or bone marrow involvement.

[0127] In some respects, the survival rate of subjects (such as FL subjects) is based on scoring systems developed by the Italian Inter-Lymphoma Group (ILI) and / or the International Follicular Lymphoma Prognostic Factor Project (IFLPFP) (Luminari et al., (2012) Rev. Brad. Hematol. Hemoter., 34:54-59). In some respects, the ILI score is based on the independent prognostic role of age, sex, B symptoms, number of extranodal sites, erythrocyte sedimentation rate (ESR), and lactate dehydrogenase (LDH). In some respects, the IFLPFP score is based on risk factors such as age, Ann Arbor stage, hemoglobin level, number of nodule sites, and serum LDH level. In some cases, the IFLPFP score can be used to characterize or predict the overall survival of FL patients.

[0128] In some arbitrary implementations, the T-cell dosage includes a certain dose of CD4. + and CD8 + T cells, wherein each dose of T cells contains a recombinant receptor that specifically binds to CD19, wherein the administration comprises administering a plurality of separate compositions, the plurality of separate compositions containing CD8 +The first composition of T cells and containing CD4 + The second composition of T cells.

[0129] In some embodiments, the disease or condition is extranodal high-grade non-Hodgkin's B-cell lymphoma. In some embodiments, the extranodal high-grade non-Hodgkin's B-cell lymphoma is primary central nervous system lymphoma (PCNSL). In some embodiments, the PCNSL involves the central nervous system (CNS) but does not involve systemic lymphoma. In some embodiments, the PCNSL is confined to the brain, spine, cerebrospinal fluid (CSF), and eyes. In some embodiments, the PCNSL is diffuse large B-cell lymphoma (DLBCL). In some embodiments, the PCNSL is Burkitt's, low-grade, or T-cell lymphoma. In some embodiments, the PCNSL includes neurological signs. In some embodiments, the neurological signs include focal neurological deficits, changes in mental status and behavior, symptoms of increased intracranial pressure, and / or seizures. In some implementations, exemplary features associated with the disease or condition include those described in Grommes et al. (J. Clin Oncol 2017; 35(21):2410-18).

[0130] In some implementations, subjects treated according to the methods provided in this disclosure do not have primary central nervous system lymphoma (PCNSL).

[0131] In some embodiments, the disease or condition is secondary central nervous system lymphoma (SCNSL). In some embodiments, the SCNSL is in a patient with systemic lymphoma. In some embodiments, the SCNSL is referred to as metastatic lymphoma. In some embodiments, the SCNSL is DLBCL. In some embodiments, the SCNSL is an aggressive lymphoma that can involve the brain, meninges, spinal cord, and eyes. In some embodiments, the SCNSL includes spread to the leptomeninges. In some embodiments, the SCNSL includes parenchymal brain disease. In some embodiments, example features associated with the disease or condition include those described in Malikova et al. (Neurophychiatric Disease and Treatment 2018; 14:733-40).

[0132] In some embodiments, the disease or condition is a high-grade B-cell lymphoma with MYC and BCL2 and / or BCL6 rearrangements, optionally accompanied by DLBCL histology (double / triple hit lymphoma (DHL / THL)). In some embodiments, the disease or condition is DLBCL NOS (new-onset or converted from indolent). In some embodiments, the disease or condition is primary mediastinal B-cell lymphoma (PMBCL) or grade 3B follicular lymphoma (FL3B). In some embodiments, the disease or condition is T-cell / histiocytic abundant large B-cell lymphoma (THRBCL). In some embodiments, the disease or condition is FL3B. In some embodiments, it is DLBCL involving the central nervous system. In some embodiments, the subject has relapsed DLBCL in the central nervous system (secondary central nervous system lymphoma). In some embodiments, the secondary central nervous system lymphoma involves the brain parenchyma and / or leptomeninges. In some embodiments, the subject has received or has previously received at least one, two, three, four, or five other therapies for the disease or disorder. In some embodiments, the subject has received prior methotrexate, thiotepa, and / or cytarabine. In some embodiments, the subject's MCL has relapsed after receiving methotrexate, thiotepa, and / or cytarabine. In some embodiments, the subject has received prior hematopoietic stem cell therapy (HSCT), such as allogeneic HSCT or autologous HSCT.

[0133] In some embodiments, the subject has or has been diagnosed with double / triple-hit lymphoma or a double / triple-hit molecular subtype of lymphoma. In some embodiments, the lymphoma is a double-hit lymphoma characterized by the presence of MYC (myeloma cell oncogene), BCL2 (B-cell lymphoma 2), and / or BCL6 (B-cell lymphoma 6) gene rearrangements (e.g., translocations). In some embodiments, the gene rearrangement is combined with another gene rearrangement to affect the MYC / 8q24 locus. For example, the other gene rearrangement includes t(14;18)(q32;q21) involving BCL2. In some embodiments, the gene rearrangement is combined with BCL6 / 3q27 to affect the MYC / 8q24 locus. In some embodiments, the lymphoma is a triple-hit lymphoma characterized by the presence of MYC, BCL2, and BCL6 gene rearrangements; see, for example, Aukema et al., (2011) Blood 117:2319-2331. In some aspects of such implementations, the subject's ECOG is 0-1, or they are not suspected or characterized as having DLBCL derived from MZL or CLL. In some aspects, the therapy is directed for such subjects and / or the instructions for use are directed for administration to subjects in such populations. In some implementations, according to the 2016 WHO criteria (Swerdlow et al., (2016) Blood 127(20):2375-2390), double / triple hit lymphoma can be considered high-grade B-cell lymphoma with histological MYC and BCL2 and / or BCL6 rearrangements (double / triple hit) of DLBCL.

[0134] In some implementations, NHL can be staged according to the Lugano classification (e.g., see Cheson et al., (2014) JCO 32(27):3059-3067; Cheson, BD (2015) Chin Clin Oncol 4(1):5). In some cases, staging is indicated by Roman numerals I to IV (1-4), with E indicating localized (I or II) lymphomas affecting organs outside the lymphatic system (exonuclear organs). Stage I represents involvement of a single nodule or a group of adjacent nodules, or involvement of a single extranodal lesion without nodule involvement (IE). Stage 2 represents involvement of two or more nodule groups on the same side of the diaphragm, or localized contiguous extranodal involvement (IIE) classified as stage I or II based on nodule extent. Stage III represents nodule involvement on both sides of the diaphragm or nodule involvement above the diaphragm with spleen involvement. Stage IV represents additional non-contiguous extranodal involvement. Furthermore, "bulky disease" can also be used to describe large tumors in the chest, especially in stage II. For malignant lymphomas, positron emission tomography (PET) and computed tomography (CT) are used to determine the extent of the disease; for non-malignant lymphomas, CT is used to determine the extent of the disease. In some embodiments, the subject receiving treatment according to the provided embodiment has a PET-positive disease at or before the administration of the cell dose.

[0135] In some implementations, if the subject has received prior CD19-targeted therapy, the biological sample obtained from the subject after prior CD19-targeted therapy, at or before the administration of the dose of cells, contains cells expressing CD19.

[0136] In some implementations, the Eastern Cooperative Oncology Group (ECOG) performance status index can be used to assess or select subjects for treatment, for example, subjects who have not responded well to previous therapies (see, for example, Oken et al. (1982) Am J Clin Oncol. 5:649-655). The ECOG performance status scale describes a patient's functional level in terms of self-care ability, daily activities, and physical abilities (such as walking, working, etc.). In some implementations, an ECOG performance status of 0 indicates that the subject can perform normal activities. In some respects, a subject with an ECOG performance status of 1 indicates some limitation in physical activity, but the subject is fully capable of movement. In some respects, more than 50% of patients with an ECOG performance status of 2 are capable of movement. In some cases, subjects with an ECOG performance status of 2 are also capable of self-care; see [link to relevant documentation]. et al., (1993) Br J Cancer 67(4) 773-775. The criteria reflecting ECOG performance status are shown in Table 1 below:

[0137] In some embodiments, at the time of or immediately prior to the administration of the given dose of cells, the subject has relapsed after remission following treatment with one or more prior therapies targeting the disease or condition (rather than another dose of cells expressing the CDR) or has become refractory to the one or more prior therapies. In some embodiments, the subject has relapsed after treatment with one, two, or three or more prior therapies (rather than another dose of cells expressing the CAR) or has become refractory to the prior therapies. In some embodiments, the subject has relapsed after treatment with one prior therapy (rather than another dose of cells expressing the CAR) or has become refractory to the prior therapies, for example, making the given dose of cells a second-line therapy. In some embodiments, the subject has relapsed after treatment with two or more prior therapies (rather than cells expressing the given dose of CAR) or has become refractory to the prior therapies, for example, making the given dose of cells a third-line or higher therapy, such as a fourth-line therapy.

[0138] In some embodiments, the subject has a disease refractory to first-line chemoimmunotherapy or has relapsed within 12 months of receiving first-line chemoimmunotherapy. In some embodiments, the subject has a disease refractory to first-line chemoimmunotherapy. In some embodiments, the subject has relapsed within 12 months of receiving first-line chemoimmunotherapy. In some embodiments, the subject has a primary refractory disease or has relapsed within 12 months of achieving a complete response (CR) to initial chemoimmunotherapy. In some embodiments, the subject has a primary refractory disease within 12 months of achieving a complete response (CR) to initial chemoimmunotherapy. In some embodiments, the subject has relapsed within 12 months of achieving a complete response (CR) to initial chemoimmunotherapy.

[0139] In some embodiments, the subject has a disease refractory to first-line chemoimmunotherapy, or has relapsed after first-line chemoimmunotherapy, and is ineligible for hematopoietic stem cell transplantation (HSCT) due to comorbidities or age. In some embodiments, the subject has relapsed after first-line chemoimmunotherapy and is ineligible for hematopoietic stem cell transplantation (HSCT) due to comorbidities or age. In some embodiments, the subject is ineligible for HSCT due to comorbidities. In some embodiments, the subject is ineligible for HSCT due to age.

[0140] In some embodiments, the subject has relapsed or refractory disease after two or more lines of systemic therapy. In some embodiments, the subject has relapsed after two or more lines of systemic therapy. In some embodiments, the subject has refractory disease after two or more lines of systemic therapy.

[0141] In some respects, subjects treated according to the provided implementation scheme include adult subjects with large B-cell lymphoma (LBCL), including diffuse large B-cell lymphoma (DLBCL) (including DLBCL caused by indolent lymphoma), high-grade B-cell lymphoma, primary mediastinal large B-cell lymphoma, and grade 3B follicular lymphoma, who have disease refractory to first-line chemoimmunotherapy or have relapsed within 12 months after first-line chemoimmunotherapy; have disease refractory to first-line chemoimmunotherapy or have relapsed after first-line chemoimmunotherapy and are ineligible for hematopoietic stem cell transplantation (HSCT) due to comorbidities or age; or have relapsed or have refractory disease after two or more lines of systemic therapy. In some respects, subjects treated according to the provided implementation plan include adult subjects with large B-cell lymphoma (LBCL), including diffuse large B-cell lymphoma (DLBCL) (including DLBCL caused by indolent lymphoma), high-grade B-cell lymphoma, primary mediastinal large B-cell lymphoma, and grade 3B follicular lymphoma, who have disease refractory to first-line chemoimmunotherapy or have relapsed within 12 months after first-line chemoimmunotherapy; or who have disease refractory to first-line chemoimmunotherapy or have relapsed after first-line chemoimmunotherapy and are ineligible for hematopoietic stem cell transplantation (HSCT) due to comorbidities or age. In some aspects, subjects treated according to the provided protocol include adult subjects with large B-cell lymphoma (LBCL), including diffuse large B-cell lymphoma (DLBCL) (including DLBCL caused by indolent lymphoma), high-grade B-cell lymphoma, primary mediastinal large B-cell lymphoma, and grade 3B follicular lymphoma, who have disease refractory to first-line chemoimmunotherapy or have relapsed within 12 months after first-line chemoimmunotherapy. In some aspects, subjects treated according to the provided protocol include adult subjects with large B-cell lymphoma (LBCL), including diffuse large B-cell lymphoma (DLBCL) (including DLBCL caused by indolent lymphoma), high-grade B-cell lymphoma, primary mediastinal large B-cell lymphoma, and grade 3B follicular lymphoma, who have disease refractory to first-line chemoimmunotherapy or have relapsed after first-line chemoimmunotherapy, and who are ineligible for hematopoietic stem cell transplantation (HSCT) due to comorbidities or age.

[0142] In some implementations, the first-line chemoimmunotherapy is rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisone (R-CHOP). In some implementations, R-CHOP is administered to the subject in a 14-day cycle (R-CHOP14). In some implementations, R-CHOP is administered to the subject in a 21-day cycle (R-CHOP21). In some implementations, the first-line chemoimmunotherapy is a modified R-CHOP in which rituximab is replaced with another anti-CD20 monoclonal antibody. In some implementations, oxutuzumab or vincristine is replaced with vedotin. In some implementations, the first-line chemoimmunotherapy is administered to the subject for 3-8 cycles. In some implementations, the first-line chemoimmunotherapy is administered to the subject for more than 4 cycles. In some implementations, the first-line chemoimmunotherapy is administered to the subject for 6 cycles or approximately 6 cycles.

[0143] In some embodiments, the first-line chemoimmunotherapy is rituximab, dexamethasone, cytarabine, and cisplatin (R-DHAP). In some embodiments, the first-line chemoimmunotherapy is rituximab, ifosfamide, carboplatin, and etoposide (R-ICE). In some embodiments, the first-line chemoimmunotherapy is rituximab, gemcitabine, dexamethasone, and cisplatin (R-GDP). In some embodiments, the first-line chemoimmunotherapy is administered to the subject in three cycles.

[0144] In some implementations, first-line chemoimmunotherapy is rituximab, doxorubicin, cyclophosphamide, vincristine, bleomycin, and prednisone (R-ACVBP). In other implementations, first-line chemoimmunotherapy is dose-adjusted etoposide, prednisone, vincristine, cyclophosphamide, doxorubicin, and rituximab (DA-EPOCH-R).

[0145] In some implementations, subjects with secondary CNS lymphoma may be treated according to the provided implementation plan. In some aspects, subjects who achieved a complete response but relapsed after an infusion of anti-CD19 CAR may be treated according to the provided implementation plan. In some implementations, subjects who have previously received CAR-expressing T-cell therapy (e.g., engineered T cells expressing the same CAR+ T cells) and achieved disease stabilization (SD) as their best response after the first infusion may be treated according to the provided implementation plan, for example, as a second infusion or cycle of CAR-expressing T-cell therapy.

[0146] In some implementations, the subject has not yet received treatment for relapsed or refractory lymphoma. In some implementations, the subject is a potential candidate for autologous HSCT.

[0147] In some implementations, subjects are ineligible for high-dose therapy and autologous HSCT due to organ function or age, but their organ function is sufficient to receive CAR-T cell therapy. In some implementations, subjects have a left ventricular ejection fraction (LVEF) ≥40%, adequate room oxygen saturation with dyspnea ≤1 grade, AST and ALT ≤5xULN, total bilirubin <2.0 mg / dL, creatinine clearance >30 mL / min, and bone marrow function sufficient to receive lymphatic clearance chemotherapy, or a combination thereof. In some implementations, subjects are 70 years of age or older, have an adjusted pulmonary carbon monoxide diffusion capacity (DLCO) ≤60%, LVEF <50%, creatinine clearance <60 mL / min, AST or ALT >2×ULN, and an ECOG performance status of 2, or a combination thereof.

[0148] In some implementations, the subject's ECOG performance status is ≤2, has previously undergone HSCT, has previously undergone allogeneic HSCT, has secondary CNS lymphoma involvement, or a combination thereof.

[0149] In some implementations, the subject has sufficient bone marrow function to receive lymphatic clearance chemotherapy.

[0150] In some implementation schemes, transplantation is discontinued if the subject is ineligible, over 75 years of age, has an ECOG performance status greater than 1, a history of central nervous system (CNS) disorders (such as epilepsy or cerebral ischemia), has an uncontrolled infection, a calculated creatinine clearance (CrCl) less than 45 mL / min, alanine aminotransferase (ALT) more than 5 times the upper limit of normal (ULN), a left ventricular ejection fraction (LVEF) less than 40%, or an absolute neutrophil count (ANC) less than 1.0 × 10⁻⁶. 9 Platelets count less than 50 × 10⁹ cells / L, or less than 50 × 10⁹ cells / L in the absence of bone marrow involvement. 9 If the number of cells / L is less than a certain threshold, the subject is excluded.

[0151] In some implementations, the subject is excluded if they have a history of CNS disorders (such as seizures or cerebral ischemia) or an autoimmune disease requiring systemic immunosuppression.

[0152] In some implementations, a subject is excluded if the subject's creatinine clearance is less than 30 mL / min, ALT is greater than 5 times the upper limit of normal, or LVEF is less than 40%.

[0153] In some implementations, the subject is excluded if they have a history of relevant CNS disorders (such as seizures or cerebral ischemia), an ECOG performance status greater than 2, or an uncontrolled infection.

[0154] In some embodiments, at or before administering the given dose of cells: the subject has or has been identified as having relapsed or refractory large B-cell lymphoma; and / or the subject has been or has been treated with anthracyclines and one or more CD20-targeting agents; and / or the subject has relapsed or become refractory after two or more lines of therapy or autologous HSCT; and / or the subject is or has been identified as having an ECOG performance status of 1 or 2; and / or if the subject has received prior CD19-targeting therapy, a biological sample obtained from the subject after the prior CD19-targeting therapy contains cells expressing CD19. In some embodiments, the cell dose is administered via outpatient administration.

[0155] In some respects, subjects treated according to the provided protocol, such as in an outpatient setting or at a non-tertiary center, include adult patients with relapsed / refractory LBCL. In some respects, subjects treated according to the provided protocol, such as in an outpatient setting, include subjects with unspecified diffuse large B-cell lymphoma (DLBCL) (including DLBCL caused by indolent lymphoma), high-grade B-cell lymphoma, primary mediastinal large B-cell lymphoma, or grade 3B follicular lymphoma. In some respects, subjects treated according to the provided protocol, such as in an outpatient setting, include subjects with disease refractory to first-line chemoimmunotherapy or relapsed within 12 months of first-line chemoimmunotherapy; subjects with disease refractory to first-line chemoimmunotherapy or relapsed after first-line chemoimmunotherapy and ineligible for hematopoietic stem cell transplantation (HSCT) due to comorbidities or age; or subjects with relapsed or refractory disease after two or more lines of systemic therapy.

[0156] In some embodiments, subjects treated according to the provided implementation scheme include adult subjects with relapsed or refractory LBCL to single-line chemoimmunotherapy. In some embodiments, subjects treated according to the provided implementation scheme include subjects with unspecified diffuse large B-cell lymphoma (DLBCL) (including DLBCL caused by indolent lymphoma), high-grade B-cell lymphoma, primary mediastinal large B-cell lymphoma, or grade 3B follicular lymphoma. In some implementation schemes, the subjects are ineligible for HSCT due to comorbidities or age. In some embodiments, the subjects have disease refractory to first-line chemoimmunotherapy or have relapsed after first-line chemoimmunotherapy and are ineligible for hematopoietic stem cell transplantation (HSCT) due to comorbidities or age.

[0157] In some implementations, the disease or condition is large B-cell lymphoma (e.g., LBCL) and the antigen is CD19.

[0158] In some embodiments, the cell therapy, such as adoptive T-cell therapy, is performed via autologous transfer, wherein the cells are isolated from and / or otherwise prepared from a subject who will receive the cell therapy, or from a sample derived from the subject. Thus, in some aspects, the cells are derived from a subject in need of treatment, such as a patient, and the cells are administered to the same subject after isolation and processing.

[0159] In some embodiments, the cell therapy, such as adoptive T-cell therapy, is performed via allogeneic transfer, wherein the cells are isolated and / or otherwise prepared from a subject other than the subject who will receive or eventually receive the cell therapy (e.g., a first subject). In such embodiments, the cells are administered to a different subject of the same species, such as a second subject. In some embodiments, the first and second subjects are genetically identical. In some embodiments, the first and second subjects are genetically similar. In some embodiments, the second subject expresses the same HLA type or supertype as the first subject.

[0160] The cells can be administered by any suitable method, such as by bolus infusion, by injection (e.g., intravenous or subcutaneous), intraocular, periocular, subretinal, intravitreal, transseptal, subscleral, choroidal, anterior chamber, subconjunctival, subconjuntival, subcapsular, retro-orbital, peri-orbital, or posterior juxtascleral delivery. In some embodiments, they can be administered parenterally, intrapulmonaryly, and intranasally, and, if local treatment is required, intralesionally. Parenterial infusion includes intramuscular, intravenous, intra-arterial, intraperitoneal, or subcutaneous injection. In some embodiments, a given dose is administered by a single bolus infusion of the cells. In some embodiments, the cells can be administered by multiple bolus infusions, for example, over a period not exceeding 3 days, or by continuous infusion. In some implementations, the cell dose or any other therapy, such as lymphatic drainage therapy, intervention therapy, and / or combination therapy, is administered via outpatient delivery.

[0161] In some implementations, the administration of the cell dose or any other therapy, such as lymphatic drainage therapy, intervention therapy, and / or combination therapy, is delivered inpatiently. In some aspects, the administration of the cell dose or any other therapy, such as lymphatic drainage therapy, intervention therapy, and / or combination therapy, is performed in an inpatient setting, such as at a university medical center. In some aspects, the therapy is received in an outpatient setting, such as at a non-university medical center. In some aspects, the administration and administration of the cell therapy or any other therapy, such as lymphatic drainage therapy, intervention therapy, and / or combination therapy, in an outpatient setting allows for wider use in community / non-university centers and improves accessibility.

[0162] For the prevention or treatment of a disease, the appropriate dosage may depend on the type of disease to be treated, the type of cell or recombinant receptor, the severity and course of the disease, whether the cell administration is for preventative or therapeutic purposes, prior therapy, the subject's clinical history and response to the cell, and the judgment of the attending physician. In some embodiments, the composition and cells are suitable for administration to the subject in a single or series of treatments.

[0163] In some embodiments, the cells are administered as part of a combination therapy, such as simultaneously or sequentially with another or additional therapeutic intervention, such as antibodies or engineered cells or receptors, or agents, such as cytotoxic agents or therapeutic agents, in any order. In some embodiments, the cells are co-administered with one or more additional therapeutic agents, or combined with another therapeutic intervention simultaneously or sequentially in any order. In some embodiments, the additional therapeutic agent is any intervention or agent described in this disclosure, such as any intervention or agent described in this disclosure that can alleviate toxic symptoms, for example, as described in Section ID. In some cases, the cells are co-administered with another therapy in sufficiently close proximity such that the cell population enhances the effect of one or more additional therapeutic agents, and vice versa. In some embodiments, the cells are administered prior to the one or more additional therapeutic agents. In some embodiments, the cells are administered after one or more additional therapeutic agents. In some embodiments, the one or more additional agents include cytokines, such as IL-2, for example, to enhance persistence. In some embodiments, the method includes the administration of a chemotherapeutic agent.

[0164] In some embodiments, the method includes the administration of a chemotherapy agent, for example, administering a moderating chemotherapy agent prior to the administration, for example, to reduce tumor burden.

[0165] In some respects, preconditioning subjects with immune depletion therapy (such as lymphatic depletion) can improve the efficacy of adoptive cell therapy (ACT).

[0166] Therefore, in some embodiments, the method includes injecting a pre-regulatory agent, such as a lympholytic agent or a chemotherapy agent, such as cyclophosphamide, fludarabine, or a combination thereof, into the subject prior to the initiation of the cell therapy. For example, the subject may receive the pre-regulatory agent at least 2 days prior to the initiation of cell therapy, such as at least 3, 4, 5, 6, or 7 days. In some embodiments, the subject receives the pre-regulatory agent no more than 7 days prior to the initiation of cell therapy, such as no more than 6, 5, 4, 3, or 2 days. In some embodiments, if there is a delay of more than two weeks between the completion of lympholytic chemotherapy and the CAR T-cell infusion, the subject should be re-administered lympholytic chemotherapy before receiving the infusion.

[0167] In some embodiments, the subject is pre-conditioned with cyclophosphamide at a dose between or equal to or about 20 mg / kg and 100 mg / kg of the subject's body weight, such as between or equal to or about 40 mg / kg and 80 mg / kg. In some aspects, the subject is pre-conditioned or administered cyclophosphamide at or equal to or about 60 mg / kg. In some embodiments, cyclophosphamide may be administered as a single dose or in multiple doses, such as once daily, every two days, or every three days. In some embodiments, cyclophosphamide is administered once daily for one or two days. In some embodiments, when the lymphatic scavenger includes cyclophosphamide, the dose of cyclophosphamide administered to the subject is between or equal to or about 100 mg / m² of the subject's body surface area. 2 Up to 500mg / m 2 Between, for example, between or about 200 mg / m³ 2 Up to 400mg / m 2 Between, or 250mg / m 2 Up to 350 mg / m 2 Between. In some instances, the subjects were administered approximately 100 mg / m². 2 Cyclophosphamide. In some instances, the subjects were administered approximately 150 mg / m². 2 Cyclophosphamide. In some instances, the subjects were administered approximately 200 mg / m². 2 Cyclophosphamide. In some instances, the subjects were administered approximately 250 mg / m². 2 Cyclophosphamide. In some instances, the subjects were administered approximately 300 mg / m². 2 Cyclophosphamide. In some embodiments, cyclophosphamide can be administered in a single dose or in multiple doses, such as once daily, every two days, or every three days. In some embodiments, cyclophosphamide is administered daily, such as for 1-5 days, for example, for 3-5 days. In some cases, the subject is given approximately 300 mg / m² daily before initiating the cell therapy. 2 Cyclophosphamide is administered to the body surface area for 3 days. In some embodiments, the subject is administered a total of approximately 300 mg / m² prior to the initiation of the cell therapy. 2 400mg / m 2 500mg / m 2 600mg / m 2 700mg / m 2 800mg / m 2 900mg / m 2 1000mg / m 2 1200mg / m 2 1500mg / m 2 1800mg / m2 2000mg / m 2 2500mg / m 2 2700mg / m 2 3000mg / m 2 3300mg / m 2 3600mg / m 2 4000mg / m 2 Or 5000mg / m 2 Cyclophosphamide, or any of the cyclophosphamides within the range defined above.

[0168] In some embodiments, when the lymphatic scavenger contains fludarabine, the subject is administered fludarabine at a dose of approximately 1 mg / m². 2 Up to or approximately 100 mg / m 2 Between, for example, or about 10 mg / m² 2 Up to approximately 75 mg / m³ 2 Between, or approximately 15 mg / m 2 Up to or approximately 50 mg / m 2 Between, or approximately 20 mg / m² 2 Up to approximately 40 mg / m 2 Between, or approximately 24 mg / m 2 Up to approximately 35 mg / m 2 Between. In some instances, the subject was administered at or approximately 10 mg / m². 2 Fludarabine. In some instances, the subjects were administered doses of 15 mg / m² or more. 2 Fludarabine. In some instances, the subjects were administered doses of 20 mg / m² or approximately. 2 Fludarabine. In some instances, the subject was administered fludarabine at a dose of 25 mg / m² or more. In some instances, the subject was administered fludarabine at a dose of 30 mg / m² or more. 2 Fludarabine. In some embodiments, fludarabine can be administered as a single dose or in multiple doses, such as once daily, every two days, or every three days. In some embodiments, fludarabine is administered daily, such as for 1-5 days, for example, for 3-5 days. In some instances, 30 mg / m² is administered to the subject daily prior to initiating the cell therapy. 2 The subject's body surface area was approximately 30 mg / m². 2 Fludarabine was administered to the subject at a concentration of approximately 10 mg / m² for 3 consecutive days. In some embodiments, the total dose administered to the subject was approximately 10 mg / m². 2 20mg / m 2 25mg / m 2 30mg / m2 40mg / m 2 50mg / m 2 60mg / m 2 70mg / m 2 80mg / m 2 90mg / m 2 100mg / m 2 120mg / m 2 150mg / m 2 180mg / m 2 200mg / m 2 250mg / m 2 270mg / m 2 300mg / m 2 330mg / m 2 360mg / m 2 400mg / m 2 Or 500mg / m 2 180mg / m 2 200mg / m 2 250mg / m 2 270mg / m 2 300mg / m 2 330mg / m 2 360mg / m 2 400mg / m 2 Or 500mg / m 2 Cyclophosphamide or cyclophosphamides within the range defined by any of the above.

[0169] In some embodiments, the lymphatic scavenger comprises a single agent, such as cyclophosphamide or fludarabine. In some embodiments, the subject is administered cyclophosphamide only, without fludarabine or other lymphatic scavengers. In some embodiments, the subject has received lymphatic scavenging therapy prior to administration, which includes the administration of cyclophosphamide at a dose of approximately 200-400 mg / m². 2 The subject's body surface area, optionally at a dose of about 300 mg / m². 2 It is administered once daily for 2-4 days. In some embodiments, the subject is administered only fludarabine, for example, without cyclophosphamide or other lymphatic scavenging agents. In some embodiments, the subject has received lymphatic scavenging therapy prior to the administration, which includes the administration of fludarabine at a dose of approximately 20-40 mg / m². 2 The subject's body surface area, optionally at a dose of about 30 mg / m². 2The subject's body surface area was measured, and the medication was applied once daily for 2-4 days.

[0170] In some embodiments, the lymphatic scavenger comprises a combination of multiple agents, such as a combination of cyclophosphamide and fludarabine. Therefore, the combination of agents may include cyclophosphamide at any dosage or administration schedule (as described above) and fludarabine at any dosage or administration schedule (as described above). For example, in some aspects, the subject is given a dose of approximately 60 mg / kg (approximately 2 g / m²) prior to the first or subsequent doses. 2 ) cyclophosphamide and 3 to 5 doses of 25 mg / m 2 Fludarabine. In some cases, the subject was simultaneously given intravenous fludarabine (30 mg / m²) prior to administration of the cells. 2 / day, for 3 consecutive days) and cyclophosphamide (300 mg / m 2 / day, for 3 days (flu / cy). In some embodiments, the subject is given a reduced, delayed, or eliminated dose of one or more doses of the lymphatic scavenger.

[0171] In some embodiments, the subject may receive a bridging therapy after collecting the subject's cells (e.g., via leukoablation) for use with recombinant receptor (e.g., CAR) engineered cell therapy and before lymph node dissection therapy. In some embodiments, the bridging therapy is chemotherapy. In some embodiments, the bridging therapy is radiation therapy. In some embodiments, the bridging therapy is for disease control. The bridging therapy can be any anticancer therapy used for disease control before receiving a dose of engineered (e.g., CAR+) T cells. Based on the judgment of those skilled in the art regarding the treatment of a particular disease or condition, including factors such as the patient's age, the severity or extent of the disease, the likelihood of side effects, the timing of administration prior to lymph node dissection therapy, prior therapies, and other factors, any of a variety of therapies may be administered as a bridging therapy. Bridging the therapy may include radiation therapy or systemic therapy. Exemplary treatments that can serve as bridging therapy prior to lymph node decompression include, but are not limited to, rituximab, dexamethasone, prednisone, lenalidomide, gemcitabine, oxaliplatin, brentuximab vedotin, ibrutinib, or bendamustine, or any combination of the foregoing. In some cases, the bridging therapy is gemcitabine and oxaliplatin. In some cases, the bridging therapy is gemcitabine and rituximab. In some embodiments, the bridging therapy is rituximab, gemcitabine, and oxaliplatin. Prior to receiving lymph node decompression therapy, the subject's disease status is assessed, such as by positron emission tomography (PET). In some embodiments, only subjects who present with PET-positive disease after bridging therapy are given lymph node decompression therapy and a dose of engineered (e.g., CAR+) T cells. In other embodiments, if a subject achieves CR after bridging therapy, neither lymph node decompression therapy nor a dose of engineered (e.g., CAR+) T cells is administered.

[0172] Following administration of the cells, in some embodiments, the bioactivity of the engineered cell population is measured, for example, using any of a variety of known methods. Parameters to be evaluated include the specific binding of engineered or natural T cells or other immune cells to the antigen, in vivo, for example, by imaging, or ex vivo, for example, by ELISA or flow cytometry. In some embodiments, the ability of the engineered cells to destroy target cells can be measured using any suitable known method, such as the cytotoxicity assays described in Kochenderfer et al., J. Immunotherapy, 32(7):689-702 (2009) and Herman et al. J. Immunological Methods, 285(1):25-40 (2004). In some embodiments, the bioactivity of the cells is measured by determining one or more cytokines (such as CD10). 7 The bioactivity is measured by the expression and / or secretion of α, IFNγ, IL-2, and TNF. In some respects, the bioactivity is measured by assessing clinical outcomes, such as a reduction in tumor burden or load.

[0173] In some embodiments, the engineered cells are further modified in various ways to enhance their therapeutic or preventative effects. For example, a population of engineered CARs or TCRs expressed can be conjugated directly or indirectly to a target molecule via a linker. The practice of conjugating compounds (such as CARs or TCRs) to target molecules is well known. See, for example, Wadwa et al., J. Drug Targeting 3:1 1 1 (1995), and U.S. Patent No. 5,087,616. In some embodiments, the cells are administered as part of a combination therapy, such as simultaneously or sequentially with another therapeutic intervention (such as an antibody or engineered cell or receptor or a formulation, such as a cytotoxic agent or therapeutic agent). In some embodiments, the cells are co-administered with one or more additional therapeutic agents, or combined with another therapeutic intervention simultaneously or sequentially in any order. In some cases, the cells are co-administered with another therapy at sufficiently close times such that the cell population enhances the effect of one or more additional therapeutic agents, or vice versa. In some embodiments, the cells are administered prior to the one or more additional therapeutic agents. In some embodiments, the cells are administered after one or more additional therapeutic agents. In some embodiments, one or more additional agents include cytokines, such as IL-2, for example, to enhance persistence.

[0174] In some embodiments, the subject is pre-medicated, for example, to minimize the risk of infusion reactions. In some aspects, pre-medication includes administration of analgesics and / or antihistamines. In some embodiments, pre-medication includes administration of acetaminophen and / or diphenhydramine, or another H1-antihistamine. In some embodiments, acetaminophen (e.g., 650 mg orally) is administered to the subject 30 to 60 minutes or about 30 to 60 minutes prior to treatment with the cell therapy. In some embodiments, diphenhydramine (e.g., 25-50 mg, IV or orally) or another H1-antihistamine is administered to the subject 30 to 60 minutes or about 30 to 60 minutes prior to treatment with the cell therapy. In some embodiments, diphenhydramine (e.g., 25-50 mg, IV or orally) is administered to the subject 30 to 60 minutes or about 30 to 60 minutes prior to treatment with the cell therapy. In some embodiments, acetaminophen (e.g., 650 mg, orally) and diphenhydramine (e.g., 25-50 mg, IV or orally), or another H1-antihistamine, are administered to the subject 30 to 60 minutes or about 30 to 60 minutes prior to treatment with the cell therapy. In some embodiments, acetaminophen (e.g., 650 mg, orally) and diphenhydramine (e.g., 25-50 mg, IV or orally) are each administered to the subject about 30 to 60 minutes or about 30 to 60 minutes prior to treatment with the cell therapy. In some embodiments, the acetaminophen is referred to as paracetamol. B. Dosage

[0175] In some embodiments, a dose of cells is administered to a subject according to the provided method and / or the provided article or composition. In some embodiments, the dose or timing is determined based on the subject's specific disease or condition. In some cases, the dose or timing for a specific disease can be determined empirically based on the provided description.

[0176] In some of the provided embodiments, the given dose of T cells, such as engineered T cells expressing a recombinant receptor, comprises, or includes a cell composition enriched with, or a cell population enriched with, CD3+ T cells, CD4+ T cells, CD8+ T cells, or CD4+ T cells. In some of these embodiments, more than or more than 70%, 75%, 80%, 85%, 90%, 95%, or 98% of the given dose of T cells are CD3+ T cells, CD4+ T cells, CD8+ T cells, or CD4+ T cells. + T cells, CD8 + T cells or CD4 + T cells and CD8 +T cells. In some embodiments, the dose of T cells includes a defined proportion of CD4+ expressing the receptor. + Cells and CD8 receptor-expressing cells + Cells and / or CD4 + T cells and CD8 + T cells, in a ratio of approximately 1:1 or between approximately 1:3 and approximately 3:1. In some embodiments, the determined ratio is approximately 1:1. In some embodiments of the provided method, CAR-positive CD4+ + T cells and CAR-positive CD8 + T cells consist of CAR-positive live CD4+ cells in a 1:1 ratio. + Cells with CAR-positive or CD8 + T live cells were administered to the subject.

[0177] In some of the provided embodiments, the dose of T cells contains a dose of CD4. + and CD8 + T cells, wherein each dose of T cells includes a recombinant receptor that specifically binds to a disease or disorder (such as any disease or disorder described in this disclosure) or a target antigen expressed in or associated with the disease or disorder by its cells or tissues. In some aspects, the administration comprises administering a plurality of separate compositions comprising CD8+. + The first composition of T cells and containing CD4 + The second composition of T cells.

[0178] In some embodiments, the stated dose of cells comprises or contains between 2 x 10⁻⁶ and about 10⁻⁶. 5 Cells / kg and approximately 2 x 10 6 Between [number] cells / kg, for example, between [number] or approximately 4 x 10 [units]. 5 Cells / kg and approximately 1x10 6 Between 10 cells / kg, or between 6 x 10⁻⁶ cells / kg, or between 10⁻⁶ cells / kg and approximately 6 x 10⁻⁶ cells / kg. 5 Cells / kg and approximately 8 x 10 5 Between [number] cells / kg. In some embodiments, the given dose of cells comprises no more than 2 x 10 [units] per kilogram of subject body weight. 5 Cells (e.g., cells expressing antigens, such as cells expressing CAR) per kg, for example, not exceeding or not exceeding about 3 x 10⁻⁶ cells per kg. 5 Cells / kg, not exceeding or not exceeding about 4 x 10 5 Cells / kg, not exceeding or not exceeding about 5 x 10 5 Cells / kg, not exceeding or not exceeding approximately 6 x 105 Cells / kg, not exceeding or not exceeding approximately 7 x 10 5 Cells / kg, not exceeding or not exceeding approximately 8 x 10 5 Cells / kg, not exceeding or not exceeding approximately 9 x 10 5 Cells / kg, not exceeding or not exceeding about 1x10 6 cells / kg, or not exceeding or not exceeding about 2 x 10 6 Cells / kg. In some embodiments, the dose of said cells comprises at least or at least about or about 2 x 10⁻⁶ cells per kilogram of subject body weight. 5 Cells (e.g., antigen-expressing cells, such as CAR-expressing cells) (cells / kg), such as at least or at least about or about 3 x 102 5 Cells / kg, at least or at least about or about 4 x 10 5 Cells / kg, at least or at least about or about 5 x 10 5 Cells / kg, at least or at least about or about 6 x 10 5 Cells / kg, at least or at least about or about 7 x 10 5 Cells / kg, at least or at least about or about 8 x 10 5 Cells / kg, at least or at least about or about 9 x 10 5 Cells / kg, at least or at least about or about 1x10 6 Cells / kg, or at least about 2 x 10⁻⁶ 6 Cells / kg. In some embodiments, the cell count refers to the number of such cells, such as live cells (e.g., live T cells).

[0179] In some implementations, a single population of the cells or cell subtypes is administered in the following ranges or amounts: from about 0.1 million to 100 billion cells per kilogram of subject body weight and / or a certain amount of cells, such as, for example, from about 0.1 million to about 50 billion cells (e.g., about 5 million cells, about 25 million cells, about 500 million cells, about 1 billion cells, about 5 billion cells, about 20 billion cells, etc.). (or approximately 30 billion cells, or approximately 40 billion cells, or the range defined by any two of the above values), or approximately 1 million to approximately 50 billion cells (e.g., approximately 5 million cells, approximately 25 million cells, approximately 500 million cells, approximately 1 billion cells, approximately 5 billion cells, approximately 20 billion cells, approximately 30 billion cells, approximately 40 billion cells, or the range defined by any two of the above values), or approximately 100 0 million to approximately 100 billion cells (e.g., approximately 20 million cells, approximately 30 million cells, approximately 40 million cells, approximately 60 million cells, approximately 70 million cells, approximately 80 million cells, approximately 90 million cells, approximately 10 billion cells, approximately 25 billion cells, approximately 50 billion cells, approximately 75 billion cells, approximately 90 billion cells, or any of the above). The dosage is defined as a range of two numerical values, and in some cases, it is from about 100 million cells to about 50 billion cells (e.g., about 120 million cells, about 250 million cells, about 350 million cells, about 650 million cells, about 800 million cells, about 900 million cells, about 3 billion cells, about 30 billion cells, about 45 billion cells), or any value between these ranges and / or the body weight of the subject per kilogram. The dosage may vary due to disease or impairment and / or the specific properties of the patient and / or other treatments. In some embodiments, such numerical values ​​refer to the number of cells expressing the recombinant receptor; in other embodiments, they refer to T cells or PBMCs or the total number of cells administered. In some embodiments, the cell number refers to the number of such cells as living cells.

[0180] In some implementations, the cell dose is a constant or fixed dose of the cells, such that the cell dose is independent of the subject's body surface area or weight, or is not based on body surface area or weight.

[0181] In some implementations, a certain dose of genetically engineered cells comprises 1 x 10⁻⁶ cells or approximately 1 x 10⁻⁶ cells. 5 It is approximately 5x10 8 One total CAR-expressing T cell, approximately 1 x 1025 It is approximately 2.5 x 10. 8 One total CAR-expressing T cell, approximately 1 x 102 5 It is approximately 1x10 8 One total CAR-expressing T cell, approximately 1 x 102 5 It is approximately 5x10 7 Total CAR-expressing T cells, including or including approximately 1 x 102 5 Up to including or including approximately 2.5 x 10 7 One total CAR-expressing T cell, approximately 1 x 102 5 It is approximately 1x10 7 One total CAR-expressing T cell, approximately 1 x 102 5 It is approximately 5x10 6 One total CAR-expressing T cell, approximately 1 x 102 5 It is approximately 2.5 x 10. 6 Total CAR-expressing T cells, approximately from 1x10 5 It is approximately 1x10 6 Total CAR-expressing T cells, approximately from 1x10 6 It is approximately 5x10 8 One total CAR-expressing T cell, approximately 1 x 102 6 It is approximately 2.5 x 10. 8 One total CAR-expressing T cell, approximately 1 x 102 6 It is approximately 1x10 8 One total CAR-expressing T cell, approximately 1 x 102 6 It is approximately 5x10 7 One total CAR-expressing T cell, approximately 1 x 102 6 It is approximately 2.5 x 10. 7 Total CAR-expressing T cells, approximately 1 x 102 6 It is approximately 1x10 7 Total CAR-expressing T cells, approximately 1 x 102 6 It is approximately 5x10 6 Total CAR-expressing T cells, approximately 1 x 102 6 It is approximately 2.5 x 10. 6 Total CAR-expressing T cells, approximately 2.5 x 10-1 6 It is approximately 5x10 8 Total CAR-expressing T cells, approximately 2.5 x 10-1 6 It is approximately 2.5 x 10. 8 Total CAR-expressing T cells, approximately 2.5 x 10-16 It is approximately 1x10 8 Total CAR-expressing T cells, approximately 2.5 x 10-1 6 It is approximately 5x10 7 Total CAR-expressing T cells, approximately 2.5 x 10-1 6 Up to including or including approximately 2.5 x 10 7 Total CAR-expressing T cells, including or including approximately 2.5 x 10-1 6 It is approximately 1x10 7 Total CAR-expressing T cells, approximately 2.5 x 10-1 6 It is approximately 5x10 6 Total CAR-expressing T cells, approximately 5 x 102 6 It is approximately 5x10 8 Total CAR-expressing T cells, approximately 5 x 102 6 It is approximately 2.5 x 10. 8 Total CAR-expressing T cells, approximately 5 x 102 6 It is approximately 1x10 8 Total CAR-expressing T cells, approximately 5 x 102 6 It is approximately 5x10 7 Total CAR-expressing T cells, approximately 5 x 102 6 It is approximately 2.5 x 10. 7 Total CAR-expressing T cells, approximately 5 x 102 6 It is approximately 1x10 7 One total CAR-expressing T cell, approximately 1 x 102 7 Up to including or including approximately 5x10 8 One total CAR-expressing T cell, approximately 1 x 102 7 It is approximately 2.5 x 10. 8 Total CAR-expressing T cells, approximately 1 x 102 7 It is approximately 1x10 8 Total CAR-expressing T cells, approximately 1 x 102 7 It is approximately 5x10 7 Total CAR-expressing T cells, approximately 1 x 102 7 It is approximately 2.5 x 10. 7 Total CAR-expressing T cells, approximately 2.5 x 10-1 7 Up to including or including approximately 5x10 8 Total CAR-expressing T cells, approximately 2.5 x 10-1 7 It is approximately 2.5 x 10. 8Total CAR-expressing T cells, approximately 2.5 x 10-1 7 It is approximately 1x10 8 Total CAR-expressing T cells, approximately 2.5 x 10-1 7 It is approximately 5x10 7 Total CAR-expressing T cells, approximately 5 x 102 7 It is approximately 5x10 8 Total CAR-expressing T cells, approximately 5 x 102 7 It is approximately 2.5 x 10. 8 Total CAR-expressing T cells, approximately 5 x 1010 7 It is approximately 1x10 8 Total CAR-expressing T cells, approximately 1 x 102 8 It is approximately 5x10 8 Total CAR-expressing T cells, approximately 1 x 102 8 It is approximately 2.5 x 10. 8 Total CAR-expressing T cells, approximately 2.5 x 103 8 It is approximately 5x10 8 Total CAR-expressing T cells. In some embodiments, the dose of genetically engineered cells includes or comprises approximately 2.5 × 10⁻⁶ T cells. 7 To approximately 1.5 × 10 8 Total CAR-expressing T cells, for example, approximately 5 × 10⁶. 7 To be approximately 1×10 8 Total CAR-expressing T cells. In some embodiments, the cell number refers to the number of such cells as living cells, such as live T cells.

[0182] In some embodiments, the dose of genetically engineered cells comprises at least or at least about 1 x 102 5 One CAR-expressing cell, at least or at least about 2.5 x 102 5 CAR-expressing cells, at least or at least about 5 x 10 5 One CAR-expressing cell, at least or at least about 1 x 10 6 One CAR-expressing cell, at least or at least about 2.5 x 102 6 CAR-expressing cells, at least or at least about 5 x 10 6 One CAR-expressing cell, at least or at least about 1 x 10 7 One CAR-expressing cell, at least or at least about 2.5 x 102 7 CAR-expressing cells, at least or at least about 5 x 10 7 One CAR-expressing cell, at least or at least about 1 x 10 8One CAR-expressing cell, at least or at least about 1.5 x 102 8 One CAR-expressing cell, at least or at least about 2.5 x 102 8 One CAR-expressing cell or at least approximately 5 x 10 8 CAR-expressing cells. In some embodiments, the number of cells refers to the number of such cells as living cells, such as live T cells.

[0183] In some embodiments, the cell therapy includes administering a dose of cells, said dose being 1 × 10⁻⁶ or about 1 × 10⁻⁶. 5 It is approximately 5 × 10 8 The total number of recombinant cells expressing this cell type, total T cells, or total peripheral blood mononuclear cells (PBMCs), is approximately 5 x 10⁻⁶. 5 It is approximately 1x10 7 The total number of recombinant cells expressing the cells, total T cells, or total peripheral blood mononuclear cells (PBMCs) is approximately 1 x 10-1. 6 It is approximately 1x10 7 Total recombinant receptor-expressing cells, total T cells, or total peripheral blood mononuclear cells (PBMCs), including all end values. In some embodiments, the cell therapy includes administration of a dose of cells comprising at least or at least about 1 x 102 cells. 5 One total of recombinant receptor-expressing cells, total T cells, or total peripheral blood mononuclear cells (PBMCs), such as at least or at least about 1 x 102 6 One, at least or at least about 1x10 7 One, at least or at least about 1x10 8 The number of such cells. In some embodiments, the number of cells refers to the number of such cells as living cells, such as live T cells.

[0184] In some implementations, the quantity is related to CD3. + CD8 + or CD4 + and CD8 + In some cases, this also includes the total number of recombinant receptor-expressing (e.g., CAR+) cells. In some embodiments, the cell number refers to the number of such cells as living cells.

[0185] In some embodiments, the cell therapy includes administering a dose of cells, said dose comprising the following number of cells: approximately 1 x 103 5 It is approximately 5x10 8 CD3+, CD8+ or CD4 + and CD8 + Total T cells or CD3+, CD8 + or CD4+ and CD8 + Recombinant receptor (e.g., CAR) expressing cells, approximately 5 x 10-1 5 It is approximately 1x10 7 CD3+, CD8+ or CD4 + and CD8 + Total T cells or CD3+, CD8 + or CD4 + and CD8 + Recombinant receptor (e.g., CAR) expressing cells, or approximately 1 x 10-1 6 It is approximately 1x10 7 CD3+, CD8+ or CD4 + and CD8 + Total T cells or CD3+, CD8 + or CD4 + and CD8 + Recombinant receptor (such as CAR) expressing cells, including all end values. In some embodiments, cell therapy includes administering a dose of cells, said dose comprising the following numbers of cells: approximately 1 x 102 or approximately 1 x 102. 5 It is approximately 5x10 8 Total CD3+ / CAR+, CD8+ / CAR+ or CD4 + / CD8 + / CAR+ cells, approximately 5x10 5 It is approximately 1x10 7 Total CD3+ / CAR+, CD8+ / CAR+ or CD4 + / CD8 + / CAR+ cells, or approximately 1×10 6 It is approximately 1×10 7 Total CD3+ / CAR+, CD8+ / CAR+ or CD4 + / CD8 + / CAR+ cells, including all endpoints. In some embodiments, the cell number is the number of such cells as living cells.

[0186] In some embodiments, the stated dose of genetically engineered cells comprises at least or at least about 2.5 x 10⁻⁶ cells. 7 CD3+ / CAR+, CD8 + / CAR+ or CD4 + / CD8 + / CAR+T cells, at least or at least about 5x10 7 CD3+ / CAR+, CD8 + / CAR+ or CD4 + / CD8+ / CAR+T cells, or at least approximately 1x10 8 CD3+ / CAR+, CD8 + / CAR+ or CD4 + / CD8 + / CAR+T cells. In some embodiments, the stated dose of genetically engineered cells comprises or is approximately 2.5 x 10⁻⁶ CAR+T cells. 7 CD3+ / CAR+, CD8 + / CAR+ or CD4 + / CD8 + / CAR+T cells, approximately 5x10 7 CD3+ / CAR+, CD8 + / CAR+ or CD4 + / CD8 + / CAR+T cells, or approximately 1x10 8 CD3+ / CAR+, CD8 + / CAR+ or CD4 + / CD8 + / CAR+T cells. In some embodiments, the number of cells is the number of such cells as living cells.

[0187] In some embodiments, the dose of the T cells includes: 5 x 10 7 One T cell expressing a recombinant receptor (such as CAR) or 2.5 x 10 7 CD8+ expressing recombinant receptors (such as CAR) + T cells. In some embodiments, the dose of the T cells includes: 1 x 10⁻⁶ or about 1 x 10⁻⁶. 8 CD8+ expressing recombinant receptors (such as CAR) + T cells may be approximately 5 x 10 7 CD8+ expressing recombinant receptors (such as CAR) + T cells. In some embodiments, the dose of the T cells includes: 1.5 x 10⁻⁶ cells or approximately 1.5 x 10⁻⁶ cells. 8 One or approximately 0.75 x 10 8 CD8+ expressing recombinant receptors (such as CAR) + T cells. In some embodiments, the number of cells refers to the number of such cells as living cells.

[0188] In some embodiments, the T-cell dose comprises between about 90 and about 110 × 10⁻⁶. 6 Between 100 × 10⁶ CAR-positive live T cells. In some embodiments, the T cell dose comprises 100 × 10⁶ cells. 6CAR-positive live T cells. In some embodiments, the T cell dose comprises between about 50 and about 110 × 10⁶ cells. 6 One CAR-positive live T cell.

[0189] In some embodiments, the T cell dose includes CD4. + T cells, CD8 + T cells or CD4 + and CD8 + T cells.

[0190] In some embodiments, the T cell dose comprises CAR-positive live T cells consisting of a 1:1 ratio of CD8 to CD4. Therefore, in some embodiments, the T cell dose comprises between about 45 and about 55 × 10⁻⁶ cells. 6 CD4 + CAR-positive live T cells and between approximately 45 and 55 × 10 6 CD8 between + CAR-positive live T cells. In some embodiments, the T cell dose comprises between about 25 and about 55 × 10⁻⁶ cells. 6 CD4 + CAR-positive live T cells and between approximately 25 and approximately 55 × 10 6 CD8 + CAR-positive live T cells.

[0191] In some implementations, for example, when the subject is human, the dose of CD8 + T cells, including CD4 + and CD8 + The dosage of T cells includes between 1 and approximately 10⁻⁶. 6 and or approximately 5×10 8 The total recombinant receptor (e.g., CAR) expression of CD8 among individuals + Cells, for example, in a range of approximately 5 × 10⁻⁶. 6 to approximately 1×10 8 Within the range of each of these cells, such as 1x10 7 2.5x10 7 5x10 7 7.5x10 7 1x10 8 1.5x10 8 Or 5x10 8 The total number of such cells, or a value between any two of the above. In some embodiments, the patient is administered multiple doses, each dose or the total dose may be within any of the above numerical ranges. In some embodiments, the cell dose includes an administration of approximately 1 × 10⁻⁶ cells.7 It is approximately 0.75 × 10⁻⁶. 8 The total recombinant receptor expresses CD8 + T cells, approximately 1 × 10⁻⁶ 7 It is approximately 5 × 10 7 The total recombinant receptor expresses CD8 + T cells, approximately 1 × 10⁻⁶ 7 It is approximately 0.25 × 10⁻⁶. 8 The total recombinant receptor expresses CD8 + T cells, including all terminal values. In some embodiments, the cell dose includes 1 x 10-1 or about 1 x 10-1. 7 2.5x10 7 5x10 7 7.5x10 7 1x10 8 1.5x10 8 2.5x10 8 Or 5x10 8 The total recombinant receptor expresses CD8 + T cells. In some embodiments, the number of cells refers to the number of such cells as living cells.

[0192] In some implementations, for example, when the subject is human, the dose comprises less than about 5 x 10 8 Total recombinant receptor (e.g., CAR) expressing cells, T cells, or peripheral blood mononuclear cells (PBMCs), for example, at approximately 1 × 10⁻⁶. 6 It is approximately 5 × 10 8 Within the range of such cells, such as approximately 2 × 103 6 5×10 6 1×10 7 5×10 7 1×10 8 1.5×10 8 Or 5×10 8 The total number of such cells, or a range between any two of the above values. In some embodiments, the cell number is the number of such cells as living cells.

[0193] In some embodiments, the patient is administered multiple doses, each dose or the total dose may be within any of the numerical ranges described above. In some embodiments, the cell dose comprises from or from about 1 x 103 5 From or from about 5x10 8 Total recombinant receptor (e.g., CAR) expression T cells or total T cells, from or from approximately 1 x 10 5 From or from about 1.5 x 10 8Total recombinant receptor (e.g., CAR) expression T cells or total T cells, from or from approximately 1 x 10 5 From or from about 1x10 8 Total recombinant receptor (e.g., CAR) expression T cells or total T cells, from or from approximately 5 x 10 5 From or from about 1x10 7 One, or from about 1x10 6 From or from about 1x10 7 Each total recombinant receptor (such as CAR) expresses T cells or total T cells, including their respective end values.

[0194] In some embodiments, the dose of T cells includes CD4. + T cells, CD8 + T cells or CD4 + and CD8 + T cells.

[0195] In some implementations, the cell dose, such as recombinant receptor-expressing T cells, is administered to the subject as a single dose, or as a single dose over a period of two weeks, one month, three months, six months, one year, or longer.

[0196] In the context of adoptive cell therapy, a given “dose” administration encompasses the administration of a given amount or number of cells as a single composition and / or a single, uninterrupted administration, such as by a single injection or continuous infusion, and also encompasses the administration of a given amount or number of cells in multiple doses or in multiple compositions over a specified time period (e.g., not exceeding 3 days) by multiple independent compositions or infusions. Therefore, in some contexts, the dose refers to a single or continuous administration of a specified number of cells given or initiated at a single time point. However, in other contexts, the dose is administered by multiple injections or infusions over a period not exceeding three days, such as once daily or twice daily over three days, or multiple infusions within a single day.

[0197] Therefore, in some aspects, the dose of cells is administered as a single pharmaceutical composition. In some embodiments, the dose of cells is administered as multiple compositions that collectively contain the dose of cells.

[0198] In some implementations, the term "fractionated dose" refers to a dose administered in multiple doses over a period of more than one day. This type of administration is covered in this method and is considered a single dose.

[0199] Therefore, the cell dose can be administered in fractionated doses, for example, fractionated doses administered over time. For example, in some embodiments, the dose may be administered to the subject over 2 or 3 days. An exemplary method of fractionated dosing includes administering 25% of the dose on the first day and the remaining 75% of the dose on the second day. In other embodiments, 33% of the dose may be administered on the first day and the remaining 67% on the second day. In some aspects, 10% of the dose is administered on the first day, 30% of the dose is administered on the second day, and 60% of the dose is administered on the third day. In some embodiments, the fractionated dosing does not continue for more than 3 days.

[0200] In some embodiments, the dose of cells can be administered by applying multiple compositions or solutions (such as first and second, optionally more, each composition or solution containing a dose of the cells). In some aspects, multiple compositions, each containing different cell populations and / or cell subtypes, can be administered separately or independently, optionally over a period of time. For example, the cell populations or cell subtypes may each comprise CD8. + and CD4+ T cells, and / or including CD8 respectively + and CD4 + The enriched population, for example, CD4+ and / or CD8+ T cells, each individually comprises cells genetically engineered to express a recombinant receptor. In some embodiments, administration of the dose includes administration of a dose containing CD8+. + T cells or a certain dose of CD4 + The first composition of T cells, and the administration of an additional dose of CD4. + T cells and CD8 + The second composition of T cells.

[0201] In some embodiments, the administration of the composition or dose (e.g., administration of multiple cell compositions) involves the separate administration of the cell compositions. In some aspects, the separate administration is performed simultaneously or sequentially in any order. In a particular embodiment, administration is achieved by administering a dose of CD8 in any order. + T cells or a certain dose of CD4 + The first composition of T cells and containing an additional dose of CD4 + T cells and CD8 +The second composition for T cells is administered sequentially in separate doses. In some embodiments, the dose comprises a first composition and a second composition, and the first composition and the second composition are administered within 48 hours of each other, for example, no more than 36 hours or no more than 24 hours of each other. In some embodiments, the time interval between the administration of the first composition and the second composition is 0 to 12 hours, 0 to 6 hours, or 0 to 2 hours. In some embodiments, the interval between the start of administration of the first composition and the start of administration of the second composition is no more than 2 hours, no more than 1 hour, or no more than 30 minutes, and no more than 15 minutes, no more than 10 minutes, or no more than 5 minutes. In some embodiments, the time interval between the start and / or completion of administration of the first composition and / or the start and / or administration of the second composition is no more than 2 hours, no more than 1 hour, no more than 30 minutes, no more than 15 minutes, no more than 10 minutes, or no more than 5 minutes. In some embodiments, the time interval between the administration of the first composition and the second composition is no more than 2 hours. In some embodiments, the time interval between the administration of the first composition and the second composition is no more than 1 hour. In some embodiments, the time interval between the administration of the first composition and the second composition is no more than 30 minutes. In some embodiments, the time interval between the application of the first composition and the second composition is no more than 15 minutes.

[0202] In some compositions, the first composition, such as the first composition at the stated dosage, contains CD4. + T cells. In some compositions, the first composition, such as the first composition at the stated dosage, contains CD8. + T cells. In some embodiments, the first composition is administered before the second composition. In a particular embodiment, CD8... + T cells in CD4 + Administered before T cells.

[0203] In some embodiments, the cell dose or composition comprises a defined or target proportion of CD4 expressing a recombinant receptor (such as CAR). + Cells and CD8 cells expressing recombinant receptors (such as CAR) + Cells and / or CD4 + Cells and CD8 + Cells, wherein the ratio is optionally about 1:1 or between about 1:3 and about 3:1, such as about 1:1. In some respects, different cell populations (such as CD4) in a target or desired ratio. + CD8+ ratio or CAR+CD4 + :CAR+CD8 +The application of a composition or dosage (e.g., 1:1) involves the administration of a cell composition containing one of the said cell populations, followed by the administration of separate cell compositions containing other cell populations, wherein the administration is performed at or near a target or desired ratio. In some aspects, administration of a dose of cells or cell composition at a defined ratio results in expansion, persistence, and / or enhanced antitumor activity of T-cell therapy.

[0204] In some implementations, the dose of genetically engineered cells is 5 x 10⁻⁶ or approximately 5 x 10⁻⁶. 7 100 CD3+CAR+ live cells, including approximately 2.5 x 10⁻⁶ cells. 7 CD4 + CAR + live cells and approximately 2.5 x 10⁻⁶ cells. 7 CD8 + CAR + live cells. In some implementations, the dose of genetically engineered cells is 1 x 10⁻⁶ or approximately 1 x 10⁻⁶. 8 10 CD3+CAR+ live cells, including approximately 5 x 10^10 cells at separate doses. 7 CD4 + CAR + live cells and approximately 5x10 7 CD8 + CAR + live cells. In some implementations, the dose of genetically engineered cells is 1.5 x 10⁻⁶ or approximately 1.5 x 10⁻⁶. 8 100 CD3+CAR+ live cells, including approximately 0.75 x 10⁻⁶ isolated doses. 8 CD4 + CAR + live cells and approximately 0.75 x 10⁻⁶ cells. 8 CD8 + CAR + live cells.

[0205] In some embodiments, the subject receives multiple doses of cells, such as two or more doses or multiple consecutive doses. In some embodiments, two doses are administered to the subject. In some embodiments, the subject receives consecutive doses, such as a second dose, approximately 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 days after the first dose. In some embodiments, multiple consecutive doses are administered after the first dose, such that one or more additional doses are administered after the administration of the consecutive doses. In some aspects, the number of cells administered to the subject in the additional doses is the same as or similar to the number of cells administered in the first dose and / or consecutive doses. In some embodiments, one or more additional doses are greater than the previous doses.

[0206] In some respects, the size of the first and / or subsequent doses is determined according to one or more criteria, such as the subject's response to prior treatment (e.g., chemotherapy), the subject's disease burden (e.g., tumor burden, volume, size, or degree, extent, or type of metastasis), stage, and / or the likelihood or incidence of toxic outcomes (e.g., CRS, macrophage activation syndrome, tumor lysis syndrome, neurotoxicity) in the subject, CRS, macrophage activation syndrome, tumor lysis syndrome, neurotoxicity, and / or the host immune response to the administered cells and / or recombinant receptors.

[0207] In some aspects, the time between the administration of the first dose and the administration of subsequent doses is about 9 to about 35 days, about 14 to about 28 days, or about 15 to about 27 days. In some embodiments, the timing of the administration of the subsequent doses is more than about 14 days but less than about 28 days after the administration of the first dose. In some aspects, the time between the first dose and the subsequent doses is about 21 days. In some embodiments, one or more additional doses, such as a continuous dose, are administered after the administration of the subsequent doses. In some aspects, the additional one or more continuous doses are administered at least about 14 days but less than about 28 days after the administration of the previous dose. In some embodiments, the additional doses are administered less than about 14 days after the previous dose, for example, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 days after the previous dose. In some embodiments, no dose is administered less than about 14 days after the previous dose and / or more than 28 days after the previous dose.

[0208] In some embodiments, the cell dose (e.g., recombinant receptor-expressing cells) comprises two doses (e.g., a dual dose), which includes a first dose of T cells and a continuous dose of T cells, wherein one or both of the first dose and the second dose comprise the administration of T cells in fractionated doses.

[0209] In some implementations, the cell dose is typically large enough to effectively reduce the disease burden.

[0210] In some embodiments, the cells are administered at a desired dose, which in some aspects includes a desired dose or number of cells or cell types and / or a desired proportion of cell types. Therefore, in some embodiments, the amount of cells used is based on the total number of cells (or cells per kilogram of body weight) and a desired proportion of a single population or subtype, such as CD4. + With CD8 +The proportion. In some embodiments, the amount of cells used is based on the desired total number of cells (or the number of cells per kilogram of body weight) for a single population or a single cell type. In some embodiments, the amount used is based on a combination of such characteristics as the desired number of total cells in a single population, the desired proportion, and the desired total number of cells.

[0211] In some implementations, the cell population or cell subtype, such as CD8 + and CD4 + T cells are administered at the desired dose of total cells (e.g., the desired T cell dose) or within an acceptable range of variation of the desired dose of total cells (e.g., the desired T cell dose). In some aspects, the desired dose refers to the desired number of cells or the desired number of cells per unit body weight of the subject receiving the cells, such as cells / kg. In some aspects, the desired dose meets or exceeds the minimum cell number or the minimum number of cells per unit body weight. In some aspects, among the total cells administered at the desired dose, individual populations or subtypes are administered at the desired output ratio (e.g., CD4+). + With CD8 + The proportion (or an approximate proportion) exists, for example, within a certain acceptable range of difference or error in that proportion.

[0212] In some embodiments, the cells are administered at a desired dose of one or more of the individual cell populations or subtypes, such as a desired dose of CD4+ cells and / or a desired dose of CD8+ cells, or within their acceptable range of variation. In some aspects, the desired dose is a desired number of cell subtypes or populations, or a desired number of cells per unit body weight of the subject to which the cells are administered, such as cells / kg. In some aspects, the desired dose reaches or exceeds a minimum number of the cell population or subtype, or a minimum number of the cell population or subtype per unit body weight.

[0213] Therefore, in some embodiments, the dosage is based on a desired fixed dose and desired proportion of total cells, and / or based on a desired fixed dose of one or more (e.g., each) of a single said individual subtype or subpopulation. Therefore, in some embodiments, the dosage is based on a desired fixed or minimum dose of T cells and a desired CD4+. + The ratio of CD8+ cells to CD4+ and / or based on the desired fixed or minimum dose of CD4+ and / or CD8+ cells.

[0214] In some implementations, the cells are in multiple cell populations or subtypes (such as CD4). + and CD8 +The desired output ratio (e.g., CD4+) is applied within an acceptable range. In some aspects, the desired ratio may be a specific ratio or a range of ratios. For example, in some embodiments, the desired ratio (e.g., CD4+) is... + The ratio of CD8+ cells to CD8+ cells is between approximately 5:1 and approximately 5:1 (or greater than or greater than approximately 1:5 and less than or less than approximately 5:1), or between approximately 1:3 and approximately 3:1 (or greater than or greater than approximately 1:3 and less than or less than approximately 3:1), such as between approximately 2:1 and approximately 1:5 (or greater than or greater than approximately 1:5 and less than or less than approximately 2:1), such as approximately 5:1, 4.5:1, 4:1, 3.5 :1, 3:1, 2.5:1, 2:1, 1.9:1, 1.8:1, 1.7:1, 1.6:1, 1.5:1, 1.4:1, 1.3:1, 1.2:1, 1.1:1, 1:1, 1:1.1, 1:1.2, 1:1.3, 1:1.4, 1:1.5, 1:1.6, 1:1.7, 1:1.8, 1:1.9, 1:2, 1:2.5, 1:3, 1:3.5, 1:4, 1:4.5 or 1:5. In some respects, acceptable differences are within the expected proportions of approximately 1%, approximately 2%, approximately 3%, approximately 4%, approximately 5%, approximately 10%, approximately 15%, approximately 20%, approximately 25%, approximately 30%, approximately 35%, approximately 40%, approximately 45%, and approximately 50%, including any value between these ranges.

[0215] In certain embodiments, the number and / or concentration of cells refers to the number of cells expressing the recombinant receptor (such as CAR). In other embodiments, the number and / or concentration of cells refers to the number or concentration of all cells, T cells, or peripheral blood mononuclear cells (PBMCs) administered.

[0216] In some respects, the dose is determined according to one or more criteria, such as the subject’s response to prior treatment (e.g., chemotherapy), the subject’s disease burden (e.g., tumor burden, volume, size or degree of metastasis, extent or type, stage) and / or the likelihood or incidence of toxic outcomes (e.g., CRS, macrophage activation syndrome, tumor lysis syndrome, neurotoxicity) and / or the host immune response to the administered cells and / or recombinant receptors.

[0217] In some embodiments, the method further includes administering one or more additional doses of a chimeric antigen receptor (CAR)-expressing cellular and / or lymphatic clearance therapy, and / or repeating one or more steps of the method. In some embodiments, the one or more additional doses are the same as the initial dose. In some embodiments, the one or more additional doses differ from the initial dose, for example, being higher, such as about 2, 3, 4, 5, 6, 7, 8, 9, or 10 times higher than the initial dose, or lower, such as 2, 3, 4, 5, 6, 7, 8, 9, or 10 times lower than the initial dose. In some embodiments, the administration of one or more additional doses is determined based on the subject's response to the initial treatment or any prior treatment, the subject's disease burden, such as tumor burden, volume, size, or degree, extent, or type of metastasis, stage, and / or the likelihood or incidence of toxic outcomes in the subject, such as CRS, macrophage activation syndrome, tumor lysis syndrome, neurotoxicity, and / or the host's immune response to the administered cells and / or recombinant receptor. C. Response, efficacy, and survival

[0218] In some implementations, subjects who have relapsed or are refractory to first-line chemoimmunotherapy are treated with this method. In some implementations, at least 30%, at least 35%, at least 40%, or at least 50% of subjects treated according to this method achieve a complete response (CR); and / or at least about 40%, at least about 50%, at least about 60%, or at least about 70% of subjects treated according to this method achieve an objective response (OR). In some implementations, at least or at least about 50%, at least or at least about 60%, at least or at least about 70%, at least or at least about 80%, or at least or at least about 90% of subjects achieve CR and / or achieve an objective response (OR) after treatment according to this method. In some implementations, the criteria for evaluating effective treatment include overall response rate (ORR; also referred to as objective response rate in some cases), complete response (CR; also referred to as complete remission in some cases), duration of response (DOR), progression-free survival (PFS), and / or overall survival (OS).

[0219] In some implementations, at least 40% or at least 50% of subjects treated according to the methods provided in this disclosure achieve complete remission (CR; also referred to in some cases as complete response), characterized by progression-free survival (PFS) and / or overall survival (OS) greater than or greater than about 3 months, 6 months, or 12 months, or greater than 13 months, or about 14 months; on average, the median PFS or OS of subjects treated according to the method is greater than or about 6 months, 12 months, or 18 months; and / or the subjects exhibit PFS or OS of at least or about 6 months, 12 months, 18 months, or longer after treatment.

[0220] In some respects, response rates for subjects (e.g., those with NHL) are based on the Lugano criteria. (Cheson et al., (2014) JCO 32(27):3059-3067; Johnson et al., (2015) Radiology 2:323–338; Cheson, BD (2015) Chin Clin Oncol 4(1):5). In some respects, response assessment employs any of the clinical, hematological, and / or molecular methods. In some respects, response assessment using the Lugano criteria involves positron emission tomography (PET)-computed tomography (CT) and / or CT, as appropriate. PET-CT assessment may further include treatment with fluorodeoxyglucose (FDG) for FDG-affinity lymphoma. In some respects, a 5-point scale may be used when PET-CT will be used to assess FDG-affinity histological response. In some respects, the 5-point scale includes the following criteria: 1. No intake above background; 2. Intake ≤ mediastinum; 3. Intake > mediastinum but ≤ liver; 4. Intake moderately > liver; 5. Intake significantly above liver and / or new lesions; X, new intake area that is unlikely to be associated with lymphoma.

[0221] In some respects, a complete response described using the Lugano criteria involves complete metabolic and complete radiological responses at multiple measurable sites. In some respects, these sites include lymph nodes and extranodal sites, where, when using PET-CT, CR is described as a score of 1, 2, or 3 on a 5-point scale, with or without residual mass. In some respects, in Waldeyer's rings or extranodal sites with high physiological uptake, or at sites activated in the spleen or bone marrow (e.g., by chemotherapy or bone marrow colony-stimulating factor), uptake may be higher than in the normal mediastinum and / or liver. In such cases, a complete metabolic response can be inferred if the uptake at the initial site of involvement is not greater than that of the surrounding normal tissue, even if the physiological uptake of said tissue is high. In some respects, response in lymph nodes is assessed using CT, where CR is described as the absence of disease at extranodal sites, and the target nodule / nodular mass must shrink to a maximum transverse diameter (LDi) of ≤1.5 cm. Further evaluation sites include the bone marrow, where PET-CT-based assessment should indicate a lack of evidence of FDG-affinity disease in the bone marrow, and CT-based assessment should indicate normal bone marrow morphology, or IHC negative if inconclusive. Further evaluation sites may include assessment of organ enlargement, which should be normalized. In some respects, unmeasured lesions and new lesions are evaluated, in cases of CR, where such lesions should be absent (Cheson et al., (2014) JCO 32(27):3059-3067; Johnson et al., (2015) Radiology 2:323–338; Cheson, BD (2015) Chin Clin Oncol 4(1):5).

[0222] In some respects, a partial response (PR; also referred to in some cases as partial remission) described using the Lugano criteria involves a partial metabolic and / or radiation response at multiple measurable sites. In some respects, these sites include lymph nodes and extranodal sites, where a PR is described as a score of 4 or 5 indicating a reduction in uptake compared to baseline on PET-CT with any size mass remaining. In transient cases, such a result may predict a response to the disease. At the end of treatment, such a result may predict residual disease. In some respects, response in lymph nodes is assessed using CT, where a PR is described as a ≥50% reduction in SPD at up to 6 measurable target nodules and extranodal sites. If the lesion is too small for CT to measure, 5mm × 5mm is designated as the default value; if the lesion is no longer visible, the value is 0mm × 0mm; if the nodule is larger than 5mm × 5mm but smaller than normal, the actual measurement is used for calculation. Further evaluation sites include the bone marrow, where PET-CT assessment should show residual uptake higher than normal bone marrow uptake, but lower than baseline (diffuse uptake consistent with changes in chemotherapy response is permissible). In some respects, if persistent focal changes are present in the bone marrow against the backdrop of nodular response, further evaluation by MRI or biopsy or interval scans should be considered. In some respects, further evaluation sites may include assessment of organ enlargement, where the length of the spleen must be reduced by >50% compared to normal. In some respects, assessment should be performed for unmeasured lesions and new lesions, which, in the case of PR, should be absent / normal, regressed, but not increased. Non-response / stable disease (SD) or disease progression (PD) may also be measured using PET-CT and / or CT-based assessments. (Cheson et al., (2014) JCO 32(27):3059-3067; Johnson et al., (2015) Radiology 2:323–338; Cheson, BD (2015) Chin Clin Oncol 4(1):5).

[0223] In some contexts, progression-free survival (PFS) is described as the length of time a subject lives with a disease (such as cancer) without its condition worsening during and after treatment. In some contexts, objective response (OR) is described as a measurable response. In some contexts, the objective response rate (ORR; sometimes also called the overall response rate) is described as the proportion of patients who achieve a complete response (CR) or partial response (PR). In some contexts, overall survival (OS) is described as the length of time a subject diagnosed with a disease (such as cancer) remains alive from the date of diagnosis or the start of treatment. In some contexts, event-free survival (EFS) is described as the length of time a subject remains free from certain complications or events designed to prevent or delay treatment after the completion of cancer treatment. These events may include cancer recurrence or the onset of certain symptoms, such as bone pain caused by cancer spreading to the bones, or death.

[0224] In some embodiments, the measurement of duration of response (DOR) includes the time from recording tumor response to disease progression. In some embodiments, parameters used to assess response may include durable response, for example, a response that persists some time after the start of therapy. In some embodiments, durable response is expressed as the response rate at approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 18, or 24 months after the start of therapy. In some embodiments, the response can last for more than 3 months or more than 6 months.

[0225] In some respects, RECIST criteria are used to determine objective tumor response; in others, they are used to determine objective response in solid tumors. (Eisenhauer et al., European Journal of Cancer 45(2009)228-247.) In some respects, RECIST criteria are used to determine objective tumor response in target lesions. In some respects, a complete response determined using RECIST criteria is described as the disappearance of all target lesions and a reduction in the short axis of any pathological lymph nodes (whether target or non-target) to <10 mm. In other respects, a partial response determined using RECIST criteria is described as a reduction of at least 30% in the sum of the diameters of target lesions, with reference to the baseline sum of diameters. In other respects, disease progression (PD) is described as an increase of at least 20% in the sum of the diameters of target lesions, with reference to the smallest sum in the study (including, if the baseline sum is the smallest in the study, then the baseline sum is used as the reference). In addition to a relative increase of 20%, the sum must also show an absolute increase of at least 5 mm (in some respects, the appearance of one or more new lesions is also considered progression). In other respects, disease stability (SD) is described as neither shrinking sufficiently to meet the criteria for PR nor increasing sufficiently to meet the criteria for PD, with reference to the minimum total diameter during the study period.

[0226] In some implementations, patient survival for follicular lymphoma (FL) is based on a scoring system developed by the Italian Inter-Lymphoma Group (ILI) and / or the International Follicular Lymphoma Prognostic Factor Project (IFLPFP), typically as described above (Luminari et al., (2012) Rev. Brad. Hematol. Hemoter., 34:54-59). In some implementations, the severity of disease, such as FL, can be assessed using the Ann Arbor staging system, tumor burden, mass disease, number of nodular or extranodular disease sites, and / or bone marrow involvement, typically as described above.

[0227] In some respects, application according to the provided methods and / or the provided articles or compositions generally reduces or prevents the spread or burden of the subject's disease or condition. For example, when the disease or condition is a tumor, the methods generally reduce tumor size, volume, metastasis, percentage of bone marrow mesoderm, or percentage of molecularly detectable cancer, and / or improve prognosis or survival or other symptoms related to tumor burden.

[0228] Disease burden can include the total number of diseased cells in a subject's disease or in an organ, tissue, or body fluid (such as the organ or tissue or other location of a tumor, for example, indicating a site of metastasis). For example, in the context of certain hematologic malignancies, tumor cells in the blood or bone marrow can be detected and / or quantified. In some embodiments, disease burden can include the quality of the tumor, the number or extent of metastases, and / or the percentage of germ cells present in the bone marrow.

[0229] In some implementations, the subject has leukemia. The extent of the disease burden can be determined by assessing the amount of leukemia remaining in the blood or bone marrow.

[0230] In some respects, the response rate of subjects (e.g., subjects with CLL) is based on the International Symposium on Chronic Lymphocytic Leukemia (IWCLL) response criteria (Hallek, et al., Blood 2008, Jun 15; 111(12):5446-5456). In some respects, these criteria are described as follows: Complete remission (CR; also referred to as complete response in some cases), which in some respects requires the absence of peripheral blood clonal lymphocytes, lymphadenopathy, hepatomegaly or splenomegaly, systemic symptoms, and satisfactory blood cell count by immunophenotyping; Complete remission with incomplete bone marrow recovery (CRi), which in some respects is described as the above-mentioned CR, but with an abnormal blood cell count; Partial remission (PR; also referred to as partial response in some cases), which in some respects is described as a reduction of lymphocyte count ≥50%, a reduction of lymphadenopathy ≥50%, or a reduction of liver or spleen lymphocyte size ≥50%, with improvement in peripheral blood count; Disease progression (PD), which in some respects is described as an increase of lymphocyte count ≥50%, reaching >5 x 10^6 cells / mL. 9 / L, lymphadenopathy increased by ≥50%, liver or spleen size increased by ≥50%, Richter's transformation, or new cytopenia due to CLL; and stable disease, which in some respects is described as not meeting the criteria for CR, CRi, PR or PD.

[0231] In some implementations, if the size of the lymph nodes in the subject is less than or equal to about 20 mm or less than or equal to about 10 mm within one month after administration of the cell dose, the subject is considered to have CR or OR.

[0232] In some embodiments, no CLL marker clones were detected in the bone marrow of the subject (or in the bone marrow of more than 50%, 60%, 70%, 80%, 90% or more of the subjects treated according to the method). In some embodiments, CLL marker clones were assessed by IgH deep sequencing. In some embodiments, the marker clones were not detected at or after about or at least about 1, 2, 3, 4, 5, 6, 12, 18 or 24 months following administration of the cells.

[0233] In some implementations, a subject is considered to have a morphological disease if the presence of 5% or more germ cells in the bone marrow, for example, as detected by optical microscopy, such as 10% or more, 20% or more, 30% or more, 40% or more, or 50% or more germ cells in the bone marrow. In some implementations, a subject is considered to have a complete remission or clinical remission if the presence of less than 5% germ cells in the bone marrow.

[0234] In some implementations, the subject has leukemia. The extent of the disease burden can be determined by assessing the amount of leukemia remaining in the blood or bone marrow.

[0235] In some implementations, a subject exhibits morphological disease if the presence of 5% or more germ cells in the bone marrow, for example, as detected by optical microscopy, such as 10% or more, 20% or more, 30% or more, 40% or more, or 50% or more germ cells in the bone marrow. In some implementations, if less than 5% germ cells are present in the bone marrow, the subject exhibits complete remission or clinical remission.

[0236] In some embodiments, a subject may present with complete remission but with a small number of morphologically undetectable (by light microscopy) residual leukemia cells. A subject is considered to have minimal residual disease (MRD) if fewer than 5% of the cells in their bone marrow are germ cells and present with molecularly detectable cancer. In some embodiments, molecularly detectable cancer can be assessed using any of a variety of molecular techniques that allow for sensitive detection of small numbers of cells. In some aspects, such techniques include PCR assays, which can identify fusion transcripts resulting from unique Ig / T cell receptor gene rearrangements or chromosomal translocations. In some embodiments, flow cytometry can be used to identify cancer cells based on a leukemia-specific immunophenotype. In some embodiments, molecular detection of cancer can detect one leukemia cell in 100,000 normal cells. In some embodiments, a subject is considered to have molecularly detectable MRD if at least one or more leukemia cells are detected in 100,000 cells (e.g., by PCR or flow cytometry). In some embodiments, a subject's disease burden is either molecularly undetectable or MRD. - For example, in some cases, leukemia cells in a subject cannot be detected using PCR or flow cytometry techniques.

[0237] In some embodiments, marker clones of leukemia (such as CLL) are not detected in the bone marrow of the subject (or in more than 50%, 60%, 70%, 80%, 90% or more of the bone marrow of subjects treated according to the method). In some embodiments, marker clones of leukemia (such as CLL) are assessed by IGH deep sequencing. In some embodiments, marker clones are not detected at time points of about or at least about 1, 2, 3, 4, 5, 6, 12, 18 or 24 months after administration of the cells.

[0238] In some respects, MRD is detected by flow cytometry. Flow cytometry can be used to monitor cancer cells in bone marrow and peripheral blood samples. In specific respects, flow cytometry is used to detect or monitor the presence of cancer cells in the bone marrow. In some respects, multi-parameter immunoassay by flow cytometry can be used to detect cancer cells (e.g., see Coustan-Smithet al., (1998) Lancet 351:550-554). In some respects, multi-parameter immunoassay by mass spectrometry flow cytometry is used to detect cancer cells. In some instances, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, or 50 parameters can be used to detect cancer cells. The antigens used for detection are selected based on the cancer being detected (Foon and Todd (1986) Blood 68:1-31).

[0239] In some instances, bone marrow is obtained via bone marrow aspiration or biopsy, followed by the isolation and analysis of lymphocytes. Monoclonal and / or polyclonal antibodies conjugated to fluorescent dyes (e.g., fluorescein isothiocyanate (FITC), phycoerythrin, chlorophyll, or biotin) can be used to detect epitopes on isolated lymphocytes, such as terminal deoxynucleotidyl transferase (TdT), CD3, CD10, CD11c, CD13, CD14, CD33, CD19, CD20, CD21, CD22, CD23, CD34, CD45, CD56, CD79b, IgM, and / or KORSA3544. The labeled cells can then be detected using flow cytometry (e.g., multiparameter flow cytometry) or mass spectrometry to detect multiple epitopes.

[0240] Lymphoid cells can be identified and sorted based on light scattering point maps, followed by secondary sorting to identify cell populations expressing immunophenotypic features of interest. Exemplary epitopes are shown in Table 2 below. Foon and Todd provided additional immunological classifications of leukemia and lymphoma (Blood (1986) 68(1):1-31). In some respects, flow cytometry assessment of MRD can be achieved by quantifying the presence of one or more CLL immunophenotypes (e.g., low positive / lateral dispersion; CD3). 阴 CD5 + CD14 阴 CD19 + CD23 + CD45 + CD56 阴 This is achieved through the use of live lymphocytes.

[0241] In some respects, deep sequencing of the immunoglobulin heavy chain (IGH) locus of harvested B cells can be used to detect minimal residual disease (MRD). The presence of clones with specific IgG rearrangements can provide a label for detecting B-cell malignancies (such as CLL or NHL) and / or the presence of malignant cellular remnants. In some respects, cells are harvested and isolated from blood, such as populations containing or suspected of containing B cells. In some respects, cells are harvested and isolated from bone marrow, such as cells from bone marrow aspiration or bone marrow biopsy and / or other biological samples. In some respects, polymerase chain reaction (PCR) amplification of complementarity-determining region 3 (CDR3) using primers with highly conserved sequences within the V and J regions of the locus can be used to identify clonal populations for assessing minimal residual disease. Other methods for detecting clonal populations can be used, such as single-cell sequencing methods, including those that provide information concerning the number of cells in a specific lineage and / or the expression of specific variable chains (such as variable heavy chains) or their binding sites (such as clonal populations). In some respects, IGH DNA is amplified using degenerate primers or primers that recognize variable strand regions common to different cell clones, such as primers that recognize the common V region of the IGH sequence and degenerate primers that recognize the common J region. An exemplary sequence of the V region is ACACGGCCTCGTGTATTACTGT (SEQ ID NO: 57). An exemplary degenerate common sequence of the J region is ACCTGAGGAGACGGTGACC (SEQ ID NO: 58).

[0242] In some respects, PCR products or sequencing results are specific for rearranged alleles and can serve as clonal markers for MRD detection. After PCR amplification of the CDR3 region, the PCR product can be sequenced to obtain patient-specific oligonucleotides, which can be used to construct allele-specific PCR probes for sensitive detection of MRD following treatment with CAR T-cell therapy (such as CD19 CAR T-cell therapy) for B-cell malignancies. In cases where common primers fail to produce PCR products, frame region 1 V family-specific primers can be used instead.

[0243] In some respects, the persistence of detectable IGH sequences corresponding to malignant or clonal IGH sequences after treatment (such as those in B-cell malignancies like NHL or CLL) is associated with an increased risk of relapse. In some respects, patients with negative malignant IGH sequences after treatment (even in some respects, and even against a backdrop where other criteria indicate disease progression or only partial response, such as persistent lymph node enlargement, or other criteria that may be associated with disease or lack of complete response) may be considered to have an increased likelihood of PFS, achieving CR, or durable CR, or prolonged survival, compared to patients with persistent malignant IGH sequences. In some implementations, this prognostic and staging determination is particularly relevant to treatment in which the clearance of malignant cells is observed shortly after administration, for example, compared to remission of other clinical symptoms (such as lymph node size or other staging criteria). For example, in some respects, the absence of detectable IGH or minimal residual disease in samples such as bone marrow may be a preferred reading for response, probability of response, or durability of response compared to other available staging or prognostic methods. In some respects, results from MRD (such as IGH deep sequencing information) can provide a basis for further intervention or non-intervention. For example, in some contexts, the methods and other provided implementations suggest that subjects with malignant IGH-negative conditions may, in some respects, not receive further treatment, or not be further administered the dose provided by the therapy, or be administered a lower or reduced dose. Conversely, further treatment may be provided or specified for subjects showing MRD through IGH deep sequencing, for example, initial administration of the therapy at a similar or higher dose or further treatment. In some respects, the disease or condition persists after administration of the first dose, and / or administration of the first dose is insufficient to eradicate the disease or condition in the subject.

[0244] In some embodiments, the method reduces the burden of disease or condition, such as tumor cell count, tumor size, patient survival, or event-free survival, to a greater extent and / or for a longer period of time, compared to comparable methods using alternative dosing regimens (such as regimens where the subject receives one or more alternative therapeutic agents and / or regimens where the subject does not receive a dose of cellular and / or lymphatic clearance agents according to the provided method and / or the provided product or composition). In some embodiments, the burden of disease or condition in the subject is detected, assessed, or measured. In some aspects, the burden of disease can be detected by detecting the total number of disease or disease-related cells (such as tumor cells) in the subject or in the subject's organs, tissues, or body fluids (such as blood or serum). In some aspects, the subject's survival, survival over a period of time, degree of survival, presence or duration of event-free or symptom-free survival or recurrence-free survival is assessed. In some embodiments, any symptoms of the disease or condition may be assessed. In some embodiments, the measurement of the burden of disease or condition is specified.

[0245] In some embodiments, this method improves event-free survival or overall survival of subjects compared to other methods, such as methods where subjects receive one or more alternative therapeutic agents, and / or methods where subjects do not receive a dose of cellular and / or lymphatic scavenger according to the provided method and / or methods using the provided articles or compositions. For example, in some embodiments, subjects treated with said method have an event-free survival or probability greater than about 40%, greater than about 50%, greater than about 60%, greater than about 70%, greater than about 80%, greater than about 90%, or greater than about 95% at 6 months after the said dose. In some aspects, the overall survival is greater than about 40%, greater than about 50%, greater than about 60%, greater than about 70%, greater than about 80%, greater than about 90%, or greater than about 95%. In some embodiments, subjects treated using said method exhibit event-free survival, relapse-free survival, or survival of at least 6 months, or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 years. In some implementations, the progress time has been improved, for example, the progress time is greater than or greater than about 6 months, or at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 years.

[0246] In some embodiments, compared to other methods, such as methods where the subject receives one or more alternative therapeutic agents, and / or methods where the subject does not receive a dose of a cellular and / or lymphatic scavenger according to the provided method and / or the provided product or composition, the probability of relapse is reduced after treatment with this method. For example, in some embodiments, the probability of relapse 6 months after the first dose is less than about 80%, less than about 70%, less than about 60%, less than about 50%, less than about 40%, less than about 30%, less than about 20%, or less than about 10%.

[0247] In some cases, the pharmacokinetics of administered cells (such as adoptive cells) are determined to assess the availability (e.g., bioavailability) of the administered cells. Methods for determining the pharmacokinetics of adoptive cells may include drawing peripheral blood from a subject who has been administered engineered cells and determining the number or proportion of engineered cells in the peripheral blood. Methods for selecting and / or isolating cells may include the use of chimeric antigen receptor (CAR)-specific antibodies (e.g., Brentjense et al., Sci. Transl. Med. 2013 Mar; 5(177): 177ra38) Protein L (Zheng et al., J. Transl. Med. 2012 Feb; 10: 29), directly introducing epitope tags (e.g., Strep-Tag sequences) to specific sites on the CAR, thereby directly evaluating the CAR using Strep-Tag binding reagents (Liu et al. (2016) Nature Biotechnology, 34: 430; International Patent Application No. WO2015 / 095895) and monoclonal antibodies that specifically bind to CAR peptides (see International Patent Application No. WO2014 / 190273). In some cases, external tag genes can be used in conjunction with engineered cell therapies to detect or select cells, and in some cases, to promote cell suicide. In some cases, truncated epidermal growth factor receptor (EGFRt) can be co-expressed with the transgene of interest (CAR or TCR) in transduced cells (see U.S. Patent No. 8,802,374). EGFRt may contain the antibody cetuximab. Or other therapeutic EGFRt receptor antibodies or binding molecules that recognize epitopes that can be used to recognize or select cells constructed using EGFRt and another recombinant receptor (such as chimeric antigen receptor (CAR)), and / or to eliminate or isolate cells expressing said receptor. See U.S. Patent 8,802,374 and Liu et al., Nature Biotech. 2016 April; 34(4):430–434).

[0248] In some implementations, CAR levels in biological samples (such as blood) obtained from the patient can be measured some time after cell therapy administration. + The number of T cells, for example, to determine the pharmacokinetics of the cells. In some embodiments, CAR+ T cells (optionally, CAR+CD8) are detectable in the blood of the subject, or in the blood of most subjects treated with the method. + T cells and / or CAR+CD4 +The number of T cells is greater than 1 cell / μL, greater than 5 cells / μL, or greater than 10 cells / μL. D. Toxicity

[0249] In some embodiments, the provided methods are designed to or include features that result in a lower incidence and / or degree of toxicity, toxic outcomes or symptoms, toxicity-promoting profiles, factors or characteristics, such as symptoms or outcomes associated with or indicative of cytokine release syndrome (CRS) or neurotoxicity (NT), for example, with the administration of alternative cell therapies, such as alternative CARs. + T-cell compositions and / or alternative cell doses, such as cell doses not administered in a defined proportion compared to those used in the same manner.

[0250] In some embodiments, the provided methods do not result in a higher incidence or likelihood of toxicity or toxic outcomes, or reduce the incidence or likelihood of toxicity or toxic outcomes such as neurotoxicity (NT), cytokine release syndrome (CRS), for example, compared to certain other cell therapies. In some embodiments, the methods do not result in or increase the risk of: severe NT (sNT), severe CRS (sCRS), macrophage activation syndrome, tumor lysis syndrome, fever of at least or at least about 38 degrees Celsius for 3 consecutive days or longer, and plasma CRP levels of at least or at least about 20 mg / dL. In some embodiments, greater than or greater than about 30%, 35%, 40%, 50%, 55%, 60% or more of subjects treated according to the provided methods do not exhibit any grade of CRS or any grade of neurotoxicity. In some embodiments, no more than 50% of the treated subjects (e.g., at least 60%, at least 70%, at least 80%, at least 90% or more of the treated subjects) exhibit grade 2 or higher cytokine release syndrome (CRS) and / or grade 2 or higher neurotoxicity. In some embodiments, at least 50% of the subjects treated according to the method (e.g., at least 60%, at least 70%, at least 80%, at least 90% or more of the treated subjects) do not exhibit serious toxic outcomes (e.g., severe CRS or severe neurotoxicity), such as not exhibiting grade 3 or higher neurotoxicity and / or not exhibiting severe CRS, or not exhibiting severe CRS for a certain period of time after treatment, such as one week, two weeks or one month after administration of the cells. In some embodiments, parameters used to assess certain toxicities include adverse events (AEs), dose-limiting toxicities (DLTs), CRS, and NT.

[0251] The administration of adoptive T-cell therapy, such as treatment with T cells expressing chimeric antigen receptors, can induce toxic effects or outcomes, such as cytokine release syndrome and neurotoxicity. In some instances, these effects or outcomes are independent of high levels of circulating cytokines, which can form the basis of observed toxicity.

[0252] In some respects, the toxic outcome is cytokine release syndrome (CRS) or severe CRS (sCRS), or is associated with, or indicates cytokine release syndrome (CRS) or severe CRS (sCRS). In some cases, CRS, such as sCRS, may occur following adoptive T-cell therapy and administration of other biologics to the subject. See Davila et al., Sci Transl Med 6, 224ra25 (2014); Brentjens et al., Sci.Transl.Med.5, 177ra38 (2013); Grupp et al., N.Engl.J.Med.368,1509–1518 (2013); and Kochenderfer et al., Blood 119, 2709–2720 (2012); Xu et al., Cancer Letters 343 (2014) 172-78.

[0253] Typically, CRS is caused by an excessive systemic immune response mediated by, for example, T cells, B cells, NK cells, monocytes, and / or macrophages. These cells can release large amounts of inflammatory mediators, such as cytokines and chemokines. Cytokines can trigger an acute inflammatory response and / or induce endothelial organ damage, leading to microvascular leakage, heart failure, or death. Severe, life-threatening CRS can cause pulmonary infiltration and lung injury, kidney failure, or disseminated intravascular coagulation. Other serious, life-threatening toxicities include cardiotoxicity, respiratory distress, neurotoxicity, and / or liver failure. In some contexts, fever, especially high fever (≥38.5°C or ≥101.3°F), is associated with CRS or its risk. In some cases, the characteristics or symptoms of CRS are similar to those of infection. In some implementations, infection should also be considered in subjects presenting with CRS symptoms, which can be monitored by culture and empirical antibiotic therapy administered. Other symptoms associated with CRS may include cardiac dysfunction, adult respiratory distress syndrome, kidney and / or liver failure, coagulopathy, disseminated intravascular coagulation, and capillary leak syndrome.

[0254] Treatment of CRS may involve anti-inflammatory therapies, such as anti-IL-6 therapy, such as anti-IL-6 antibodies, such as tocilizumab, or antibiotics or other drugs described herein. The outcomes, signs, and symptoms of CRS are known and include those described in this disclosure. In some embodiments, specific outcomes, signs, and symptoms and / or their number or extent may be specified when a particular dosing regimen or administration has or does not affect a particular CRS-related outcome, sign, or symptom.

[0255] In the context of CAR-expressing cell administration, CRS typically occurs 6–20 days after CAR-expressing cell infusion. See Xu et al., Cancer Letters 343 (2014) 172–78. In some cases, CRS occurs less than 6 days or more than 20 days after CAR T cell infusion. The incidence and timing of CRS may be related to baseline cytokine levels or tumor burden at the time of infusion. Typically, CRS involves elevated serum levels of interferon (IFN)-γ, tumor necrosis factor (TNF)-α, and / or interleukin (IL)-2. Other cytokines that can be rapidly induced in CRS are IL-1β, IL-6, IL-8, and IL-10.

[0256] Exemplary outcomes associated with CRS include fever, stiffness, chills, hypotension, dyspnea, acute respiratory distress syndrome (ARDS), encephalopathy, elevated ALT / AST, renal failure, cardiac dysfunction, hypoxia, neurological disorders, and death. Neurological complications include delirium, epileptic-like activity, confusion, dysarthria, aphasia, and / or lethargy. Other CRS-related outcomes include fatigue, nausea, headache, seizures, tachycardia, myalgia, rash, acute vascular leakage syndrome, liver damage, and renal failure. In some respects, CRS is associated with increases in one or more factors such as serum ferritin, D-dimer, transaminases, lactate dehydrogenase, and triglycerides, or with hypofibrinogenemia or hepatosplenomegaly. Other exemplary signs or symptoms associated with CRS include hemodynamic instability, febrile neutropenia, elevated serum C-reactive protein (CRP), changes in coagulation parameters (e.g., international normalized ratio (INR), prothrombin time (PTI), and / or fibrinogen), changes in cardiac and other organ function, and / or changes in absolute neutrophil count (ANC).

[0257] In some implementations, CRS-related outcomes include one or more of the following: persistent fever, for example, fever at a specific temperature, such as greater than or greater than about 38 degrees Celsius for two or more days, such as three days or more, such as four days or more, or at least three consecutive days; for example, fever greater than or greater than about 38 degrees Celsius; elevated cytokines, such as a maximum fold change, such as at least or about 75, compared to pre-treatment levels of at least two cytokines (e.g., interferon-γ (IFNγ), GM-CSF, IL-6, IL-10). The neurotoxicity (NT) is compared to the levels of at least two cytokines in the group consisting of Flt-3L, fractal chemokines, and IL-5 and / or tumor necrosis factor α (TNFα), or a maximum fold change of at least one of these cytokines, such as at least or at least about 250-fold; and / or at least one clinical sign of toxicity, such as hypotension (as measured by at least one intravenous vasopressor), hypoxia (such as plasma oxygen (PO2) levels below or below about 90%); and / or one or more neurological disorders (including altered mental status, coma, and seizures). In some embodiments, neurotoxicity (NT) may occur concurrently with CRS.

[0258] Exemplary CRS-related outcomes include elevated or abnormally high serum levels of one or more factors, including cytokines and chemokines, as well as other CRS-related factors. Exemplary outcomes also include increased synthesis or secretion of one or more such factors. This synthesis or secretion can be carried out by T cells or cells that interact with T cells, such as innate immune cells or B cells.

[0259] In some embodiments, the CRS-related serum factors or CRS-related outcomes include inflammatory cytokines and / or chemokines, including interferon-gamma (IFN-γ), TNF-α, IL-1β, IL-2, IL-6, IL-7, IL-8, IL-10, IL-12, sIL-2Ra, granulocyte-macrophage colony-stimulating factor (GM-CSF), macrophage inflammatory protein (MIP)-1, tumor necrosis factor α (TNFα), IL-6 and IL-10, IL-1β, IL-8, IL-2, MIP-1, Flt-3L, fractal chemokines, and / or IL-5. In some embodiments, the factors or outcomes include C-reactive protein (CRP). CRP is not only an early or easily detectable risk factor for CRS, but also a marker of cell proliferation. In some embodiments, subjects with high CRP levels, such as ≥15 mg / dL, have CRS. In some embodiments, subjects with high CRP levels do not have CRS. In some implementations, the measurement of CRS includes the measurement of CRP and another factor indicating CRS.

[0260] In some embodiments, one or more inflammatory cytokines or chemokines are monitored before, during, or after CAR treatment. In some aspects, the one or more cytokines or chemokines include IFN-γ, TNF-α, IL-2, IL-1β, IL-6, IL-7, IL-8, IL-10, IL-12, sIL-2Rα, granulocyte-macrophage colony-stimulating factor (GM-CSF), or macrophage inflammatory protein (MIP). In some embodiments, IFN-γ, TNF-α, and IL-6 are monitored.

[0261] CRS criteria associated with the pathogenesis of CRS have been established to predict which patients are more likely to develop sCRS (see Davilla et al. Science translational medicine. 2014; 6(224):224ra25). Factors include fever, hypoxia, hypotension, neurological changes, and elevated serum levels of inflammatory cytokines, such as a group of seven cytokines (IFNγ, IL-5, IL-6, IL-10, Flt-3L, fractal chemokines, and GM-CSF), whose treatment-induced elevations are closely related to pre-treatment tumor burden and sCRS symptoms. Other guidelines on the diagnosis and management of CRS are well-known (see, for example, Lee et al., Blood. 2014; 124(2):188-95). In some implementation plans, the criteria reflecting the CRS grade are detailed in Table 3 below.

[0262] In some implementation schemes, the criteria for reflecting CRS levels are detailed in Table 4 below.

[0263] In some implementations, high-dose vasopressor therapy includes the therapies described in Table 5 below.

[0264] In some embodiments, the toxic outcome is severe CRS. In some embodiments, the toxic outcome is no severe CRS (e.g., moderate or mild CRS). In some embodiments, a subject may be considered to have responded to or subsequently experienced “severe CRS” (“sCRS”) in response to or secondary to the administration of the cell therapy or its cell dose if the subject exhibits the following after administration of the cell therapy or its cell dose: (1) fever of at least 38 degrees Celsius lasting for at least 3 days; (2) elevated cytokine levels, including (a) at least a fold change of at least 75-fold in at least two of the following seven cytokines from the group immediately following administration: interferon-γ (IFNγ), GM-CSF, IL-6, IL-10. (a) Flt-3L, fractal chemokines, and IL-5 and / or (b) a maximum fold change of at least 250 in at least one of the following seven cytokines compared to immediate post-administration levels: interferon-gamma (IFNγ), GM-CSF, IL-6, IL-10, Flt-3L, fractal chemokines, and IL-5; and (c) at least one clinical sign of toxicity, such as hypotension (requiring at least one intravenous vasopressor) or hypoxia (PO2 < 90%) or one or more neurological disorders (including altered mental status, coma, and / or seizures). In some embodiments, severe CRS includes grade 3 or higher CRS, as listed in Tables 3 and 4.

[0265] In some embodiments, the levels of the toxic outcome (e.g., CRS-related outcomes, such as serum levels of CRS indicators) are determined by ELISA. In some embodiments, fever and / or C-reactive protein (CRP) levels may be measured. In some embodiments, subjects with fever and CRP ≥15 mg / dL may be considered high-risk for severe CRS. In some embodiments, the CRS-related serum factors or CRS-related outcomes include elevated concentrations and / or levels of inflammatory cytokines and / or chemokines, including Flt-3L, fractal chemokines, granulocyte-macrophage colony-stimulating factor (GM-CSF), interleukin-1β (IL-1β), IL-2, IL-5, IL-6, IL-7, IL-8, IL-10, IL-12, interferon-gamma (IFN-γ), macrophage inflammatory protein (MIP)-1, sIL-2Rα, or tumor necrosis factor α (TNFα). In some embodiments, the factors or outcomes include C-reactive protein (CRP). In addition to being an early and easily detectable risk factor for CRS, CRP is also a marker of cell proliferation. In some implementations, subjects with high CRP levels, such as ≥15 mg / dL, are considered to have CRS. In some implementations, subjects with high CRP levels are not considered to have CRS. In some implementations, CRS measurement includes a measurement of CRP and another factor indicative of CRS.

[0266] In some implementations, outcomes associated with severe CRS or grade 3 or higher CRS, such as grade 4 or higher CRS, include one or more of the following: persistent fever, for example, fever at a specific temperature, such as greater than or greater than about 38 degrees Celsius for two or more days, such as three or more days, such as four or more days or at least three consecutive days; for example, fever greater than or greater than about 38 degrees Celsius; elevated cytokines, such as a maximum fold change, such as at least or about 75, compared to pre-treatment levels of at least two cytokines (e.g., by interferon-γ (IFNγ), GM-CS) The levels of at least two cytokines from the group consisting of F, IL-6, IL-10, Flt-3L, fractal chemokines, and IL-5 and / or tumor necrosis factor α (TNFα), or a maximum fold change of at least one of these cytokines, such as at least or at least about 250-fold; and / or at least one clinical sign of toxicity, such as hypotension (as measured by at least one intravenous vasopressor), hypoxia (such as plasma oxygen (PO2) levels below or below about 90%); and / or one or more neurological disorders (including altered mental status, coma, and seizures). In some embodiments, severe CRS includes CRS requiring management or care in an intensive care unit (ICU).

[0267] In some embodiments, the CRS (e.g., severe CRS) includes a combination of the following two conditions: (1) persistent fever (fever of at least 38 degrees Celsius lasting for at least three days) and (2) serum CRP levels of at least or about 20 mg / dL. In some embodiments, the CRS covers hypotension requiring the use of two or more vasopressors or respiratory failure requiring mechanical ventilation. In some embodiments, the dose of the vasopressor is increased in a second or subsequent administration.

[0268] In some implementations, severe CRS or grade 3 CRS includes elevated alanine aminotransferase, elevated aspartate aminotransferase, chills, febrile neutropenia, headache, left ventricular dysfunction, encephalopathy, hydrocephalus, and / or tremor.

[0269] It can specify the methods for measuring or detecting various results.

[0270] In some embodiments, toxicological results are neurotoxic or related to neurotoxicity. In some implementations, symptoms associated with the clinical risk of neurotoxicity include confusion, delirium, aphasia, expressive aphasia, lethargy, myoclonus, somnolence, altered mental status, seizures, epileptiform activity, epilepsy (optionally confirmed by electroencephalography (EEG)), elevated β-amyloid (Aβ) levels, elevated glutamate levels, and elevated oxygen free radical levels. In some implementations, neurotoxicity is graded according to severity (e.g., using a 1-5 scale; see Guido Cavaletti & Paola Marmiroli Nature Reviews Neurology 6, 657-666 (December 2010); National Cancer Institute—Common Toxicity Criteria version 4.03 (NCI-CTCAE v4.03)).

[0271] In some cases, neurological symptoms may be the earliest symptom of sCRS. In some implementations, neurological symptoms begin to appear 5 to 7 days after cell therapy infusion. In some implementations, the duration of neurological changes is 3 to 19 days. In some cases, recovery from neurological changes occurs after other symptoms of sCRS have subsided. In some implementations, the time or extent of relief from neurological changes is not accelerated by anti-IL-6 and / or steroid treatment.

[0272] In some implementations, a subject is considered to have a “serious neurotoxicity” in response to or secondary to the cell therapy or its cell dose if the subject experiences symptoms that restrict self-care (such as bathing, dressing, feeding, toileting, or taking medication) after administration. This includes: 1) symptoms of peripheral motor neuropathy, including inflammation or degeneration of peripheral motor nerves; and 2) symptoms of peripheral sensory neuropathy, including inflammation or degeneration of peripheral sensory nerves, sensory disturbances (such as sensory distortion, resulting in abnormal and unpleasant sensations), neuralgia (such as intense pain along a nerve or group of nerves), and / or sensory abnormalities (such as functional impairment of sensory neurons, resulting in abnormal skin sensations such as tingling, numbness, pressure, cold, and heat in the absence of stimulation). In some implementations, serious neurotoxicity includes grade 3 or higher neurotoxicity, as listed in Table 6.

[0273] In some implementations, the method may alleviate symptoms associated with CRS or neurotoxicity compared to other methods. In some aspects, the provided method may alleviate symptoms, outcomes, or factors associated with CRS, including those associated with severe CRS or grade 3 or higher CRS, compared to other methods. For example, subjects treated according to this method may lack symptoms, outcomes, or factors of detectable CRS (such as severe CRS or grade 3 or higher CRS) and / or have reduced symptoms, outcomes, or factors of CRS, as described in Tables 3 and 4. In some implementations, subjects treated according to this method may have reduced neurotoxicity symptoms compared to subjects treated by other methods, such as limb weakness or numbness, memory, visual and / or intellectual loss, uncontrollable obsessive-compulsive disorder and / or compulsive behaviors, delusions, headaches, cognitive and behavioral problems (including loss of motor control, cognitive decline, and autonomic nervous system dysfunction), and sexual dysfunction. In some implementations, subjects treated according to this method may experience reduced symptoms associated with peripheral motor neuropathy, peripheral sensory neuropathy, movement disorders, neuralgia, or sensory abnormalities.

[0274] In some embodiments, the method reduces neurotoxicity-related outcomes, including damage to the nervous system and / or brain, such as neuronal death. In some aspects, the method reduces levels of neurotoxicity-related factors such as β-amyloid (Aβ), glutamate, and oxygen free radicals.

[0275] In some embodiments, the toxicity result is a dose-limiting toxicity (DLT). In some embodiments, the toxicity result is a dose-limiting toxicity. In some embodiments, the toxicity result is that no dose-limiting toxicity exists. In some embodiments, dose-limiting toxicity (DLT) is defined as any grade 3 or higher toxicity assessed according to any known or published specific toxicity assessment guideline (such as any guideline described above, including the National Cancer Institute (NCI) Common Terminology Standard for Adverse Events (CTCAE) version 4.0).

[0276] In some embodiments, a low incidence, low risk, or low likelihood of toxicity (such as CRS or neurotoxicity, or severe CRS or neurotoxicity, such as grade 3 or higher CRS or neurotoxicity) is observed when a dose of T cells is administered according to the provided method and / or the provided product or composition, allowing the cell therapy to be administered on an outpatient basis. In some embodiments, the cell therapy, such as T cells (e.g., CAR), is administered according to the provided method and / or the provided product or composition. + The dosage of T cells is administered on an outpatient basis, or without requiring the subject to be sent to a hospital, in which case overnight stay is necessary.

[0277] In some respects, cell therapy, such as T-cell therapy (e.g., CAR), is administered according to the provided methods and / or the provided products or compositions. + Subjects receiving T-cell doses, including those receiving treatment on an outpatient basis, shall not receive any interventions to treat any therapeutic toxicity before or at the time of administration of the cell dose, unless or until the subject exhibits signs or symptoms of toxicity, such as neurotoxicity or CRS.

[0278] In some implementations, if the cell therapy (such as a T-cell dose, such as CAR) is applied... + Subjects receiving T-cell therapy, including those treated on an outpatient basis, exhibiting fever symptoms, will be given or instructed to receive or administer antipyretic treatment. In some embodiments, the fever in the subject is characterized by the subject's body temperature (or measured body temperature) reaching or exceeding a certain threshold temperature or level. In some aspects, the threshold temperature is associated with at least low-grade fever, moderate fever, and / or high fever. In some embodiments, the threshold temperature is a specific temperature or range. For example, the threshold temperature may be about or at least about 38, 39, 40, 41, or 42 degrees Celsius, and / or may be a range from about 38 degrees Celsius to about 39 degrees Celsius, from about 39 degrees Celsius to about 40 degrees Celsius, from about 40 degrees Celsius to about 41 degrees Celsius, or from about 41 degrees Celsius to about 42 degrees Celsius.

[0279] In some embodiments, treatment aimed at reducing fever includes treatment with an antipyretic. Antipyretics may include any agent capable of reducing fever, such as compounds, compositions, or ingredients, such as any number of agents known to have antipyretic effects, such as NSAIDs (e.g., ibuprofen, naproxen, ketoprofen, and nimesulide), salicylates (e.g., aspirin, salicylcholine, magnesium salicylate, and sodium salicylate), acetaminophen, paracetamol, metamizole, nabumetone, benzophenone, antipyrine, antipyretics, etc. In some embodiments, the antipyretic is acetaminophen. In some embodiments, acetaminophen is administered orally or intravenously at a dose of 12.5 mg / kg every four hours. In some embodiments, acetaminophen is referred to as paracetamol. In some embodiments, acetaminophen is or includes ibuprofen or aspirin.

[0280] In some implementations, if the fever is a persistent fever, the subject is given an alternative treatment to treat the toxicity. For subjects treated on an outpatient basis, if the subject develops a fever and / or is determined to have a fever or a persistent fever, the subject is instructed to return to the hospital. In some implementations, if a subject develops a fever at or above a relevant threshold temperature after specific treatment (such as the use of a treatment designed to reduce fever, such as an antipyretic, such as an NSAID, or a salicylate, such as ibuprofen, acetaminophen, or aspirin), and the subject's fever or body temperature does not decrease, or does not decrease or decreases by a specified amount (e.g., a decrease of more than 1°C, and generally does not fluctuate by about or more than about 0.5°C, 0.4°C, 0.3°C, or 0.2°C), then the subject has and / or is determined to have or is considered to have a persistent fever. For example, if a subject presents with or is determined to present with a fever of at least or about 38 or 39 degrees Celsius, and the fever decreases by no more than or equal to about 0.5°C, 0.4°C, 0.3°C, or 0.2°C over a time period of 6 hours, 8 hours, 12 hours, or 24 hours, or by no more than or equal to about 1%, 2%, 3%, 4%, or 5%, the subject is considered to have a persistent fever, even after treatment with an antipyretic such as acetaminophen. In some embodiments, the dose of the antipyretic is a dose that is generally effective in reducing the fever or a specific type of fever, such as fever associated with bacterial or viral infections (e.g., local or systemic infections). In some embodiments, acetaminophen is referred to as paracetamol.

[0281] In some implementations, a subject is considered to have and / or is identified as having persistent fever if their fever reaches or exceeds a relevant threshold temperature, and the subject's fever or body temperature does not fluctuate by 1°C or more than about 1°C, and generally does not fluctuate or exceed about 0.5°C, 0.4°C, 0.3°C, or 0.2°C. Such fluctuation not exceeding or not exceeding certain amounts is typically measured over a given time period, such as 24 hours, 12 hours, 8 hours, 6 hours, 3 hours, or 1 hour, and can be measured from the first appearance of signs of fever or the first time the body temperature exceeds a specified threshold. For example, in some implementations, a subject is considered to have persistent fever if they present with a fever of at least or at least or about 38 or 39 degrees Celsius, and there is no temperature fluctuation exceeding or about 0.5°C, 0.4°C, 0.3°C, or 0.2°C over a time period of 6 hours, 8 hours, 12 hours, or 24 hours.

[0282] In some implementations, the fever is a persistent fever; in some aspects, the subject is treated at the time at which the fever is determined to be persistent, for example, within 1, 2, 3, 4, 5, 6 or fewer hours when such persistent fever is determined, or at the time of initial treatment that may induce toxicity (such as cell therapy, such as T-cell doses, such as CAR). + The first time a fever was identified was within 1, 2, 3, 4, 5, 6 or fewer hours after the T cells were used to identify the fever.

[0283] In some embodiments, one or more interventions or agents for treating toxicity, such as toxicity-targeting therapies, are administered upon or immediately following identification or confirmation that a subject is exhibiting persistent fever (e.g., as measured according to any of the embodiments described above). In some embodiments, the one or more toxicity-targeting therapies are administered within a certain timeframe following such identification or confirmation, such as within 30 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 6 hours, or 8 hours. II. Recombinant Antigen Receptors

[0284] In some embodiments, the cells used in or related to the provided method contain or are engineered to contain engineered receptors, such as engineered antigen receptors, like chimeric antigen receptors (CARs). Furthermore, populations of such cells, compositions containing such cells, and / or enriching such cells are provided, for example, by enriching or selecting a certain type of cell, such as T cells or CD8 cells, in the composition. + or CD4 + Cells. The composition is a pharmaceutical composition and formulation for administration, such as for adoptive cell therapy. Treatment methods are also provided for administering the cells and composition to a subject (e.g., a patient) according to the provided methods and / or the provided products or compositions.

[0285] In some embodiments, the cells include one or more nucleic acids introduced through genetic engineering, and recombinant or genetically engineered products expressing such nucleic acids therefrom. In some embodiments, gene transfer is achieved by first stimulating the cells, for example by combining them with stimuli that induce responses such as cell proliferation, survival, and / or activation, as measured by the expression of cytokines or activation markers, followed by transduction of the activated cells and amplification in a culture to a number sufficient for clinical application. A. Chimeric antigen receptors (such as CD19-targeted CARs)

[0286] In some embodiments of the provided methods and uses, the chimeric receptor, such as a chimeric antigen receptor, contains one or more domains that bind a ligand-binding domain (such as an antibody or antibody fragment) to an intracellular signaling domain that is specific for a desired antigen (such as a tumor antigen). In some embodiments, the intracellular signaling domain is a stimulatory or activating intracellular domain portion, such as a T-cell stimulatory or activating domain, providing a primary activation signal or primary signal. In some embodiments, the intracellular signaling domain includes or additionally includes a co-stimulatory signaling domain to promote effector function. In some embodiments, when the chimeric receptor is genetically engineered and implanted into immune cells, it can modulate T-cell activity, and in some cases, T-cell differentiation or homeostasis, thereby improving the duration, survival, and / or persistence of the genetically engineered cells in vivo, as in methods for adoptive cell therapy.

[0287] Exemplary antigen receptors (including CARs) and methods for engineering and introducing such receptors into cells include, for example, International Patent Application Publication Nos. WO200014257, WO2013126726, WO2012 / 129514, WO2014031687, WO2013 / 166321, WO2013 / 071154, WO2013 / 123061, and U.S. Patent Application Publication Nos. US2002131960, US2013287748, etc. U.S. Patents 20130149337, 6,451,995, 7,446,190, 8,252,592, 8,339,645, 8,398,282, 7,446,179, 6,410,319, 7,070,995, 7,265,209, 7,354,762, 7,446,191, 8,324,353 and 8,479,118, and European Patent Application EP2537416 and / or Sadelain et al., Cancer Discov. 2013 April; 3(4):388–398; Davila et al. (2013) PLoS ONE 8(4):e61338; Turtle et al., Curr. Opin. Immunol., 2012 October; 24(5):633-39; Wu et al., Cancer, 2012 March 18(2):160-75. In some aspects, the antigen receptor comprises the CDR as described in U.S. Patent No. 7,446,190 and the international patent application publication No. WO / 2014055668A1. Examples of CARs include those disclosed in any of the publications mentioned above, such as WO2014031687, US 8,339,645, US 7,446,179, US 2013 / 0149337, US Patent No. 7,446,190, US Patent No. 8,389,282, Wang et al. (2012) J. Immunother. 35(9):689-701; and Brentjens et al., Sci Transl Med. 2013 5(177). See also WO2014031687, US 8,339,645, US 7,446,179, US 2013 / 0149337, US Patent No. 7,446,190, and US Patent No. 8,389282.

[0288] Chimeric receptors (such as CARs) typically include an extracellular antigen-binding domain, such as part of an antibody molecule, usually the variable heavy chain (V) of the antibody. H ) region and / or variable light chain (VL ) region, such as scFv antibody fragment.

[0289] In some embodiments, the receptor-targeted antigen is a polypeptide. In a particular embodiment, the antigen target is CD19. In some embodiments, the antigen is selectively expressed or overexpressed on diseased or conditional cells (such as tumor or pathogenic cells) compared to normal or untargeted cells or tissues.

[0290] In some embodiments, the CAR is constructed to be specific to a particular antigen, such as an antigen expressed in a specific cell type targeted in adoptive therapy, such as a cancer marker, and / or an antigen intended to induce an inhibitory response, such as an antigen expressed on normal or disease-free cell types. Therefore, the CAR typically includes one or more antigen-binding molecules in its extracellular portion, such as one or more antigen-binding fragments, domains, or portions, or one or more antibody variable domains and / or antibody molecules. In some embodiments, the CAR includes one or more antigen-binding portions of an antibody molecule, such as a variable heavy chain (V) of a monoclonal antibody (mAb). H ) and variable light chains (V L )Derived single-chain antibody fragments (scFv).

[0291] In some embodiments, the antibody or its antigen-binding portion is expressed on cells as part of a recombinant receptor (such as a chimeric receptor, like a CAR) that binds to an antigen (such as CD19), as in cases of specific binding. The antigens targeted by the chimeric receptor include those expressed in the context of a disease, condition, or cell type that will be targeted via adoptive cell therapy. These diseases and conditions are proliferative, neoplastic, and malignant diseases and disorders, including cancers and tumors, including hematologic cancers, immune system cancers such as lymphoma, leukemia, and / or myeloma, such as B-type, T-type, and myeloid leukemia, lymphoma, and multiple myeloma.

[0292] In some implementations, the CAR contains an antibody or antigen-binding fragment (such as scFv) that can specifically recognize antigens expressed on the cell surface, such as intact antigens.

[0293] In some implementations, the disease or condition is a B-cell malignancy, such as large B-cell lymphoma (e.g., DLBCL), and the antigen is CD19.

[0294] The term "antibody" in this disclosure has the broadest meaning, including polyclonal antibodies and monoclonal antibodies, including intact antibodies and functional (antigen-binding) antibody fragments, including fragment antigen-binding (Fab) fragments, F(ab')2 fragments, Fab' fragments, Fv fragments, recombinant IgG (rIgG) fragments, and variable heavy chains (V) capable of specifically binding antigens. H This term refers to single-chain antibody fragments, including single-chain variable fragments (sdFv) and single-domain antibodies (such as sdAb, sdFv, nanobodies). It also includes genetically engineered and / or otherwise modified immunoglobulin forms, such as in vivo antibodies, peptide antibodies, chimeric antibodies, fully human antibodies, humanized antibodies, heteroconjugated antibodies, and multispecific antibodies (such as bispecific antibodies, biantibodies, triantibodies and tetraantibodies, tandem bi-scFv, tandem tri-scFv). Unless otherwise stated, the term "antibody" should be understood to include its functional antibody fragment. The term also includes complete or full-length antibodies, including antibodies of any class or subclass, including IgG and its subclasses, IgM, IgE, IgA, and IgD.

[0295] In some embodiments, antigen-binding proteins, antibodies, and their antigen-binding fragments specifically recognize the antigen of a full-length antibody. In some embodiments, the heavy and light chains of the antibody may be full-length or may be antigen-binding portions (Fab, F(ab')2, Fv, or single-chain Fv fragments (scFv)). In other embodiments, the constant region of the antibody heavy chain is selected from, for example, IgG1, IgG2, IgG3, IgG4, IgM, IgA1, IgA2, IgD, and IgE, particularly from IgG1, IgG2, IgG3, and IgG4, and more particularly from IgG1 (such as human IgG1). In yet another embodiment, the constant region of the antibody light chain is selected from κ or λ, especially κ.

[0296] The antibodies provided include antibody fragments. An "antibody fragment" is a molecule other than a complete antibody that contains a portion of the complete antibody that binds to the antigen to which the complete antibody binds. Examples of antibody fragments include, but are not limited to, Fv, Fab, Fab', Fab'-SH, F(ab')2; biantibodies; linear antibodies; and variable heavy chains (V...). H ) region, single-chain antibody molecules (such as scFv and single-chain V) H Monoclonal antibodies; and multispecific antibodies formed from antibody fragments. In a particular embodiment, the antibody is a single-chain antibody fragment containing a variable heavy chain region and / or a variable light chain region, such as scFv.

[0297] As is well known, the terms "complementarity-determining region" and "CDR" are synonymous with "hypervariable region" or "HVR," and in some cases refer to the discontinuous amino acid sequence within the antibody variable region that confers antigen specificity and / or binding affinity. Generally, each heavy chain variable region has three CDRs (CDR-H1, CDR-H2, CDR-H3), and each light chain variable region has three CDRs (CDR-L1, CDR-L2, CDR-L3). As is well known, "frame region" and "FR" in some cases refer to the non-CDR portions of the heavy and light chain variable regions. Generally, each full-length heavy chain variable region has four FRs (FR-H1, FR-H2, FR-H3, and FR-H4), and each full-length light chain variable region has four FRs (FR-L1, FR-L2, FR-L3, and FR-L4).

[0298] The precise amino acid sequence boundaries of a given CDR or FR can be easily determined using a range of well-known methods, including Kabat et al. (1991), “Sequences of Proteins of Immunological Interest,” 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD (“Kabat” numbering scheme); Al-Lazikani et al. (1997) JMB 273, 927-948 (“Chothia” numbering scheme); MacCallum et al., J. Mol. Biol. 262: 732-745 (1996), “Antibody-antigen interactions: Contact analysis and binding site topography,” J. Mol. Biol. 262, 732-745 (“Contact” numbering scheme); Lefranc MP et al., “IMGT unique numbering for immunoglobulin and T cell receptor variable domains and Ig superfamily V-like domains,” Dev Comp. Immunol, 2003 Jan; 27(1):55-77 (“IMGT” numbering scheme); Honegger A and Plückthun A, “Yet another numbering scheme for immunoglobulin variabledomains: an automatic modeling and analysis tool,” J Mol Biol, 2001 Jun 8; 309(3):657-70 (“Aho” numbering scheme); and Martin et al., “Modeling antibody hypervariable loops: a combined algorithm,” PNAS, 1989, 86(23):9268-9272 (“AbM” numbering scheme) describe the methods.

[0299] The boundaries of a given CDR or FR can vary depending on the scheme used for identification. For example, the Kabat scheme is based on structural alignment, while the Chothia scheme is based on structural information. Both the Kabat and Chothia schemes number antibodies based on the length of the most common antibody region sequence, with insertions indicated by an insertion letter, such as "30a," and deletions appearing in some antibodies. These two schemes place certain insertions and deletions ("indels") in different positions, resulting in different numbering. The Contact scheme, based on analysis of the complex's crystal structure, is similar to the Chothia numbering scheme in many ways. The AbM scheme is a compromise between the Kabat and Chothia definitions, based on the definition used by Oxford Molecular's AbM antibody modeling software.

[0300] Table 7 lists exemplary site boundaries for CDR-L1, CDR-L2, CDR-L3 and CDR-H1, CDR-H2, CDR-H3 as determined by the Kabat, Chothia, AbM, and Contact schemes, respectively. For CDR-H1, residue numbering uses both the Kabat and Chothia numbering schemes. FRs are located between CDRs; for example, FR-L1 precedes CDR-L1, FR-L2 is between CDR-L1 and CDR-L2, FR-L3 is between CDR-L2 and CDR-L3, and so on. It is noteworthy that because the Kabat numbering scheme places the insertion at H35A and H35B, the end of the Chothia CDR-H1 loop varies between H32 and H34 when numbering using the Kabat numbering rules shown, depending on the loop length. 1-Kabat et al. (1991), "Sequences of Proteins of Immunological Interest," 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD 2-Al-Lazikani et al., (1997) JMB 273,927-948

[0301] Therefore, unless otherwise stated, a given antibody or its region's "CDR" or "complementarity-determining region," or a single specific CDR (such as CDR-H1, CDR-H2, CDR-H3), such as its variable region, should be understood to include the (or specific) complementarity-determining region defined by any of the above-described schemes or other known schemes. For example, in stating that a specific CDR (such as CDR-H3) contains a given V H or V L When referring to the amino acid sequence of the corresponding CDR in a regional amino acid sequence, it should be understood that such CDR has the sequence of the corresponding CDR (e.g., CDR-H3) within the variable region defined by any of the above schemes or other known schemes. In some embodiments, a specific CDR sequence is specified. Exemplary CDR sequences of the provided antibodies are described using various numbering schemes, although it is understood that the provided antibodies may include CDRs described according to any other numbering scheme described above or other numbering schemes known to those skilled in the art.

[0302] Similarly, unless otherwise stated, a FR or a single specific FR (such as FR-H1, FR-H2, FR-H3, FR-H4) for a given antibody or its region (such as a variable region) should be understood to include the frame region defined (or specific) by any known protocol. In some cases, a protocol for identifying a particular CDR, FR, or FR or CDR has been specified, for example, a CDR defined by the Kabat, Chothia, AbM, or Contact method or other known protocols. In other cases, a specific amino acid sequence of the CDR or FR is specified.

[0303] The term "variable region" or "variable domain" refers to a domain in the antibody heavy or light chain that participates in antibody-antigen binding. Natural antibody heavy and light chains (V1 and V2, respectively) H and V L The variable domains of ) typically have similar structures, with each domain consisting of four conserved frame regions (FRs) and three CDRs. (See, for example, Kindt et al., Kuby Immunology, 6th ed., WH Freeman and Co., page 91 (2007). A single V H or V L The structural domain may be sufficient to confer antigen-binding specificity. Furthermore, the V-like structures in antibodies that bind to antigens can also be utilized. H or V L Using structural domains to screen complementary V H or V LA library of domains is used to isolate antibodies that bind to specific antigens. See, for example, Portolano et al., J. Immunol. 150:880-887 (1993); Clarkson et al., Nature 352:624-628 (1991).

[0304] A single-domain antibody is an antibody fragment comprising all or part of the variable domain of the heavy chain or all or part of the variable domain of the light chain. In some embodiments, the single-domain antibody is a human single-domain antibody. In some embodiments, the CAR includes an antibody heavy chain domain that specifically binds to an antigen, such as a tumor cell or cancer cell awaiting targeting, a cancer marker of a cell or disease, or a cell surface antigen, as described in this disclosure or any known target antigen.

[0305] Antibody fragments can be produced using various techniques, including but not limited to the proteolytic digestion of intact antibodies and the production of recombinant host cells. In some embodiments, the antibody is a recombinantly produced fragment, such as a fragment containing a non-naturally occurring arrangement, such as a fragment in which two or more antibody regions or chains are linked by a synthetic linker (e.g., a peptide linker), and / or a fragment that a naturally occurring intact antibody may not be produced by enzymatic digestion. In some embodiments, the antibody fragment is an scFv.

[0306] A "humanized" antibody is an antibody in which all or substantially all of the CDR amino acid residues are derived from a non-human CDR, and all or substantially all of the FR amino acid residues are derived from human FR. Optionally, a humanized antibody may include at least a portion of the antibody constant region derived from a human antibody. A "humanized form" of a non-human antibody refers to a non-human antibody variant that has undergone humanization, typically to reduce immunogenicity to humans while retaining the specificity and affinity of the parent non-human antibody. In some embodiments, some FR residues in the humanized antibody are replaced by corresponding residues in the non-human antibody (e.g., an antibody derived from CDR residues) to, for example, restore or improve the antibody's specificity or affinity.

[0307] In some embodiments, the antigen or antigen-binding domain is CD19. In some embodiments, scFv contains V H and V L This antibody or antibody fragment is derived from an antibody or antibody fragment that is specific to CD19. In some embodiments, the CD19-binding antibody or antibody fragment is a mouse-derived antibody, such as FMC63 and SJ25C1. In some embodiments, the antibody or antibody fragment is a human antibody, as described in U.S. Patent Publication No. US 2016 / 0152723.

[0308] In some embodiments, scFv is derived from FMC63. FMC63 generally refers to a mouse monoclonal IgG1 antibody against Nalm-1 and -16 cells expressing human CD19 (Ling, NR, et al. (1987). Leucocyte typing III. 302). In some embodiments, the FMC63 antibody comprises CDR-H1 and CDR-H2 as shown in SEQ ID NO: 38 and 39, and CDR-H3 as shown in SEQ ID NO: 40 or 54; and CDR-L1 as shown in SEQ ID NO: 35, and CDR-L2 as shown in SEQ ID NO: 36 or 55, and CDR-L3 as shown in SEQ ID NO: 37 or 56. In some embodiments, the FMC63 antibody comprises a heavy chain variable region (V) containing the amino acid sequence of SEQ ID NO: 41. H ) and the light chain variable region (V) containing the amino acid sequence of SEQ ID NO:42. L ).

[0309] In some embodiments, the scFv comprises a variable light chain containing the CDR-L1 sequence of SEQ ID NO:35, the CDR-L2 sequence of SEQ ID NO:36, and the CDR-L3 sequence of SEQ ID NO:37, and / or a variable heavy chain containing the CDR-H1 sequence of SEQ ID NO:38, the CDR-H2 sequence of SEQ ID NO:39, and the CDR-H3 sequence of SEQ ID NO:40. In some embodiments, the scFv comprises the variable heavy chain region shown in SEQ ID NO:41 and the variable light chain region shown in SEQ ID NO:42. In some embodiments, the variable heavy chain and the variable light chain are connected by a connector. In some embodiments, the connector is as shown in SEQ ID NO:22, 24, or 52. In some embodiments, the scFv sequentially includes V H , connectors and V L In some implementations, the scFv sequentially includes V L , connectors and V HIn some embodiments, the scFv is encoded by the nucleotide sequence shown in SEQ ID NO:25 or a sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with SEQ ID NO:25. In some embodiments, the scFv comprises the amino acid sequence shown in SEQ ID NO:43 or a sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with SEQ ID NO:43.

[0310] In some embodiments, the scFv is derived from SJ25C1. SJ25C1 is a mouse monoclonal IgG1 antibody against Nalm-1 and -16 cells expressing human CD19 (Ling, NR, et al. (1987). Leucocyte typing III. 302). In some embodiments, the SJ25C1 antibody comprises the CDR-H1, CDR-H2, and CDR-H3 sequences shown in SEQ ID NO:47-49, and the CDR-L1, CDR-L2, and CDR-L3 sequences shown in SEQ ID NO:44-46, respectively. In some embodiments, the SJ25C1 antibody includes a heavy chain variable region (V) comprising the amino acid sequence of SEQ ID NO:50. H ) and the light chain variable region (V) containing the amino acid sequence of SEQ ID NO:51. L ).

[0311] In some embodiments, the scFv comprises a variable light chain containing the CDR-L1 sequence of SEQ ID NO:44, the CDR-L2 sequence of SEQ ID NO:45, and the CDR-L3 sequence of SEQ ID NO:46, and / or a variable heavy chain containing the CDR-H1 sequence of SEQ ID NO:47, the CDR-H2 sequence of SEQ ID NO:48, and the CDR-H3 sequence of SEQ ID NO:49. In some embodiments, the scFv comprises the variable heavy chain region shown in SEQ ID NO:50 and the variable light chain region shown in SEQ ID NO:51. In some embodiments, the variable heavy chain and the variable light chain are connected by a connector. In some embodiments, the connector is as shown in SEQ ID NO:52. In some embodiments, the scFv sequentially includes V H , connectors and V L In some implementations, the scFv sequentially includes VL , connectors and V H In some embodiments, the scFv comprises the amino acid sequence shown in SEQ ID NO:53 or a sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with SEQ ID NO:53.

[0312] In some embodiments, the chimeric antigen receptor comprises an extracellular portion containing an antibody or antibody fragment. In some aspects, the chimeric antigen receptor comprises an extracellular portion containing an antibody or fragment and an intracellular signaling domain. In some embodiments, the antibody or fragment comprises scFv. In some aspects, the chimeric antigen receptor comprises an extracellular portion containing an antibody or fragment and an intracellular signaling region. In some embodiments, the intracellular signaling region comprises an intracellular signaling domain. In some embodiments, the intracellular signaling domain is or comprises a primary signaling domain, a signaling domain capable of inducing primary activation signals in T cells, a signaling domain of a T cell receptor (TCR) component, and / or includes a signaling domain comprising an immune receptor tyrosine-based activation motif (ITAM).

[0313] In some embodiments, the antibody portion of the recombinant receptor (such as CAR) further comprises at least a portion of an immunoglobulin constant region, such as a hinge region (e.g., the IgG4 hinge region), and / or C H 1 / C L (and / or Fc region). In some embodiments, the constant region or portion is human IgG, such as IgG4 or IgG1. In some aspects, a portion of the constant region serves as a spacer between an antigen recognition component (such as scFv) and a transmembrane domain. The length of the spacer can enhance the cellular responsiveness after antigen binding compared to the absence of a spacer. Exemplary spacers include, but are not limited to, those described in the studies of Hudecek et al., (2013) Clin. Cancer Res., 19:3153, International Patent Application Publication No. WO2014031687, U.S. Patent No. 8,822,647, or Publication No. US2014 / 0271635.

[0314] In some embodiments, the constant region or portion is human IgG, such as IgG4 or IgG1. In some embodiments, the spacer has the sequence ESKYGPPCPPCP (as shown in SEQ ID NO:1) and is encoded by the sequence shown in SEQ ID NO:2. In some embodiments, the spacer comprises the sequence shown in SEQ ID NO:3. In some embodiments, the spacer comprises the sequence shown in SEQ ID NO:4. In some embodiments, the constant region or portion belongs to IgD. In some embodiments, the spacer has the sequence shown in SEQ ID NO:5. In some embodiments, the spacer has an amino acid sequence exhibiting at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or higher sequence identity with any one of SEQ ID NO:1, 3, 4, or 5. In some embodiments, the spacer is encoded by the nucleotide sequence shown in SEQ ID NO:2. In some embodiments, the spacer has the sequences shown in SEQ ID NO:26-34. In some embodiments, the spacer has an amino acid sequence exhibiting at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or higher sequence identity with any of SEQ ID NO:26-34.

[0315] In some embodiments, the antigen receptor includes an intracellular domain directly or indirectly linked to an extracellular domain. In some embodiments, the chimeric antigen receptor includes a transmembrane domain connecting an extracellular domain and an intracellular signaling domain. In some embodiments, the intracellular signaling domain includes an ITAM. For example, in some aspects, in cases where CAR and / or signaling is emitted via another cell surface receptor, the antigen recognition domain (e.g., the extracellular domain) is typically linked to one or more intracellular signaling elements, such as signaling elements mimicked by an antigen receptor complex (e.g., a TCR complex). In some embodiments, the chimeric receptor includes a transmembrane domain connected or fused between an extracellular domain (e.g., scFv) and an intracellular signaling domain. Therefore, in some embodiments, the antigen-binding component (e.g., an antibody) is linked to one or more transmembrane and intracellular signaling domains.

[0316] In one implementation, a transmembrane domain naturally associated with a domain in the receptor (such as a CAR) is used. In some cases, the transmembrane domain is selected or modified by amino acid substitution to prevent such domains from binding to transmembrane domains of the same or different surface membrane proteins, thereby minimizing interactions with other members of the receptor complex.

[0317] In some embodiments, the transmembrane domain may be derived from a natural or synthetic source. If the source is natural, the domain may, in some respects, be derived from any membrane-bound or transmembrane protein. The transmembrane region includes transmembrane regions derived from (i.e., including at least a transmembrane region) the T cell receptor α, β, or ζ chain, CD28, CD3ε, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, or CD154. Alternatively, in some embodiments, the transmembrane domain is synthetic. In some aspects, the synthetic transmembrane domain includes major hydrophobic residues such as leucine and valine. In some aspects, a phenylalanine, tryptophan, and valine triplet will appear at both ends of the synthetic transmembrane domain. In some embodiments, the connection is made via a linker, a spacer, and / or one or more transmembrane domains. In some aspects, the transmembrane domain includes the transmembrane portion of CD28.

[0318] In some embodiments, the extracellular domain and the transmembrane domain may be directly or indirectly connected. In some embodiments, the extracellular domain and the transmembrane domain are connected by a spacer, such as any spacer described in this disclosure. In some embodiments, the receptor comprises an extracellular portion of a molecule derived from the transmembrane domain, such as the extracellular portion of CD28.

[0319] Intracellular signal transduction domains include intracellular signal transduction domains that mimic or approximate signals emitted via natural antigen receptors, signals emitted via the binding of natural antigen receptors to co-stimulatory receptors, and / or signals emitted solely via co-stimulatory receptors. In some embodiments, short oligo or polypeptide linkers are present and form a connection between the transmembrane domains and cytoplasmic signal transduction domains of the CAR, such as linkers with a length between 2 and 10 amino acids, or linkers containing glycine and serine, such as glycine-serine duplexes.

[0320] In some respects, T cell activation is described as being mediated by two classes of cytoplasmic signaling sequences: one class initiates antigen-dependent primary activation via the TCR (primary cytoplasmic signaling sequences), and the other class provides secondary or co-stimulatory signals in an antigen-independent manner (secondary cytoplasmic signaling sequences). In some respects, the CAR includes one or both of these signaling components.

[0321] The receptor (such as a CAR) typically includes at least one or more intracellular signaling components. In some aspects, the CAR includes a primary cytoplasmic signaling sequence that regulates primary activation of the TCR complex. The primary cytoplasmic signaling sequence that functions in a stimulatory manner may contain a signaling motif, referred to as an activation motif based on an immune receptor tyrosine or ITAM. Examples of ITAMs include primary cytoplasmic signaling sequences derived from the CD3ζ chain, FcRγ, CD3γ, CD3δ, and CD3ε. In some embodiments, the cytoplasmic signaling molecule in the CAR includes a cytoplasmic signaling domain, a portion thereof, or a sequence derived from CD3ζ.

[0322] In some embodiments, the receptor includes an intracellular component of the TCR complex, such as the TCR CD3 chain, like the CD3ζ chain, which mediates T cell activation and cytotoxicity. Therefore, in some aspects, the antigen-binding portion is linked to one or more cell signaling modules. In some embodiments, the cell signaling module includes a CD3 transmembrane domain, a CD3 intracellular signaling domain, and / or other CD transmembrane domains. In some embodiments, the receptor (such as a CAR) further includes a portion of one or more additional molecules, such as Fc receptor γ, CD8, CD4, CD25, or CD16. For example, in some aspects, the CAR or other chimeric receptor includes a chimeric molecule between CD3-zeta (CD3-ζ) or Fc receptor γ and CD8, CD4, CD25, or CD16.

[0323] In some embodiments, upon binding to a CAR or other chimeric receptor, the cytoplasmic domain or intracellular signaling domain of the receptor activates at least one normal effector function or response of an immune cell, such as engineered T cells to express the CAR. For example, in some contexts, the CAR induces T cell functions, such as cytolytic activity or T helper activity, such as secretion of cytokines or other factors. In some embodiments, a truncated portion of the intracellular signaling domain of an antigen receptor component or co-stimulatory molecule is used to replace the complete immune stimulation chain, for example, if it transduces effector functional signals. In some embodiments, one or more intracellular signaling domains include a cytoplasmic sequence of a T cell receptor (TCR) and, in some respects, a cytoplasmic sequence of a co-receptor that synergizes with such receptors in the natural environment to initiate signal transduction upon antigen receptor binding.

[0324] In the context of a natural TCR, complete activation typically requires not only signal transduction via the TCR but also co-stimulatory signals. Therefore, in some embodiments, the CAR includes components for generating secondary or co-stimulatory signals to facilitate complete activation. In other embodiments, the CAR does not include components for generating co-stimulatory signals. In some aspects, an additional CAR is expressed in the same cell and provides components for generating secondary or co-stimulatory signals.

[0325] In some embodiments, the chimeric antigen receptor contains an intracellular domain of a T-cell co-stimulatory molecule. In some embodiments, the CAR includes a signal transduction domain and / or a transmembrane portion of a co-stimulatory receptor, such as CD28, 4-1BB, OX40, DAP10, and ICOS. In some aspects, the same CAR includes both an activating component and a co-stimulatory component. In some embodiments, the chimeric antigen receptor contains an intracellular domain derived from a T-cell co-stimulatory molecule or a functional variant thereof, such as a domain between a transmembrane domain and an intracellular signal transduction domain. In some aspects, the T-cell co-stimulatory molecule is CD28 or 41BB.

[0326] In some embodiments, the intracellular signaling domain includes a CD28 transmembrane and signaling domain connected to the CD3 (e.g., CD3-ζ) intracellular domain. In some embodiments, the intracellular signaling domain includes a chimeric CD28 and CD137 (4-1BB, TNFRSF9) co-stimulatory domain connected to the CD3ζ intracellular domain.

[0327] In some implementations, the CAR includes one or more (e.g., two or more) co-stimulatory domains and activation domains (e.g., primary activation domains) in its cytoplasmic portion. Exemplary CARs include intracellular components of CD3-ζ, CD28, and 4-1BB.

[0328] In some embodiments, the antigen receptor further includes a marker and / or cells expressing the CAR or other antigen receptor further include an alternative marker, such as a cell surface marker, which can be used to confirm the transduction or engineering of the cell expressing the receptor. In some aspects, the marker includes all or part (e.g., a truncated form) of CD34, NGFR, or an epidermal growth factor receptor, such as a truncated version of such a cell surface receptor (e.g., tEGFR). In some embodiments, the nucleic acid encoding the marker is operatively linked to a polynucleotide encoding an adapter sequence (e.g., a cleavable adapter sequence, such as T2A). For example, the marker and adapter sequence can be any marker and adapter sequence disclosed in published patent application WO2014031687. For example, the marker can be a truncated epidermal growth factor receptor (tEGFR), optionally linked to an adapter sequence, such as a T2A cleavable adapter sequence.

[0329] Exemplary polypeptides of truncated EGFR (e.g., tEGFR) comprise the amino acid sequence shown in SEQ ID NO:7 or 16, or an amino acid sequence exhibiting at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with SEQ ID NO:7 or 16. Exemplary T2A adapter sequences comprise the amino acid sequence shown in SEQ ID NO:6 or 17, or a sequence exhibiting at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with SEQ ID NO:6 or 17.

[0330] In some embodiments, the marker is a molecule or a portion thereof that is not naturally present on or on the surface of T cells, such as a cell surface protein. In some embodiments, the molecule is a non-self molecule, such as a non-self protein, i.e., a molecule that the host's immune system does not recognize as "self" after adoptive transfer of the cell.

[0331] In some embodiments, the marker has no therapeutic function and / or produces no effect other than serving as a marker for genetic engineering (e.g., for selecting successfully engineered cells). In other embodiments, the marker may be a therapeutic molecule or a molecule that otherwise produces a desired effect, such as a ligand for cells encountered in vivo, or a co-stimulatory or immune checkpoint molecule to enhance and / or inhibit cellular responses upon adoptive transfer and encounter with the ligand.

[0332] In some contexts, CAR refers to first-generation, second-generation, and / or third-generation CARs. In some respects, a first-generation CAR is a CAR that provides only CD3 chain-induced signaling upon antigen binding; in some respects, a second-generation CAR is a CAR that provides both such signals and co-stimulatory signals, such as signals from intracellular signaling domains derived from co-stimulatory receptors (e.g., CD28 or CD137); and in some respects, a third-generation CAR is a CAR that includes multiple co-stimulatory domains from different co-stimulatory receptors.

[0333] For example, in some embodiments, the CAR comprises an antibody (such as an antibody fragment), a transmembrane domain (which is or contains a transmembrane portion of CD28 or a functional variant thereof), and an intracellular signaling domain (containing signaling portions of CD28 or a functional variant thereof and signaling portions of CD3ζ or a functional variant thereof). In some embodiments, the CAR comprises an antibody (such as an antibody fragment), a transmembrane domain (which is or contains a transmembrane portion of CD28 or a functional variant thereof), and an intracellular signaling domain (containing signaling portions of 4-1BB or a functional variant thereof and signaling portions of CD3ζ or a functional variant thereof). In some such embodiments, the receptor further comprises a spacer containing an Ig molecule portion, such as a human Ig molecule, such as an Ig hinge, such as an IgG4 hinge, or a hinge-only spacer.

[0334] In some embodiments, the transmembrane domain of the recombinant receptor (e.g., CAR) is or includes the transmembrane domain of human CD28 (e.g., accession number P01747.1) or a variant thereof, such as containing the amino acid sequence shown in SEQ ID NO: 8 or an amino acid sequence exhibiting at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity with SEQ ID NO: 8; in some embodiments, the transmembrane domain portion of the recombinant receptor includes the amino acid sequence shown in SEQ ID NO: 9 or an amino acid sequence exhibiting at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity with SEQ ID NO: 9.

[0335] In some embodiments, the intracellular signaling component of the recombinant receptor (such as CAR) contains an intracellular agonist signaling domain of human CD28 or a functional variant or portion thereof, such as a domain with LL to GG substitutions at positions 186-187 of the native CD28 protein. For example, the intracellular signaling domain may comprise the amino acid sequence shown in SEQ ID NO: 10 or 11, or a sequence exhibiting at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with SEQ ID NO: 10 or 11. For example, the intracellular cell signaling domain includes an intracellular 4-1BB costimulatory signaling domain (such as accession number Q07011.1) or a functional variant or portion thereof, such as the amino acid sequence shown in SEQ ID NO:12 or a sequence that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with SEQ ID NO:12.

[0336] In some embodiments, the intracellular signaling domain of the recombinant receptor (e.g., CAR) includes a human CD3ζ stimulation signaling domain or a functional variant thereof, such as the 112AA cytoplasmic domain of human CD3ζ isotype 3 (accession number P20963.2) or a CD3ζ signaling domain, as described in U.S. Patent Nos. 7,446,190 or 8,911,993. For example, in some embodiments, the intracellular signaling domain comprises the amino acid sequence shown in SEQ ID NO: 13, 14, or 15, or a sequence exhibiting at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with SEQ ID NO: 13, 14, or 15.

[0337] In some aspects, the spacer contains only the hinge region of IgG, such as only the hinge of IgG4 or IgG1, as shown in SEQ ID NO. 1, which is a hinge-only spacer. In other embodiments, the spacer is or contains an Ig hinge, for example, an IgG4-derived hinge, optionally with C H 2 and / or C H 3. Domain Connections. In some embodiments, the spacer is connected to C. H 2 and C H 3. Ig hinges connected by structural domains, such as the IgG4 hinge, as shown in SEQ ID NO: 4. In some embodiments, the spacer is only connected to C. HA 3-domain connected Ig hinge, such as the IgG4 hinge, as shown in SEQ ID NO: 3. In some embodiments, the spacer is or includes a glycine-serine-rich sequence or other flexible linker, such as known flexible linkers.

[0338] For example, in some embodiments, the CAR includes an antibody (such as an antibody fragment, including scFv), a spacer (such as a spacer containing a portion of an immunoglobulin molecule, such as a hinge region and / or one or more constant regions of a heavy chain molecule, such as a spacer containing an Ig hinge), a transmembrane domain containing all or a portion of a CD28-derived transmembrane domain, a CD28-derived intracellular signaling domain, and a CD3ζ signaling domain. In some embodiments, the CAR includes an antibody or fragment (such as scFv), a spacer (such as any spacer containing an Ig hinge), a CD28-derived transmembrane domain, a 4-1BB-derived intracellular signaling domain, and a CD3ζ-derived signaling domain.

[0339] In a particular embodiment, the CAR is a CD19-targeting CAR comprising an scFv antigen-binding domain from FMC63; an immunoglobulin hinge spacer, a transmembrane domain, and an intracellular signal transduction domain comprising a co-stimulatory signal transduction region, which is a 4-1BB signal transduction domain and a CD3-zeta (CD3ζ) chain signal transduction domain. In some embodiments, the scFv comprises the sequence shown in SEQ ID NO:43. In some embodiments, the scFv has a VL and a VH, the VL having a CDR containing the amino acid sequences RASQDISKYLN (SEQ ID NO:35), SRLHSGV (SEQ ID NO:36), and GNTLPYTFG (SEQ ID NO:37); and the VH having a CDR containing the amino acid sequences DYGVS (SEQ ID NO:38), VIWGSETTYYNSALKS (SEQ ID NO:39), and YAMDYWG (SEQ ID NO:40). In some embodiments, the transmembrane domain has the sequence shown in SEQ ID NO:8. In some embodiments, the sequence of the transmembrane domain has a sequence identity with SEQ ID NO:8 having at least 5%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher. In some embodiments, the 4-1BB co-stimulatory domain has the amino acid sequence shown in SEQ ID NO:12. In some embodiments, the 4-1BB co-stimulatory signal transduction domain has a sequence identity with SEQ ID NO:12 having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher. In some embodiments, the CD3-ζ domain has the sequence shown in SEQ ID NO:13. In some embodiments, the CD3ζ signaling domain has a sequence with at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher sequence identity. In some embodiments, the CAR targeting CD19 binds to CD19 and, when expressed in T cells and stimulated by the CAR (e.g., bound to CD19), mediates cytokine production and / or cytotoxic activity against CD19+ target cells.

[0340] In some embodiments, the nucleic acid molecule encoding such a CAR construct further includes a sequence encoding a T2A ribosomal switching element and / or a tEGFR sequence, for example, downstream of the CAR sequence. In some embodiments, the sequence encodes a T2A ribosomal switching element as shown in SEQ ID NO:6 or 17, or a sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with SEQ ID NO:6 or 17. In some embodiments, T cells expressing an antigen receptor (such as a CAR) can also be generated to express a truncated epidermal growth factor receptor (EGFRt) as a non-immunogenic selective epitope (e.g., by introducing a construct encoding both CAR and EGFRt and separating them via a T2A ribosomal switch to express two proteins from the same construct), which is then used as a marker for detecting such cells (see, for example, U.S. Patent No. 8,802,374). In some embodiments, the sequence encodes a tEGFR sequence of the amino acid sequence shown in SEQ ID NO:7 or 16, or a tEGFR sequence of the amino acid sequence shown in SEQ ID NO:7 or 16 having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the amino acid sequence shown in SEQ ID NO:7 or 16. In some cases, the peptide (such as T2A) can cause the ribosome to skip the synthesis of the peptide bond at the C-terminus of the 2A element (ribosome skipping), thereby resulting in separation between the 2A sequence terminus and the next downstream peptide (e.g., see de Felipe. Genetic Vaccines and Ther. 2:13 (2004) and de Felipe et al. Traffic 5:616-626 (2004)). Many 2A elements are known. Examples of 2A sequences that can be used in the methods and nucleic acids disclosed in this disclosure include, but are not limited to, 2A sequences of foot-and-mouth disease virus (F2A, such as SEQ ID NO: 21), equine rhinitis A virus (E2A, such as SEQ ID NO: 20), Thosea asigna virus (T2A, such as SEQ ID NO: 6 or 17), and porcine parvovirus-1 (P2A, such as SEQ ID NO: 18 or 19), as described in U.S. Patent Publication No. 20070116690.

[0341] Recombinant cell-expressed receptors (such as CARs) administered to the subject typically recognize or specifically bind to molecules expressed in, associated with, and / or specific to, the disease or condition being treated or its cells. Upon specific binding to a molecule (such as an antigen), the receptor typically delivers an immune-stimulating signal, such as ITAM transduction signaling, to the cell, thereby promoting an immune response against the disease or condition. For example, in some embodiments, the cells express a CAR that specifically binds to antigens expressed in the disease or condition or in cells or tissues associated with the disease or condition. B. Methods of engineered cells

[0342] In certain embodiments, the engineered cells are produced through a process of producing an output composition of enriched T cells from one or more input compositions and / or from a single biological sample. In some embodiments, the output composition contains cells expressing a recombinant receptor, such as a CAR, like an anti-CD19 CAR. In certain embodiments, the cells of the output composition are suitable for administration to a subject as a therapy (such as autologous cell therapy). In some embodiments, the output composition is enriched CD4 cells. + or CD8 + Composition of T cells.

[0343] In some embodiments, the process of generating or producing engineered cells is carried out by a method comprising some or all of the following steps: collecting or acquiring a biological sample; isolating, selecting, or enriching input cells from the biological sample; cryopreserving and storing the input cells; thawing and / or incubating the input cells under stimulating conditions; engineering the stimulated cells to express or contain recombinant polynucleotides, such as polynucleotides encoding recombinant receptors (e.g., CARs); culturing the engineered cells, such as culturing to a threshold amount, density, or expansion; formulating the cultured cells into an output composition; and / or cryopreserving and storing the formulated output cells until the cells are released for infusion and / or suitable for administration to a subject. In some embodiments, the process is carried out using an input composition of two or more enriched T cells, such as separate CD4+. + Composition and separate CD8 + The composition, which is separately processed and engineered from the same starting or initial biological sample and in a defined ratio (e.g., 1:1 ratio of CD4) + With CD8 + The enriched T cells are then infused into the subject. In some embodiments, the enriched T cells are or include engineered T cells, such as T cells transduced to express a recombinant receptor.

[0344] In certain embodiments, the output composition of engineered cells expressing recombinant receptors (such as anti-CD19 CAR) is generated from the cells' initial and / or input compositions. In some embodiments, the input composition is enriched T cells, enriched CD4+, etc. + T cells and / or enriched CD8 + The T cell composition (hereinafter referred to as enriched T cell composition, enriched CD4, etc.) + T cell composition and enriched CD8 + T-cell composition). In some embodiments, CD4-rich + The T-cell composition contains at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 99.9% CD4+. + T cells. In a specific implementation, CD4 enrichment is used. + The T-cell composition contains 100% CD4. + T cells contain approximately 100% CD4+. + T cells. In some embodiments, the composition enriched with T cells includes or contains less than 20%, less than 10%, less than 5%, less than 1%, less than 0.1%, or less than 0.01% CD8+. + T cells, and / or lack of CD8 + T cells, and / or no or virtually no CD8 + T cells. In some embodiments, the cell population is primarily composed of CD4+ cells. + T cell composition. In some implementations, CD8-rich... + The T-cell composition contains at least 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 99.9% CD8+. + T cells, or cells containing approximately 100% CD8+. + T cells. In some implementations, enriched CD8... + The T-cell composition includes or contains less than 20%, less than 10%, less than 5%, less than 1%, less than 0.1%, or less than 0.01% CD4. + T cells, and / or lack of CD4 + T cells, and / or no or virtually no CD4 + T cells. In some embodiments, the cell population is primarily composed of CD8+ cells. + T cells are the main components of this structure.

[0345] In some embodiments, the process of generating engineered cells may further include one or more of the following: activating and / or stimulating cells, such as cells into which the composition is introduced; genetically engineering the activated and / or stimulated cells, such as by introducing polynucleotides encoding recombinant proteins via transduction or transfection; and / or culturing the engineered cells, such as under conditions that promote proliferation and / or expansion. In specific embodiments, the provided methods can be used to harvest, collect, and / or formulate output compositions resulting from cells after incubation, activation, stimulation, engineering, transduction, transfection, and / or culture.

[0346] In some embodiments, the engineered cells used, such as cells expressing the anti-CD19 CAR, depending on the provided methods and uses, are produced or generated through processes of screening, isolating, activating, stimulating, expanding, culturing, and / or formulating cells. In some embodiments, such methods include any of the methods described in this disclosure.

[0347] In some implementations, the engineered cells used, such as cells expressing the anti-CD19 CAR, depending on the provided methods and uses, are produced or generated by exemplary processes described, for example, in WO 2019 / 089855 and WO 2015 / 164675.

[0348] In some embodiments, engineered cells (such as cells expressing the described anti-CD19 CAR) or compositions containing such cells (such as engineered CD4 cells each expressing the same anti-CD19 chimeric antigen receptor (CAR)) are generated, produced, or manufactured. + T cells and engineered CD8 + An exemplary process for a T-cell composition involves enriching CD4 + Cell population and enriched CD8 + Cell populations are placed in various process steps. In some aspects of an exemplary process for generating or manufacturing engineered cells, CD4... + and CD8 + Cells were separated from, for example, human peripheral blood mononuclear cells (PBMCs) obtained through leukocyte removal, and isolated enriched CD4+ cells were generated. + and enriched CD8 + Cell composition. In some respects, these cells can be cryopreserved. In some respects, the CD4... + and CD8 + The composition can then be thawed and used separately for stimulation, transduction, and amplification steps.

[0349] In some aspects of the exemplary process of generating or manufacturing engineered cells, the thawed CD4 cells are separately processed. + and CD8 +Cells are stimulated, for example, in the presence of paramagnetic polystyrene-coated beads conjugated with anti-CD3 and anti-CD28 antibodies (e.g., beads to cells in a 1:1 ratio). In some aspects, the stimulation is performed in a culture medium containing recombinant human IL-2, recombinant human IL-15, and N-acetylcysteine ​​(NAC). In some aspects, CD4... + The cell culture medium may also include recombinant human IL-7.

[0350] In some aspects of the exemplary process of generating or manufacturing engineered cells, after the introduction of magnetic beads, CD4 is transduced separately using a lentiviral vector encoding the same CAR (such as the same anti-CD19 CAR). + and CD8 + Cells. In some aspects, the CAR may comprise an anti-CD19 scFv derived from a murine antibody, an immunoglobulin spacer, a transmembrane domain derived from CD28, a co-stimulatory region derived from 4-1BB, and a CD3-ζ intracellular signal transduction domain. In some aspects, the vector may encode a truncated receptor as an alternative marker for CAR expression, the receptor being linked to the CAR construct via a T2A sequence. In some aspects of the exemplary procedure, the cells are transduced in the presence of 10 μg / ml proteinamine sulfate.

[0351] In some aspects of exemplary processes for generating or manufacturing engineered cells, magnetic beads are removed from the cell composition by exposure to a magnetic field after transduction. In some aspects, the CD4... + and CD8 + The cell composition was cultured for amplification in a bioreactor (e.g., a Xuri W25 bioreactor) under continuous mixing and oxygen transfer conditions. In some cases, poloxamer was added to the medium. In some aspects, the CD4... + and CD8 + Both cell compositions were cultured in the presence of IL-2 and IL-15. In some respects, the CD4... + The cell culture medium also includes IL-7. In some cases, the CD4... + and CD8 + Cells are cultured individually to a 4-fold expansion before harvest. In some respects, cells from each composition can be harvested, formulated, or cryopreserved separately one day after reaching a threshold. In other respects, engineered cells (such as cells expressing the stated anti-CD19 CAR) or compositions containing such cells (such as engineered CD4 cells each expressing the same anti-CD19 chimeric antigen receptor (CAR)) are generated, produced, or manufactured. + T cells and engineered CD8 + An exemplary process for a T-cell composition includes the process described in Table 8 below. Table 8. Generating CD4 + and CD8 + Exemplary process of CAR-T cells *approximation

[0352] In other respects, different exemplary processes for generating, producing, or manufacturing engineered cells or compositions containing such cells include processes that differ from the exemplary processes described above in that NAC is not added to the culture medium during stimulation; CD4 + The cell culture medium does not contain IL-2; cells are stimulated at a magnetic bead to cell ratio of 3:1; cells are transduced with a high concentration of protein sulfate; magnetic beads are removed around day 7; expansion is performed under static conditions, i.e., without continuous mixing or perfusion (such as semi-continuous and / or stepwise perfusion), and without the use of poloxamer.

[0353] In some implementations, at least one enriched CD4 + A single composition of T cells and at least one enriched CD8 + The individual composition of T cells is isolated, screened, enriched, or obtained from a single biological sample, such as PBMCs or other white blood cell samples from the same donor (e.g., a patient or healthy individual). In some embodiments, enriched CD4... + Individual compositions of T cells and enriched CD8 + The individual composition of T cells is initially isolated, selected, and / or enriched from the same biological sample, such as a single biological sample obtained, collected, and / or extracted from a single subject. In some embodiments, the biological sample is first subjected to CD4... + T-cell selection, retaining both negative and positive components, followed by further CD8 assay on the negative components. + T-cell selection. In other implementations, the biological sample is first subjected to CD8... + T cell selection involves preserving both negative and positive components, followed by further CD44 assay on the negative components. + T cell selection. In some embodiments, the selection method is performed as described in International PCT Publication No. WO2015 / 164675. In some embodiments, the selection method is performed as described in International PCT Publication No. WO 2019 / 089855. In some aspects, the biological sample is first subjected to CD8... + Positive selection of T cells to produce at least one enriched CD8 + The composition of T cells, followed by CD4 in the negative fraction. + Positive selection of T cells to produce at least one enriched CD4 +The composition of T cells results in at least one enriched CD8 + The composition of T cells and at least one enriched CD4 + The T cell composition is a single composition derived from the same biological sample (e.g., from the same donor patient or healthy individual). In some aspects, it may be two or more separate enriched T cell compositions (e.g., at least one is enriched CD4). + T cell composition, and at least one of which is enriched CD8 from the same donor. + T cells (individual compositions) are frozen individually, for example, cryopreserved or cryopreserved in a cryopreservation medium.

[0354] In some respects, two or more isolated enriched T cell compositions from the same biological sample (e.g., at least one is enriched for CD4) + T cell composition, at least one of which is an isolated enriched CD8 + T cell compositions activate and / or stimulate T cells through contact with a stimulant (e.g., by incubation with CD3 / CD28 conjugated magnetic beads to activate T cells). In some aspects, each activation / stimulation cell composition is engineered, transduced, and / or transfected, for example using a viral vector encoding a recombinant protein (such as CAR), to induce T cell activation in the CD4+ of each cell composition. + T cells and CD8 + The same recombinant protein is expressed in T cells. In some aspects, the method includes removing stimulants, such as magnetic beads, from the cell composition. In some aspects, it contains engineered CD4. + T cell composition and containing engineered CD8 + The T cell composition is cultured separately, for example, for the purpose of separately amplifying CD4. + T cells and CD8 + T cell population. In some embodiments, cell compositions are harvested and / or collected and / or formulated from the culture medium, for example by washing the cell compositions in a formulation buffer. In some embodiments, CD4 will be included. + T cell formulation and cell composition containing CD8 + T-cell formulations are frozen, for example, cryopreserved or cryopreserved in a cryopreservation medium. In some respects, engineered CD4 in each formulation... + T cells and CD8 + T cells are derived from the same donor or biological sample and express the same recombinant protein (e.g., CAR, such as anti-CD19 CAR). In some respects, engineered CD4 cells are isolated. + Engineering of formulation and separation CD8 +The formulation is administered to the required subject in a defined ratio (e.g., 1:1) as with a single donor. 1. Preparation of cells and cells for genetic engineering

[0355] In some embodiments, the cells used in conjunction with the provided methods, uses, articles, or compositions, such as T cells, are cells that have been genetically engineered to express recombinant receptors such as CAR or TCR as described in this disclosure. In some embodiments, the engineered cells are used in cell therapies, such as adoptive cell therapy. In some embodiments, the engineered cells are immune cells. In some embodiments, the engineered cells are T cells, such as CD4 cells. + or CD8 + T cells.

[0356] In some embodiments, the nucleic acid (such as the nucleic acid encoding a recombinant receptor) is heterologous, i.e., not normally present in cells or samples obtained from cells, such as samples obtained from another organism or cell, for example, not normally present in engineered cells and / or organisms derived from such cells. In some embodiments, the nucleic acid is not naturally occurring, such as nucleic acids not found in nature, including chimeric combinations of nucleic acids encoding various domains from multiple different cell types.

[0357] The cells are typically eukaryotic cells, such as mammalian cells, typically human cells. In some embodiments, the cells are derived from blood, bone marrow, lymph nodes, or lymphoid organs, and are cells of the immune system, such as innate or adoptive immune cells, such as myeloid cells or lymphoid cells, including lymphocytes, typically T cells and / or NK cells. Other exemplary cells include stem cells, such as pluripotent stem cells and multipotent stem cells, including induced pluripotent stem cells (iPSCs). The cells are typically primary cells, such as cells isolated directly from the subject and / or cells isolated from and frozen from the subject. In some embodiments, the cells include one or more T cell subsets or other cell types, such as the entire T cell population, CD4+, etc. + Cells, CD8 +Cells and their subpopulations, such as those defined based on function, activation state, maturity, differentiation potential, expansion, recycling, localization and / or persistence, antigen specificity, antigen receptor type, presence in a specific organ or compartment, marker or cytokine secretion, and / or degree of differentiation. For the subject to be treated, the cells may be allogeneic and / or autologous. Methods described in this disclosure include off-the-shelf methods. In some aspects, such as off-the-shelf techniques, the cells are pluripotent and / or multipotent, such as stem cells, such as induced pluripotent stem cells (iPSCs). In some embodiments, the methods include isolating cells from the subject, preparing, processing, culturing and / or engineering the cells, and re-infusing the cells into the same subject before or after cryopreservation.

[0358] T cells and / or CD4 + and / or CD8 + T cell subtypes and subsets include naive T cells (TN cells), effector T cells (T cells), and other T cells. EFF ), memory T cells and their subtypes, such as stem cell memory T (T) SCM ), central memory T(T) CM ), effect memory T (T EM Effector memory T cells or terminally differentiated T cells, tumor-infiltrating lymphocytes (TILs), immature T cells, mature T cells, helper T cells, cytotoxic T cells, mucosa-associated invariant T (MAIT) cells, naturally occurring adoptive regulatory T (Treg) cells, helper T cells such as TH1 cells, TH2 cells, TH3 cells, TH17 cells, TH9 cells, TH22 cells, follicular helper T cells, α / β T cells, and δ / γ T cells.

[0359] In some embodiments, the cells are natural killer (NK) cells. In some embodiments, the cells are monocytes or granulocytes, such as myeloid cells, macrophages, neutrophils, dendritic cells, mast cells, eosinophils, and / or basophils.

[0360] In some embodiments, the cell includes one or more nucleic acids introduced through genetic engineering, and recombinant or genetically engineered products thereby expressing such nucleic acids. In some embodiments, the nucleic acid is a heterologous nucleic acid, i.e., a nucleic acid that is not normally present in cells or samples obtained from cells, such as nucleic acids obtained from another organism or cell, for example, nucleic acids that are not normally present in engineered cells and / or organisms from which such cells are derived. In some embodiments, the nucleic acid is not naturally occurring, e.g., non-naturally occurring nucleic acids, including chimeric combinations of nucleic acids encoding various domains from multiple different cell types.

[0361] In some embodiments, the preparation of the engineered cells includes one or more culture and / or preparation steps. Cells intended for the delivery of nucleic acids encoding a transgenic receptor (such as a CAR) can be isolated from a sample such as a biological sample, for example, from a sample obtained from or derived from a subject. In some embodiments, the subject from whom the cells are isolated is a subject with a disease or condition, a subject requiring cell therapy, or a subject who will receive cell therapy. In some embodiments, the subject is a person requiring a specific therapeutic intervention, such as adoptive cell therapy in which engineered cells are being isolated, processed, and / or engineered.

[0362] Therefore, in some embodiments, the cells are primary cells, such as human primary cells. The samples include tissues, fluids, and other samples taken directly from the subject, as well as samples that have undergone one or more process steps (such as separation, centrifugation, genetic engineering (e.g., transduction with a viral vector), washing, and / or incubation). The biological samples can be samples obtained directly from a biological source or can be processed samples. Biological samples include, but are not limited to, bodily fluids such as blood, plasma, serum, cerebrospinal fluid, synovial fluid, urine, and sweat, and tissue and organ samples, including processed samples derived therefrom.

[0363] In some respects, the sample from which cells are derived or isolated is blood or a blood-derived sample, or a product derived from cell isolation or leukocyte removal. Exemplary samples include whole blood, peripheral blood mononuclear cells (PBMCs), leukocytes, bone marrow, thymus, tissue biopsy, tumors, leukemia, lymphoma, lymph nodes, intestinal-associated lymphoid tissue, mucosa-associated lymphoid tissue, spleen, other lymphoid tissue, liver, lungs, stomach, intestines, colon, kidneys, pancreas, breast, bone, prostate, cervix, testes, ovaries, tonsils, or other organs, and / or cells derived therefrom. In the context of cell therapy (such as adoptive cell therapy), samples include autologous and allogeneic samples.

[0364] In some embodiments, the cells are derived from cell lines, such as T cell lines. In some embodiments, the cells are obtained from xenogeneic sources, such as mice, rats, non-human primates, and pigs.

[0365] In some embodiments, cell isolation includes one or more preparative and / or affinity-based cell isolation steps. In some instances, cells are washed, centrifuged, and / or incubated in the presence of one or more reagents, for example, to remove unwanted components, enrich desired components, lyse, or remove cells sensitive to a specific reagent. In some instances, cells are isolated based on one or more specific criteria, such as density, adhesion properties, size, sensitivity to a specific component, and / or resistance.

[0366] In some instances, cells may be obtained from the subject's circulating blood, for example, through cell separation or leukocyte removal. In some aspects, the sample contains lymphocytes, including T cells, monocytes, granulocytes, B cells, other nucleated leukocytes, erythrocytes, and / or platelets, and in some aspects also contains cells other than erythrocytes and platelets.

[0367] In some embodiments, blood cells collected from a subject are washed, for example, to remove the plasma fraction, and the cells are place...

Claims

1. A method of treating a subject with large B-cell lymphoma (LBCL), the method comprising administering to the subject a dose of autologous genetically modified T cells directed against CD19, wherein: (a) the LBCL is selected from the group consisting of diffuse large B-cell lymphoma (DLBCL), high-grade B-cell lymphoma, primary mediastinal large B-cell lymphoma, and grade 3B follicular lymphoma; (b) The dosage comprises a CD4 positive expression of a chimeric antigen receptor (CAR) that binds to CD19. + T cells and the CAR positively expressed CD8 + T cells; (c) The dosage is 44×10 6 Up to 120×10 6 CAR-positive live T cells; and (d) the subject: (i) refractory within 12 months of initial therapy; or (ii) relapsed within 12 months of initial therapy.

2. The method of claim 1, wherein the initial therapy is first-line chemoimmunotherapy.

3. A method of treating a subject with large B-cell lymphoma (LBCL), the method comprising administering to the subject a dose of autologous genetically modified T cells directed against CD19, wherein: (a) the LBCL is selected from the group consisting of diffuse large B-cell lymphoma (DLBCL), high-grade B-cell lymphoma, primary mediastinal large B-cell lymphoma, and grade 3B follicular lymphoma; (b) The dosage comprises a CD4 positive expression of a chimeric antigen receptor (CAR) that binds to CD19. + T cells and the CAR positively expressed CD8 + T cells; (c) The dosage is 40×10 6 Up to 120×10 6 CAR-positive live T cells; and (d) the subject: (i) have disease refractory to first-line chemoimmunotherapy; (ii) relapsed within 12 months of first-line chemoimmunotherapy; (iii) have disease refractory to first-line chemoimmunotherapy and are not eligible for hematopoietic stem cell transplantation (HSCT); or (iv) Relapsed after first-line chemoimmunotherapy and not eligible for hematopoietic stem cell transplantation (HSCT).

4. The method of claim 3, wherein the subject (i) suffers from a disease refractory to first-line chemoimmunotherapy.

5. The method of claim 3, wherein the subject (ii) has relapsed within 12 months of first-line chemoimmunotherapy.

6. The method of claim 3, wherein the subject (iii) has disease refractory to first-line chemoimmunotherapy and is not eligible for hematopoietic stem cell transplantation (HSCT).

7. The method of claim 3, wherein the subject (iv) has relapsed after first-line chemoimmunotherapy and is not eligible for hematopoietic stem cell transplantation (HSCT).

8. The method of any one of claims 3, 6 and 7, wherein the subject is not eligible for HSCT due to comorbidities or age.

9. The method of claim 8, wherein the comorbidity comprises impaired lung function.

10. The method of claim 8 or claim 9, wherein the comorbidity comprises an adjusted diffusing capacity of the lung for carbon monoxide (DLCO) of about 60% or less.

11. The method of any one of claims 8-10, wherein the comorbidity comprises impaired cardiac function.

12. The method of any one of claims 8-11, wherein the comorbidity comprises a left ventricular ejection fraction (LVEF) of less than about 50%.

13. The method of any one of claims 8-12, wherein the comorbidity comprises impaired renal function.

14. The method of any one of claims 8-13, wherein the comorbidity comprises a calculated creatinine clearance of less than about 60 milliliters per minute (mL / min).

15. The method of any one of claims 8-14, wherein the comorbidity comprises impaired liver function.

16. The method of any one of claims 8-15, wherein the comorbidity comprises aspartate aminotransferase (AST) greater than about two times the upper limit of normal (ULN).

17. The method of any one of claims 8-16, wherein the comorbidity comprises an alanine aminotransferase (ALT) greater than about two times the upper limit of normal (ULN).

18. The method of any one of claims 8-17, wherein the comorbidities include an Eastern Cooperative Oncology Group (ECOG) performance status of 2.

19. The method of any one of claims 1-18, wherein the subject is an adult, optionally at least 18 years old.

20. The method of any one of claims 1-19, wherein the subject is not 75 years of age or older.

21. The method of any one of claims 8-19, wherein the subject is not eligible for HSCT due to the subject being 70 years of age or older.

22. The method according to any one of claims 3, 4, 6 and 8-21, wherein the subject belongs to (i) or (iii), and the refractory disease is a primary refractory disease.

23. The method according to any one of claims 3, 5 and 7-22, wherein the subject belongs to (ii) or (iv), and the relapse of the subject is after the subject achieves a complete response (CR) to first-line chemoimmunotherapy.

24. The method of any one of claims 3, 5, and 7-23, wherein the subject belongs to (ii) or (iv), and the subject's relapse is after the subject achieves a partial response (PR) to first-line chemoimmunotherapy.

25. The method according to any one of claims 3 and 7-24, wherein the subject belongs to (iv) and the relapse of the subject is within 12 months of the first-line chemoimmunotherapy.

26. The method according to any one of claims 3 and 7-24, wherein the subject belongs to (iv) and the relapse of the subject is more than 12 months after the first-line chemoimmunotherapy.

27. A method of treating a subject with large B-cell lymphoma (LBCL), the method comprising administering to the subject a dose of autologous genetically modified T cells directed against CD19, wherein: (a) the LBCL is selected from the group consisting of diffuse large B-cell lymphoma (DLBCL), high-grade B-cell lymphoma, primary mediastinal large B-cell lymphoma, and grade 3B follicular lymphoma; (b) The dosage comprises a CD4 positive expression of a chimeric antigen receptor (CAR) that binds to CD19. + T cells and the CAR positively expressed CD8 + T cells; (c) The dosage is 44×10 6 Up to 120×10 6 CAR-positive live T cells; and (d) The subject suffers from a disease that is refractory to first-line chemoimmunotherapy.

28. A method of treating a subject with large B-cell lymphoma (LBCL), the method comprising administering to the subject a dose of autologous genetically modified T cells directed against CD19, wherein: (a) the LBCL is selected from the group consisting of diffuse large B-cell lymphoma (DLBCL), high-grade B-cell lymphoma, primary mediastinal large B-cell lymphoma, and grade 3B follicular lymphoma; (b) The dosage comprises a CD4 positive expression of a chimeric antigen receptor (CAR) that binds to CD19. + T cells and the CAR positively expressed CD8 + T cells; (c) The dosage is 44×10 6 Up to 120×10 6 CAR-positive live T cells; and (d) the subject relapses within 12 months of first-line chemoimmunotherapy.

29. A method of treating a subject with large B-cell lymphoma (LBCL), the method comprising administering to the subject a dose of autologous genetically modified T cells directed against CD19, wherein: (a) the LBCL is selected from the group consisting of diffuse large B-cell lymphoma (DLBCL), high-grade B-cell lymphoma, primary mediastinal large B-cell lymphoma, and grade 3B follicular lymphoma; (b) The dosage comprises a CD4 positive expression of a chimeric antigen receptor (CAR) that binds to CD19. + T cells and the CAR positively expressed CD8 + T cells; (c) The dosage is 44×10 6 Up to 120×10 6 CAR-positive live T cells; and (d) The subject has disease refractory to first-line chemoimmunotherapy and is not eligible for hematopoietic stem cell transplantation (HSCT).

30. A method of treating a subject with large B-cell lymphoma (LBCL), the method comprising administering to the subject a dose of autologous genetically modified T cells directed against CD19, wherein: (a) the LBCL is selected from the group consisting of diffuse large B-cell lymphoma (DLBCL), high-grade B-cell lymphoma, primary mediastinal large B-cell lymphoma, and grade 3B follicular lymphoma; (b) The dosage comprises a CD4 positive expression of a chimeric antigen receptor (CAR) that binds to CD19. + T cells and the CAR positively expressed CD8 + T cells; (c) The dosage is 44×10 6 Up to 120×10 6 CAR-positive live T cells; and (d) The subject has relapsed after first-line chemoimmunotherapy and is not eligible for hematopoietic stem cell transplantation (HSCT).

31. The method of claim 30, wherein the subject's relapse is within 12 months of first-line chemoimmunotherapy.

32. The method of claim 30, wherein the subject's relapse is more than 12 months after the first-line chemoimmunotherapy.

33. The method according to any one of claims 1 to 32, wherein the dose is 90×10 6 Up to 110×10 6 CAR-positive live T cells, optionally wherein the dose is 100×10 6 CAR-positive live T cells.

34. The method according to any one of claims 1-33, wherein the CAR-positive CD4 + T cells and the CAR-positive CD8 + T cells are approximately 1:1 CAR-positive live CD4 + T cells with CAR positive live CD8 + A ratio of T cells is administered to the subject.

35. The method of any one of claims 1-34, wherein the DLBCL not otherwise specified is DLBCL arising from an indolent lymphoma.

36. The method of any one of claims 1-35, wherein the first-line chemoimmunotherapy is rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisone (R-CHOP).

37. The method of claim 36, wherein R-CHOP is administered to the subject in 14-day cycles (R-CHOP 14).

38. The method of claim 36, wherein R-CHOP is administered to the subject in 21 day cycles (R-CHOP21).

39. The method of any one of claims 1-35, wherein the first-line chemoimmunotherapy is modified R-CHOP, wherein rituximab is replaced by another anti-CD20 monoclonal antibody, optionally wherein obinutuzumab or vincristine is replaced by polatuzumab vedotin.

40. The method of any one of claims 1-35, wherein the first-line chemoimmunotherapy is rituximab, dexamethasone, cytarabine, and cisplatin (R-DHA).

41. The method of any one of claims 1-35, wherein the first-line chemoimmunotherapy is rituximab, ifosfamide, carboplatin, and etoposide (R-ICE).

42. The method of any one of claims 1-35, wherein the first-line chemoimmunotherapy is rituximab, gemcitabine, dexamethasone and cisplatin (R-GDP).

43. The method of any one of claims 40-42, wherein first-line chemoimmunotherapy is administered to the subject for 3 cycles.

44. The method of any one of claims 1-39, wherein first-line chemoimmunotherapy is administered to the subject for 3-8 cycles.

45. The method of any one of claims 1-39 and 44, wherein first-line chemoimmunotherapy is administered to the subject for greater than 4 cycles.

46. ​​The method of any one of claims 1-39 and 44-45, wherein first-line chemoimmunotherapy is administered to the subject for 6 cycles or about 6 cycles.

47. The method of any one of claims 1-35, wherein the first-line chemoimmunotherapy is rituximab, doxorubicin, cyclophosphamide, vindesine, bleomycin, and prednisone (R-ACVBP).

48. The method of any one of claims 1-35, wherein the first-line chemoimmunotherapy is dose-adjusted etoposide, prednisone, vincristine, cyclophosphamide, doxorubicin, and rituximab (DA-EPOCH-R).

49. The method of any one of claims 1-48, wherein the subject does not have primary central nervous system (CNS) lymphoma.

50. The method according to any one of claims 1-49, wherein the CAR-positive CD4 + T cells and the CAR-positive CD8 + The T cells are administered to the subject in separate compositions.

51. The method according to claim 50, wherein the CAR-positive CD8 + The composition of T cells contains the CAR-positive CD4 + The composition of T cells was previously administered to the subject.

52. The method of claim 50 or claim 51, wherein a CD8 + Administration of the composition and the CAR-positive CD4 + The interval between administrations of the composition of T cells is no more than about 12 hours, no more than about 6 hours, no more than about 4 hours, no more than about 2 hours, no more than about 1 hour, or no more than about 30 minutes.

53. The method according to any one of claims 50-52, wherein a CD8 + Administration of the composition and the CAR-positive CD4 + The interval between administrations of the composition of T cells does not exceed about 30 minutes.

54. The method according to any one of claims 50-53, wherein a CD8 + Administration of the composition and the CAR-positive CD4 + The interval between administrations of the composition of T cells is about 15 minutes or less.

55. The method of any one of claims 1-54, wherein the dose of autologous genetically modified T cells against CD19 is provided in a formulation comprising a cryoprotectant.

56. The method of claim 55, wherein the formulation comprises dimethyl sulfoxide (DMSO).

57. The method of claim 55 or claim 56, wherein the formulation comprises albumin, optionally human albumin.

58. The use according to any one of claims 1-57, wherein the dose of autologous genetically modified T cells against CD19 is cryopreserved prior to administration to the subject.

59. The method of claim 58, wherein the cryopreserved dose of autologous genetically modified T cells directed against CD19 is thawed prior to administration to the subject.

60. The method of claim 59, wherein the dose of autologous genetically modified T cells directed against CD19 is administered to the subject within 2 hours of thawing.

61. The method of any one of claims 1-60, wherein the dose of autologous genetically modified T cells against CD19 is administered to the subject by intravenous infusion.

62. The method of any one of claims 1-61, wherein the CAR comprises an extracellular antigen binding domain that binds CD19, a transmembrane domain, and an intracellular signaling domain.

63. The method of claim 62, wherein the extracellular antigen binding domain is a single chain variable fragment (scFv) derived from the FMC63 monoclonal antibody.

64. The method of claim 62 or claim 63, wherein the transmembrane domain is the CD28 transmembrane domain.

65. The method of any one of claims 62-64, wherein the intracellular signaling domain comprises a 4-1BB co-stimulatory domain and a CD3 zeta activation domain.

66. A method according to any one of claims 62-65, wherein the CAR comprises a single-chain variable fragment (scFv) derived from the FMC63 monoclonal antibody, an IgG4 hinge region, a 47-CD28 transmembrane domain, a 4-1BB (CD137) co-stimulatory domain, and a CD3ζ activation domain in order from N-terminus to C-terminus.

67. The method of any one of claims 62-66, wherein the extracellular antigen binding domain comprises the amino acid sequence shown in SEQ ID NO:

43.

68. The method of any one of claims 62-67, wherein the transmembrane domain comprises the amino acid sequence shown in SEQ ID NO:

8.

69. The method of any one of claims 65-68, wherein the 4-1BB co-stimulatory domain comprises the amino acid sequence shown in SEQ ID NO:

12.

70. The method of any one of claims 65-69, wherein the CD3 zeta signaling domain comprises the amino acid sequence shown in SEQ ID NO:

13.

71. The method of any one of claims 1-70, wherein the CAR comprises the amino acid sequence shown in SEQ ID NO:

59.

72. The method of any one of claims 1-71, wherein the dose of autologous genetically modified T cells against CD19 express a non-functional truncated epidermal growth factor receptor (EGFRt).

73. The method of any one of claims 1-72, further comprising administering to the subject a lymphodepletion regimen of fludarabine and cyclophosphamide prior to administering to the subject the dose of autologous genetically modified T cells against CD19.

74. The method of any one of claims 1-73, wherein the subject has been administered a lymphodepleting regimen of fludarabine and cyclophosphamide at the dose at which the autologous CD19-targeted genetically modified T cells are administered.

75. The method of claim 73 or claim 74, wherein the lymphocyte depletion regimen comprises fludarabine 30 g / m 2 / day intravenous (IV) and cyclophosphamide 300 g / m 2 / day IV administration, each lasting 3 days.

76. The method of any one of claims 73-75, wherein the lymphocyte depletion regimen is administered to the subject between about 2 days and about 7 days prior to administering the dose of autologous genetically modified T cells against CD19 to the subject.

77. The method of any one of claims 1-76, wherein the subject has been administered acetaminophen prior to administration of the dose of autologous genetically modified T cells against CD19, optionally between about 30 minutes to about 60 minutes prior to administration of the dose of autologous genetically modified T cells against CD19.

78. The method of claim 77, wherein the subject has been administered about 650 mg of acetaminophen.

79. The method of claim 77 or claim 78, wherein the acetaminophen is administered orally.

80. The method of claim 79, wherein the subject has been administered an H1 antihistamine prior to administration of the dose of autologous genetically modified T cells directed against CD19, optionally between about 30 minutes to about 60 minutes prior to administration of the dose of autologous genetically modified T cells directed against CD19.

81. The method of claim 80, wherein the H1 antihistamine is diphenhydramine, optionally wherein the subject has been administered between about 25 mg to about 50 mg of diphenhydramine.

82. The method of claim 80 or claim 81, wherein the H1 antihistamine is administered intravenously or orally.

83. The method of any one of claims 1-82, wherein the subject is not pregnant.

84. The method of any one of claims 1-83, wherein the dose of autologous genetically modified T cells against CD19 is obtained from the subject by leukapheresis.

85. The method of claim 84, wherein the subject has been administered bridging therapy after leukapheresis and prior to administration of the dose of autologous genetically modified T cells directed against CD19.

86. The method of claim 85, wherein the bridging therapy is chemotherapy or radiation therapy.

87. The method of any one of claims 1-86, wherein the dose of autologous genetically modified T cells against CD19 is administered to the subject via inpatient management.

88. The method of any one of claims 1-86, wherein the dose of autologous genetically modified T cells against CD19 is administered to the subject via outpatient administration.

89. The method of any one of claims 1-88, wherein the subject has an ECOG performance status of 0, 1, or 2.

90. The method of any one of claims 1-89, wherein the subject has an ECOG performance status of 0.

91. The method of any one of claims 1-89, wherein the subject has an ECOG performance status of 1.

92. The method of any one of claims 1-89, wherein the subject has an ECOG performance status of 2.

Images