Variant allele enrichment by unidirectional dual probe primer extension

Abstract

The present disclosure provides a method for enriching at least one target nucleic acid in a library of nucleic acids. The present disclosure also relates to a faster and easier method for target capture using a primer extension reaction that can improve ease of use, turnaround time, and variant allele specificity by designing a target enrichment primer to specifically enrich library fragments based on the relative position of variant bases in the primer, a polymerase with better initiation specificity is utilized to design a mutant base in a capture primer, design a mutant base in a release primer, and / or design a mutant specific primer for both a positive chain and a negative chain of a target library fragment.

Description

[0001] Statement regarding sequence listing

[0002] The sequence listing associated with this application is provided in XML format in lieu of a paper copy and is hereby incorporated by reference into the specification. The name of the XML file containing the sequence listing is P37667-WO_sequence_listing.xml. The XML file is 32.3KB, was created on July 5, 2023, and is being submitted electronically. Technical Field

[0003] The present disclosure generally relates to the enrichment of nucleic acid targets in samples, and more specifically, to the enrichment of targets for nucleic acid sequencing (including high-throughput sequencing).Even more specifically, the present disclosure relates to the enrichment of specific variant alleles by unidirectional dual probe primer extension. Background Art

[0004] The present invention belongs to a class of technologies that allow users to focus on target regions in nucleic acids to be sequenced. This reduces the costs associated with sequencing reactions and subsequent data analysis. There are currently three general types of technologies that selectively capture target regions in nucleic acids present in samples. The first technology is hybrid capture, in which the target region is captured by hybridization of probes that can selectively bind to a capture surface. This capture allows the removal of non-target nucleic acids, and then releases and collects the captured target molecules. The advantages of this type of technology include the ability to capture regions of exon group size and regions containing unknown structural variations. Disadvantages include long and complex protocols that tend to take far more than 8 hours to complete. Complexity is mainly caused by the need to prepare randomly fragmented shotgun libraries before hybridization. A separate hybridization step may take up to three days to complete. Examples of this type of technology include SECAP EZ target enrichment system (ROCHE) and SURESELECT target enrichment system (AGILENT).

[0005] Another method of target enrichment is based on the amplification of dual target primers. In this method, two probes are used on the border of the target to enrich the target area. These methods tend to take less than 8 hours to complete and are simpler than hybrid capture methods. However, the technology based on dual primers cannot enrich sequences with unknown structural variations. The most mature dual primer method is multiplex polymerase chain reaction (PCR). This is a very simple single step process, but only tens of targets can be amplified in each reaction tube. Currently available other updated technologies, including TRUSEQ amplicon sequencing kit (ILLUMINA) and ION TORRENT AMPLISEQ sequencing kit (LIFE TECHNOLOGIES) products, are able to amplify hundreds to thousands of targets in a single reaction tube, and only require a few processing steps.

[0006] The third technology is based on the amplification of a single target primer. In this method, the target is enriched by amplifying the region defined by a single target primer and a universal primer connected to the end. Similar to the hybridization-based method; these technologies require the generation of a randomly fragmented shotgun library before the selective hybridization of the target oligonucleotide. However, instead of using the oligonucleotide to capture the target and wash out non-target molecules, an amplification step is adopted to selectively amplify the region between the randomly generated end and the target-specific oligonucleotide. The advantage of this technology is that, unlike the dual primer technology, it allows the detection of sequences with unknown structural variations. It is faster and simpler than hybridization-based technology. However, this type of technology is still slower and more complicated than the dual primer-based method. Examples of this type of technology are ARCHER's anchored multiplex PCR (ARCHER DX) and OVATION target enrichment system (NUGEN).

[0007] There remains an unmet need for rapid and simple target enrichment methods that will also accommodate unknown structural variations in the target sequence.

[0008] In some applications of next-generation sequencing, target enrichment methods have been used to enrich specific variant alleles relative to reference alleles. By enriching these variant alleles relative to reference alleles before sequencing, fewer sequencing reads are required to detect variant alleles. This reduces the overall sequencing cost in applications where the fraction of smaller variant alleles is at low frequency (<10%, <1%, <0.1%, <0.01%, etc.). Probe hybridization capture methods have been used to achieve this goal (Gydush et al., "Massively parallel enrichment of low-frequency allelesenables duplex sequencing at low depth," Nat. Biomed. Eng. 6(3): 257-266(2022)). However, these methods are slow, cumbersome, and costly.

[0009] There remains an unmet need for rapid, simple, and cost-effective methods to enrich for specific variant alleles. Summary of the invention

[0010] According to one embodiment, the present disclosure provides a method for enriching at least one target nucleic acid in a nucleic acid library. The method includes hybridizing a first oligonucleotide with a target nucleic acid in a nucleic acid library. Each of the nucleic acids in the nucleic acid library has a first end comprising a first adapter and a second end comprising a second adapter. The method further includes extending the hybridized first oligonucleotide with a first polymerase, thereby generating a first primer extension complex comprising a target nucleic acid and the extended first oligonucleotide. The method further includes capturing the first primer extension complex, enriching the first primer extension complex relative to the nucleic acid library, hybridizing the second oligonucleotide with the target nucleic acid, and extending the hybridized second oligonucleotide with a second polymerase, thereby generating a second primer extension complex comprising a target nucleic acid and the extended second oligonucleotide, thereby releasing the extended first oligonucleotide from the first primer extension complex. The method further includes amplifying the target nucleic acid with a third polymerase, a first amplification primer, and a second amplification primer, the first amplification primer having a 3' end complementary to the first adapter, and the second amplification primer having a 3' end complementary to the second adapter.

[0011] In one aspect, the method further comprises sequencing the amplified target nucleic acid.

[0012] In another aspect, the first oligonucleotide comprises a capture moiety.

[0013] In another aspect, capturing the first primer extension complex comprises capturing the capture moiety on a solid support.

[0014] In another aspect, the capture moiety is biotin and the solid support comprises streptavidin.

[0015] In another aspect, the first oligonucleotide is bound to a solid support prior to hybridizing the first oligonucleotide to the target nucleic acid, and the first oligonucleotide is hybridized to the target nucleic acid and the hybridized first oligonucleotide is extended with a polymerase, thereby capturing the first primer extension complex on the solid support.

[0016] In another aspect, capturing the first primer extension complex is performed after extending the hybridized first oligonucleotide.

[0017] In another aspect, the method further comprises incorporating at least one modified nucleotide into at least one of the extended first oligonucleotide in the first primer extension complex and the extended second oligonucleotide in the second primer extension complex.

[0018] In another aspect, the modified nucleotide is selected from dUTP and a nucleotide having a capture moiety.

[0019] In another aspect, the method further comprises incorporating at least one modified nucleotide into the extended first oligonucleotide in the first primer extension complex, the at least one modified nucleotide having a capture moiety.

[0020] In another aspect, capturing the first primer extension complex comprises capturing the capture moiety on a solid support.

[0021] In another aspect, the method further comprises incorporating at least one uracil into at least one of the extended first oligonucleotide in the first primer extension complex and the extended second oligonucleotide in the second primer extension complex, thereby forming a uracil-containing oligonucleotide product.

[0022] In another aspect, the method further comprises digesting the uracil-containing oligonucleotide product.

[0023] In another aspect, digestion of the uracil-containing oligonucleotide product is achieved with at least one of a uracil DNA glycosylase and a DNA glycosylase-lyase.

[0024] In another aspect, the DNA glycosylase-lyase is selected from the group consisting of endonuclease IV and endonuclease VIII.

[0025] In another aspect, the method further comprises contacting the nucleic acid library with a blocking oligonucleotide.

[0026] In another aspect, the blocking oligonucleotide is at least partially complementary to at least one of the first adaptor and the second adaptor.

[0027] In another aspect, the blocking oligonucleotide is a universal blocking oligonucleotide.

[0028] In another aspect, the first adaptor and the second adaptor have the same nucleic acid sequence.

[0029] In another aspect, the first adaptor and the second adaptor have different nucleic acid sequences.

[0030] In another aspect, the first adaptor and the second adaptor are forked adaptors.

[0031] In another aspect, the first adaptor and the second adaptor comprise at least one uracil.

[0032] In another aspect, at least one of the first polymerase and the second polymerase is a uracil-incompatible polymerase.

[0033] In another aspect, the third polymerase is a uracil-compatible polymerase.

[0034] In another aspect, the second oligonucleotide hybridizes to the target nucleic acid at a position 5' relative to the first oligonucleotide.

[0035] In another aspect, the third polymerase is a uracil-incompatible polymerase.

[0036] In another aspect, at least one of the first adaptor, the second adaptor, the first amplification primer, and the second amplification primer comprises at least one of a unique identifier (UID) sequence, a molecular identifier (MID) sequence.

[0037] In another aspect, the method includes the step of repeating the step of hybridizing the first oligonucleotide to the target nucleic acid after the step of amplifying the enriched library fragments through the step of amplifying the enriched library fragments.

[0038] On the other hand, the method includes a step of denaturing the first primer extension complex to release the target nucleic acid after the step of enriching the first primer extension complex, followed by a step of repeating the step of hybridizing the first oligonucleotide with the target nucleic acid by the step of enriching the first primer extension complex, followed by a step of hybridizing the second oligonucleotide with the target nucleic acid by the step of amplifying the target nucleic acid.

[0039] In another aspect, the method includes the step of repeating the step of hybridizing the first oligonucleotide to the target nucleic acid by performing a second primer extension reaction after the step of performing a second primer extension reaction, followed by the step of performing amplifying the target nucleic acid.

[0040] According to another embodiment, the present disclosure provides a kit for enriching at least one target nucleic acid in a nucleic acid library. The kit includes a first oligonucleotide complementary to the target nucleic acid in the nucleic acid library, and each of the nucleic acids in the nucleic acid library has a first end including a first adapter and a second end including a second adapter. The kit further includes a second oligonucleotide complementary to the target nucleic acid, a first amplification primer, and a second amplification primer. The first oligonucleotide includes a capture portion, the second oligonucleotide hybridizes with the target nucleic acid at a position 5' relative to the first oligonucleotide, and the first amplification primer has a 3' end complementary to the first adapter, and the second amplification primer has a 3' end complementary to the second adapter.

[0041] According to another embodiment, the present disclosure provides a kit for enriching at least one target nucleic acid in a nucleic acid library. The kit includes a first oligonucleotide complementary to the target nucleic acid in the nucleic acid library, and each of the nucleic acids in the nucleic acid library has a first end including a first adapter and a second end including a second adapter. The kit further includes a modified nucleotide with a capture portion, a second oligonucleotide complementary to the target nucleic acid, a first amplification primer, and a second amplification primer. The second oligonucleotide hybridizes with the target nucleic acid at a position 5' relative to the first oligonucleotide, and the first amplification primer has a 3' end complementary to the first adapter, and the second amplification primer has a 3' end complementary to the second adapter.

[0042] In one aspect, the kit further comprises at least one of a uracil nucleotide, a uracil compatible polymerase, a uracil incompatible polymerase, and a blocking oligonucleotide.

[0043] In one aspect, the capture moiety in the first oligonucleotide is a capture sequence that is at least partially complementary to the capture oligonucleotide, and the kit further comprises a capture oligonucleotide

[0044] According to another embodiment, the present disclosure provides a composition comprising a nucleic acid library, which includes at least one target nucleic acid. Each of the nucleic acids in the nucleic acid library has a first end comprising a first adapter, a second end comprising a second adapter, and a target region between the first adapter and the second adapter. The composition further includes an extended first oligonucleotide hybridized with the target region of the target nucleic acid. The extended first oligonucleotide includes at least one capture portion. The composition further includes a solid support combined with at least one capture portion, a second oligonucleotide hybridized with the target nucleic acid at a position 5' relative to the first extended oligonucleotide, and a polymerase associated with the 3' end of the second oligonucleotide.

[0045] In one aspect, the composition further comprises a blocking oligonucleotide hybridized to each of the first adaptor and the second adaptor.

[0046] In another aspect, at least one capture moiety is located at the 5' end of the extended first oligonucleotide.

[0047] In another aspect, at least one capture moiety is incorporated into the extended portion of the extended first oligonucleotide.

[0048] In another aspect, the extended first oligonucleotide further comprises at least one uracil and at least one thymine.

[0049] In another aspect, the polymerase is a uracil-incompatible polymerase.

[0050] In another aspect, at least one of the first adaptor and the second adaptor comprises at least one uracil and at least one thymine.

[0051] In another aspect, releasing the extended first oligonucleotide from the first primer extension complex is achieved with an enzyme having an activity selected from the group consisting of strand displacement activity, 5' to 3' exonuclease activity, and flap endonuclease activity.

[0052] On the other hand, the capture moiety is a capture sequence that is at least partially complementary to the capture oligonucleotide, so that capturing the first primer extension complex is achieved by hybridizing the capture oligonucleotide with the capture sequence of the first oligonucleotide present in the first primer extension complex. On the other hand, the capture oligonucleotide comprises a capture moiety. On the other hand, the capture oligonucleotide comprises a modified nucleotide that increases the melting temperature of the capture oligonucleotide, for example, 5-methylcytosine, 2,6-diaminopurine, 5-hydroxybutynyl-2'-deoxyuridine, 8-aza-7-deazaguanosine, ribonucleotides, 2'O-methylribonucleotides or locked nucleic acids. On the other hand, the capture oligonucleotide is modified to inhibit digestion by a nuclease (e.g., phosphorothioate nucleotides).

[0053] One aspect relates to a method for enriching at least one target nucleic acid in a nucleic acid library, wherein the at least one target nucleic acid comprises at least one variant base, the method comprising: (a) hybridizing a first oligonucleotide to a target nucleic acid in the nucleic acid library, each of the nucleic acids in the nucleic acid library having a first end comprising a first adaptor and a second end comprising a second adaptor, wherein the first oligonucleotide is complementary to the target nucleic acid at the at least one variant base; (b) extending the hybridized first oligonucleotide with a first polymerase, thereby generating a first primer extension complex comprising the target nucleic acid and the extended first oligonucleotide; (c) capturing a first primer extension complex; (d) enriching the first primer extension complex relative to the nucleic acid library; (e) hybridizing the second oligonucleotide to the target nucleic acid; (f) extending the hybridized second oligonucleotide with a second polymerase, thereby generating a second primer extension complex comprising the target nucleic acid and the extended second oligonucleotide, thereby releasing the extended first oligonucleotide from the first primer extension complex; and (g) amplifying the target nucleic acid with a third polymerase, a first amplification primer, and a second amplification primer, the first amplification primer having a 3' end complementary to the first adaptor, and the second amplification primer having a 3' end complementary to the second adaptor. In another embodiment, the complementary position between the first oligonucleotide and the variant base of the target nucleotide is the last 3' base of the first oligonucleotide. In another embodiment, the complementary position between the first oligonucleotide and the variant base of the target nucleotide is the second to last 3' base of the first oligonucleotide. In another embodiment, the complementary position between the first oligonucleotide and the variant base of the target nucleotide is the third to last 3' base of the first oligonucleotide. In another embodiment, the frequency of at least one variant base in the nucleic acid library is less than 1%. In another embodiment, the frequency of at least one variant base in the nucleic acid library is less than 0.1%. In another embodiment, the frequency of at least one variant base in the nucleic acid library is less than 0.01%. In another embodiment, the frequency of at least one variant base in the nucleic acid library is less than 0.001%. In another embodiment, the method further comprises an additional oligonucleotide in step (a), wherein the additional oligonucleotide is hybridized with such a chain, which is opposite to the chain hybridized by the first oligonucleotide. In a related embodiment, the additional oligonucleotide is complementary to the target nucleic acid at at least one variant base. In another embodiment, one or more additional mismatches or unannealed bubbles are generated in the first oligonucleotide. In another embodiment, the first oligonucleotide comprises one or more modified bases. In another embodiment, one or more modified bases comprise locked nucleic acid (LNA), methyl C or 7 deaza dGTP or any combination thereof. In another embodiment, the first, second and / or third DNA polymerase is KAPA 2G polymerase, △Z05 polymerase, AS-1 polymerase or KAPA HiFi Exo (-) polymerase or any combination thereof. In another embodiment, the second oligonucleotide is complementary to the target nucleic acid at at least one variant base.In another embodiment, the complementary position between the first oligonucleotide and the variant base of the target nucleotide is the last 3' base of the second oligonucleotide. In another embodiment, the complementary position between the first oligonucleotide and the variant base of the target nucleotide is the second to last 3' base of the second oligonucleotide. In another embodiment, the complementary position between the first oligonucleotide and the variant base of the target nucleotide is the third to last 3' base of the second oligonucleotide. In another embodiment, the second oligonucleotide comprises one or more modified bases. In another embodiment, the one or more modified bases comprise locked nucleic acid (LNA), methyl C or 7 deaza dGTP or any combination thereof. In another embodiment, one or more additional mismatches or unannealed bubbles are generated in the second oligonucleotide. In another embodiment, the method further comprises hybridizing nucleic acids of non-target nucleic acids in the nucleic acid library with toxic primers. In a related embodiment, the toxic primers deplete nucleic acids of non-target nucleic acids in the nucleic acid library. In another embodiment, the method further comprises sequencing the amplified target nucleic acid. In another embodiment, the first oligonucleotide comprises a capture portion. In another embodiment, the first oligonucleotide is combined with a solid support before the first oligonucleotide is hybridized with the target nucleic acid, and the first oligonucleotide is hybridized with the target nucleic acid and the hybridized first oligonucleotide is extended with a polymerase, thereby capturing the first primer extension complex on the solid support. In another embodiment, the method further includes incorporating at least one uracil into the first oligonucleotide extended in the first primer extension complex and at least one of the second oligonucleotide extended in the second primer extension complex, thereby forming an oligonucleotide product containing uracil. In another embodiment, the method further includes contacting the nucleic acid library with a blocking oligonucleotide. In another embodiment, the first adapter and the second adapter are forked adapters. In another embodiment, the first adapter and the second adapter include at least one uracil. In another embodiment, the second oligonucleotide is hybridized with the target nucleic acid at a position 5' relative to the first oligonucleotide. In another embodiment, at least one of the first adapter, the second adapter, the first amplification primer, and the second amplification primer includes at least one of a unique identifier (UID) and a molecular identifier (MID) sequence.

[0054] Another embodiment relates to a kit for enriching at least one target nucleic acid in a nucleic acid library, wherein the at least one target nucleic acid comprises at least one variant base, the kit comprising: (a) a first oligonucleotide complementary to a target nucleic acid in the nucleic acid library, each of the nucleic acids in the nucleic acid library having a first end comprising a first adaptor and a second end comprising a second adaptor, wherein the first oligonucleotide is complementary to the target nucleic acid at at least one variant base; (b) a second oligonucleotide complementary to the target nucleic acid; (c) a first amplification primer; and (d) a second amplification primer, wherein the first oligonucleotide comprises a capture portion, wherein the second oligonucleotide hybridizes to the target nucleic acid at a position 5' relative to the first oligonucleotide, and wherein the first amplification primer has a 3' end complementary to the first adaptor, and the second amplification primer has a 3' end complementary to the second adaptor. In a related embodiment, the second oligonucleotide is complementary to the target nucleic acid at at least one variant base.

[0055] Another embodiment relates to a kit for enriching at least one target nucleic acid in a nucleic acid library, wherein the at least one target nucleic acid comprises at least one variant base, the kit comprising: (a) a first oligonucleotide complementary to the target nucleic acid in the nucleic acid library, each of the nucleic acids in the nucleic acid library having a first end comprising a first adaptor and a second end comprising a second adaptor, wherein the first oligonucleotide is complementary to the target nucleic acid at at least one variant base; (b) a modified nucleotide having a capture portion; (c) a second oligonucleotide complementary to the target nucleic acid; (d) a first amplification primer; and (e) a second amplification primer, wherein the second oligonucleotide hybridizes to the target nucleic acid at a position 5' relative to the first oligonucleotide, and wherein the first amplification primer has a 3' end complementary to the first adaptor, and the second amplification primer has a 3' end complementary to the second adaptor. In a related embodiment, the second oligonucleotide is complementary to the target nucleic acid at at least one variant base.

[0056] Another aspect relates to a method for dual enrichment of at least one target nucleic acid in a nucleic acid library, wherein the at least one target nucleic acid comprises at least one variant base, the method comprising the following steps: (a) hybridizing a first oligonucleotide to a target nucleic acid in the nucleic acid library, each of the nucleic acids in the nucleic acid library having a first end comprising a first adaptor and a second end comprising a second adaptor, wherein the first oligonucleotide is complementary to the target nucleic acid at at least one variant base; (b) extending the hybridized first oligonucleotide with a first polymerase, thereby generating a first primer extension complex comprising the target nucleic acid and the extended first oligonucleotide; (c) capturing the first primer extension complex; (d) enriching the first oligonucleotide relative to the nucleic acid library. primer extension complex; (e) hybridizing the second oligonucleotide to the target nucleic acid; (f) extending the hybridized second oligonucleotide with a second polymerase, thereby producing a second primer extension complex including the target nucleic acid and the extended second oligonucleotide, thereby releasing the extended first oligonucleotide from the first primer extension complex; (g) amplifying the target nucleic acid with a third polymerase, a first amplification primer and a second amplification primer, the first amplification primer having a 3' end complementary to the first adaptor, and the second amplification primer having a 3' end complementary to the second adaptor to produce a sample of amplified target nucleic acid; and (h) repeating each of the ordered steps (a) to (g) for the sample of amplified target nucleic acid of step (g).

[0057] Another aspect relates to a method for dual enrichment of at least one target nucleic acid in a nucleic acid library, wherein the at least one target nucleic acid comprises at least one variant base, the method comprising the following steps: (a) hybridizing a first oligonucleotide to a target nucleic acid in the nucleic acid library, each of the nucleic acids in the nucleic acid library having a first end comprising a first adaptor and a second end comprising a second adaptor, wherein the first oligonucleotide is complementary to the target nucleic acid at at least one variant base; (b) extending the hybridized first oligonucleotide with a first polymerase, thereby generating a first primer extension complex comprising the target nucleic acid and the extended first oligonucleotide; (c) capturing the first primer extension complex; and (d) enriching the first primer extension complex relative to the nucleic acid library. (e) denaturing the first primer extension complex to release the target nucleic acid from the first primer extension complex; (f) repeating each of the ordered steps (a) to (d) for the target nucleic acid of step (e); (g) hybridizing a second oligonucleotide to the target nucleic acid; (h) extending the hybridized second oligonucleotide with a second polymerase, thereby generating a second primer extension complex comprising the target nucleic acid and the extended second oligonucleotide, thereby releasing the extended first oligonucleotide from the first primer extension complex; and (i) amplifying the target nucleic acid with a third polymerase, a first amplification primer, and a second amplification primer, the first amplification primer having a 3' end complementary to the first adaptor, and the second amplification primer having a 3' end complementary to the second adaptor.

[0058] Another aspect relates to a method for dual enrichment of at least one target nucleic acid in a nucleic acid library, wherein the at least one target nucleic acid comprises at least one variant base, the method comprising the following steps: (a) hybridizing a first oligonucleotide to a target nucleic acid in the nucleic acid library, each of the nucleic acids in the nucleic acid library having a first end comprising a first adaptor and a second end comprising a second adaptor, wherein the first oligonucleotide is complementary to the target nucleic acid at the at least one variant base; (b) extending the hybridized first oligonucleotide with a first polymerase, thereby generating a first primer extension complex comprising the target nucleic acid and the extended first oligonucleotide; (c) capturing the first primer extension complex; and (d) enriching a first primer extension complex for a nucleic acid library; (e) hybridizing a second oligonucleotide to a target nucleic acid; (f) extending the hybridized second oligonucleotide with a second polymerase, thereby generating a second primer extension complex comprising the target nucleic acid and the extended second oligonucleotide, thereby releasing the extended first oligonucleotide from the first primer extension complex; (g) repeating each of the ordered steps (a) to (f) for the target nucleic acid of step (f); and (h) amplifying the target nucleic acid with a third polymerase, a first amplification primer, and a second amplification primer, the first amplification primer having a 3' end complementary to the first adaptor, and the second amplification primer having a 3' end complementary to the second adaptor.

[0059] The foregoing and other aspects and advantages of the present invention will become apparent from the following description. In the specification, reference is made to the accompanying drawings which form a part thereof and in which preferred embodiments of the present invention are shown by way of illustration. Such embodiments do not necessarily represent the full scope of the present invention, however, therefore, the claims are hereby cited to interpret the scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0060] This patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with one or more color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

[0061] Figure 1 is a schematic flow chart illustrating an embodiment of a method for enriching at least one target nucleic acid in a nucleic acid library according to the present disclosure.

[0062] Figure 2A , Figure 2B , Figure 2C , Figure 2D and Figure 2E A schematic diagram of a first embodiment of a method for enriching at least one target nucleic acid in a nucleic acid library according to the present disclosure is shown. In the illustrated embodiment, the first oligonucleotide includes a capture moiety for solution phase capture of the target nucleic acid.

[0063] Figure 3A and Figure 3BA schematic diagram of yet another second embodiment of a method for enriching at least one target nucleic acid in a nucleic acid library according to the present disclosure is shown. In the illustrated embodiment, a first oligonucleotide is bound to a solid support for in situ capture of the target nucleic acid.

[0064] Figure 4A , Figure 4B , Figure 4C and Figure 4D A schematic diagram of yet another third embodiment of a method for enriching at least one target nucleic acid in a nucleic acid library according to the present disclosure is shown. In the illustrated embodiment, one or more capture moieties are incorporated during the extension of a first oligonucleotide hybridized to a target nucleic acid, thereby enabling capture of a complex comprising a target nucleic acid and the extended first oligonucleotide on a solid support.

[0065] Figure 5 is a schematic diagram of multiple nucleic acids in a library molecule showing intermolecular adaptor-adapter hybridization.

[0066] Fig. 6A is the fluorescence output trace from an electrophoretic DNA analyzer for a nucleic acid library derived from human genomic DNA and adjusted with universal adapter end sequences using a commercially available library preparation kit. Data were collected after 5 and 12 cycles of standard PCR amplification for 1 μL 10 ng library and 1 μL 100 ng library, respectively. According to the present disclosure, nucleic acid libraries are sampled and enriched for target nucleic acids.

[0067] Figure 6B is a method of the present invention for the enrichment and amplification of primer extension targets after Fig. 6A Fluorescence-based size analysis of nucleic acid libraries.

[0068] Figure 7 It is depicted for Figure 6B Bar graph of high-level sequencing metrics for an enriched nucleic acid library. More than 99% of the sequencing reads map to sequences known to be present in the library, and about half of the sequencing reads map to enriched target nucleic acids. The 80-fold base penalty for the library is 1.4 and 1.5 for first oligonucleotide primer annealing temperatures of 60°C and 65°C, respectively. In each cluster of three bars, data are shown for the percentage of trimmed reads mapped (left), the percentage of bases in the target nucleic acid filled (center), and the percentage of targets in non-repetitive reads mapped (right).

[0069] Fig. 8A , Figure 8B , Figure 8C , Fig.8D and Fig. 8E A schematic diagram of another embodiment of the present invention is shown, wherein capture is achieved by hybridizing universal capture oligonucleotides.

[0070] Fig.9A and Fig. 9B A schematic diagram of another embodiment in which a universal capture oligonucleotide is bound to a solid support is shown.

[0071] Fig.10 Shown are the results of sequencing a library generated using universal capture oligonucleotides.

[0072] Fig.11 Plots showing relative targeted allele enrichment (expressed as a percentage) for the following three primer conditions: (a) the capture primer falls on the variant (called "capture", peach); (b) the release primer falls on the variant (called "release", green); and (c) where the variant is between the capture and release primer pair or beyond the capture-release pair (called "none", blue).

[0073] Fig.12 Plots showing relative targeted allele enrichment (expressed as a percentage) for the following conditions: (a) where the variant base is located at the 3' end of the capture primer (referred to as "Capture 3'", in blue); (b) where the variant base is located in the middle of the capture primer (referred to as "Capture MID", in green); (c) where the variant base is located at the 5' end of the capture primer (referred to as "Capture 5'", in peach); and (d) where the variant base is located in the middle of the release primer (referred to as "Release", in green).

[0074] Fig.13 Exemplary mappings of reference primers against reference targets having positions in the reference sequence where a cytosine (C) is present and where a common variant has a thymine (T) at that same position are shown, with varying degrees of overlap. In particular, Fig.13 Shown are primers with no overlap (called "No Overlap"), primers that overlap at the last 3' position (called "Ult"), primers that overlap at the second to last 3' position (called "Penult"), and primers that overlap at the third to last 3' position (called "Antepenult").

[0075] Fig.14 Shown are exemplary mappings of a reference primer against the positive strand of a reference target (having a position in the reference sequence where a cytosine (C) is present and where the common variant has a thymine (T) at that same position) with varying degrees of overlap (referred to as the "positive strand"). Fig.14 Also shown are exemplary mappings of reference primers against the negative strand of a reference target (having positions in the reference sequence where a cytosine (C) is present and where a common variant has a thymine (T) at that same position), with varying degrees of overlap (referred to as the "negative strand"). In particular, for primers targeting the positive strand and for primers targeting the negative strand, Fig.14Also shown are: (i) primers with no overlap (SEQ ID NO:7 and SEQ ID NO:14), (ii) primers that overlap at the last 3' position (SEQ ID NO:8 and SEQ ID NO:13), (iii) primers that overlap at the second to last 3' position (SEQ ID NO:9 and SEQ ID NO:12), and (iv) primers that overlap at the third to last 3' position (SEQ ID NO:10 and SEQ ID NO:11).

[0076] Fig.15 An exemplary mapping of reference primers relative to the positive and negative strands of the reference target is shown. Fig.15 Also shown are the capture primer that hybridizes upstream of the variant position (outside variant, blue) and the primer whose last 3' base falls on the variant position (on variant, blue). The release primer (orange) for each strand is shown upstream of the capture primer outside variant.

[0077] Fig.16 Shown are graphs of on-target reads or read on-target rate (OTR) (expressed as a percentage) for the following conditions: (a) single capture outside variant (orange bars); (b) single capture on variant (blue bars); and (c) dual capture on variant (green bars).

[0078] Fig.17 Shown are graphs of observed allele frequencies (AF) (expressed as percentages) for the following conditions: (a) single capture outside variant (orange bars); (b) single capture on variant (blue bars); and (c) double capture on variant (green bars).

[0079] Fig.18 Exemplary mapping of reference primers against the positive strand (SEQ ID NO:21 - SEQ ID NO:28) and negative strand (SEQ ID NO:29 - SEQ ID NO:36) of the reference target is shown.

[0080] Fig.19Plots showing observed allele frequencies (AF) (expressed as percentages) for the following conditions are shown: variant-out capture (pink bars); variant-on capture using the last 3' variant capture primer (green bars), or the same variant capture primer using a toxic primer (blue bars and indicated by vertical arrows); variant-on capture using the second-to-last 3' variant capture primer (green bars), or the same variant capture using a toxic primer (blue bars and indicated by vertical arrows); variant-on capture using the third-to-last 3' variant capture primer (green bars), or the same variant capture using a toxic primer (blue bars and indicated by vertical arrows); variant-on capture using the middle variant capture primer (green bars), or the same variant capture using a toxic primer (blue bars and indicated by vertical arrows); and variant-on capture using the 5' variant capture primer (green bars), and the same variant capture using a toxic primer (blue bars and indicated by vertical arrows).

[0081] Fig. 20 Shows the Fig.19 The data are shown as a plot of fold enrichment as a function of total coverage. Variant primer only data points are represented by a single vertical arrow, while variant plus toxic primer data points are represented by double vertical arrows.

[0082] Fig.21 A graph showing the percentage of variant recovery using various combinations of capture primers is shown.

[0083] Fig. 22 Shown is a graph of the enrichment fold (observed allele frequency (AF) / expected allele frequency (AF)) as a function of increasing amounts of toxic primers in the enrichment reaction.

[0084] Fig.23 Shown is a graph of percent recovery as a function of increasing amounts of toxic primers in the enrichment reaction.

[0085] Fig.24 Plots of percent recovery as a function of ligation time and captured variant input are shown.

[0086] Fig.25 Shown are plots of observed allele frequencies expressed as percentages for capture primers off-variant and on-variant for two different libraries.

[0087] Fig.26 A graph showing the percentage of variants detected using off-variant and on-variant capture primers for two different libraries is shown. DETAILED DESCRIPTION

[0088] I. Definitions

[0089] In this application, unless the context clearly indicates otherwise, (i) the term "a" (a) may be understood to mean "at least one"; (ii) the term "or" may be understood to mean "and / or"; (iii) the term "comprising" (and including) may be understood to cover the components or steps listed individually, whether they are presented alone or together with one or more other components or steps; (iv) the terms "about" and "approximately" may be understood to allow for standard variations, as would be understood by a person of ordinary skill in the art; and (v) where a range is provided, the endpoints are included.

[0090] Adaptor: As used herein, "adaptor" means a nucleotide sequence that can be added to another sequence to impart additional properties to the other sequence. An adaptor can be single-stranded or double-stranded, or can have both single-stranded and double-stranded portions.

[0091] Approximately: As used herein, the term "approximately" or "about" as applied to one or more target values ​​refers to a value similar to the reference value. In certain embodiments, the term "approximately" or "about" refers to a range of values ​​within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less in either direction (greater or less than) of the reference value, unless otherwise specified or obvious from the context (unless the number exceeds 100% of the possible value).

[0092] Correlation: Two events or entities are "associated" with each other, as the term is used herein, if the presence, level, and / or form of one event or entity is related to the presence, level, and / or form of another event or entity. For example, a particular entity (e.g., a polypeptide, genetic marker, metabolite, etc.) is considered to be associated with a particular disease, disorder, or condition (e.g., in a relevant population) if the presence, level, and / or form of the particular entity (e.g., a polypeptide, genetic marker, metabolite, etc.) is associated with the incidence and / or susceptibility of the disease, disorder, or condition. In some embodiments, two or more entities are physically "associated" with each other if they interact directly or indirectly, such that they are in physical proximity to each other and / or remain in physical proximity to each other. In some embodiments, two or more entities that are physically bound to each other are covalently attached to each other; in some embodiments, two or more entities that are physically bound to each other are not covalently attached to each other, but are non-covalently attached, such as by hydrogen bonding, van der Waals interactions, hydrophobic interactions, magnetism, and combinations thereof.

[0093] Barcode: As used herein, "barcode" means a sequence of nucleotides that confers identity to a molecule. A barcode can confer a unique identity to a single molecule (and its copies). Such a barcode is a unique ID (UID). A barcode can confer an identity to an entire population of molecules (and its copies) from the same source (e.g., a patient). Such a barcode is a multiple ID (MID).

[0094] Biological sample: As used herein, the term "biological sample" generally refers to a sample obtained or derived from a target biological source (e.g., a tissue or organism or cell culture), as described herein. In some embodiments, the target source includes an organism, such as an animal or a human, or consists thereof. In some embodiments, the biological sample includes or consists of a biological tissue or fluid. In some embodiments, the biological sample can be or include bone marrow; blood; blood cells; ascites; tissue or fine needle biopsy samples; body fluids containing cells; free floating nucleic acids; sputum; saliva; urine; cerebrospinal fluid; peritoneal fluid; pleural fluid; feces; lymph; gynecological fluid; skin swab; vaginal swab; oral swab; nasal swab; washing or lavage, such as catheter lavage or bronchoalveolar lavage; aspirate; scrapings; bone marrow specimens; tissue biopsy specimens; surgical specimens; other body fluids, secretions and / or excretions; and / or cells therefrom, etc. In some embodiments, the biological sample includes or consists of cells obtained from an individual. In some embodiments, the cell obtained is or includes a cell from an individual from which a sample is obtained. In some embodiments, a sample is a "primary sample" obtained directly from a target source by any appropriate means. For example, in some embodiments, an original biological sample is obtained by a method selected from the group consisting of the following items: biopsy (e.g., fine needle aspiration or tissue biopsy), surgery, body fluid collection (e.g., blood, lymph, feces, etc.). In some embodiments, as can be clearly seen from the context, the term "sample" refers to a preparation obtained by processing the original sample (e.g., by removing one or more components thereof and / or by adding one or more medicaments thereto). For example, a semipermeable membrane is used for filtration. Such "processed samples" may include, for example, nucleic acids or proteins extracted from a sample, or nucleic acids or proteins obtained by subjecting the primary sample to techniques such as amplification or reverse transcription of mRNA, separation and / or purification of certain components.

[0095] Blocking oligonucleotide: An oligonucleotide that is complementary to another nucleic acid present in the reaction mixture and is capable of hybridizing to such nucleic acid to prevent undesired hybridization of such nucleic acid. This other nucleic acid may be a synthetic nucleic acid, such as a primer or adapter. When a primer or adapter is incorporated into a library nucleic acid molecule, the undesired hybridization to be prevented may occur. The blocking oligonucleotide need not be completely complementary to the nucleic acid to be protected from undesired hybridization, but must form a sufficiently stable hybrid to prevent the undesired event from occurring. To this end, the blocking oligonucleotide may contain universal bases or Tm -Modified bases.

[0096] Comprising: A composition or method described herein as "comprising" one or more named elements or steps is open ended, meaning that the named elements or steps are essential, but other elements or steps may be added within the scope of the composition or method. It should be understood that a composition or method described as "comprising or comprises" one or more named elements or steps also describes a corresponding, more limited composition or method "consisting essentially of or consisting essentially of" the same named elements or steps, meaning that the composition or method includes the named basic elements or steps, and may also include additional elements or steps that do not substantially affect the basic and novel features of the composition or method. It should also be understood that any composition or method described herein as "comprising" or "consisting essentially of" one or more named elements or steps also describes a corresponding, more limited, closed composition or method "consisting of or consisting of" the named elements or steps to exclude any other unnamed elements or steps. In any composition or method disclosed herein, a known or published equivalent of any named essential element or step may replace that element or step.

[0097] Designed: As used herein, the term "designed" refers to an agent that: (i) has a structure that is artificially selected; (ii) is produced by a process that requires human intervention; and / or (iii) is different from natural substances and other known agents.

[0098] Determining: Those of ordinary skill in the art reading this specification will understand that "determining" can be accomplished using or by using any of a variety of techniques available to those skilled in the art, including, for example, specific techniques explicitly mentioned herein. In some embodiments, determining involves manipulation of a physical sample. In some embodiments, determining involves consideration and / or manipulation of data or information, such as using a computer or other processing unit suitable for performing the relevant analysis. In some embodiments, determining involves receiving relevant information and / or material from a source. In some embodiments, determining involves comparing one or more features of a sample or entity to a comparable reference.

[0099] Identity: As used herein, the term "identity" refers to the overall correlation between polymer molecules, for example, between nucleic acid molecules (e.g., DNA molecules and / or RNA molecules) and / or between polypeptide molecules. In some embodiments, if the sequence of the polymer molecule is at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99% identical, then these polymer molecules are considered to be "substantially identical" to each other. For example, for the purpose of optimal comparison, the percentage of identity of two nucleic acid or polypeptide sequences can be calculated by comparing the two sequences (for example, a gap can be introduced in one or both of the first sequence and the second sequence to achieve optimal comparison, and for the purpose of comparison, non-identical sequences can be ignored). In certain embodiments, the length of the sequence compared for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or substantially 100% of the length of the reference sequence. Then compare the nucleotides of the corresponding positions.When the position in the first sequence is occupied by the same residue (for example, nucleotide or amino acid) as the corresponding position in the second sequence, the molecule is identical at this position.Considering the number of each gap and the length of the gap, the identity percentage between the two sequences is a function of the number of identical positions shared by the sequences, which needs to be introduced to achieve the best comparison of the two sequences.The comparison of the sequence and the determination of the identity percentage between the two sequences can be completed using a mathematical algorithm.For example, the algorithm (CABIOS, 1989, 4: 11-17) of Meyers and Miller can be used to determine the identity percentage between the two nucleotide sequences, which has been incorporated into the ALIGN program (version 2.0).In some exemplary embodiments, the nucleic acid sequence comparison performed with the ALIGN program uses a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4.Alternatively, the NWSgapdna.CMP matrix can be used to determine the identity percentage between the two nucleotide sequences using the GAP program in the GCG software package.

[0100] Ligation site: As used herein, a "ligation site" is a portion of a nucleic acid molecule that can facilitate ligation (except for the blunt ends of double-stranded molecules). The presence of "compatible ligation sites" on two molecules enables the two molecules to preferentially ligate to each other.

[0101] Sample: As used herein, the term "sample" refers to a substance that is a target composition for qualitative and / or quantitative assessment or a substance containing the composition. In some embodiments, the sample is a biological sample (i.e., from a living thing (e.g., a cell or organism)). In some embodiments, the sample is from a geological, aquatic, astronomical, or agricultural source. In some embodiments, the target source includes an organism, such as an animal or a human, or consists of it. In some embodiments, the sample used for forensic analysis is or includes biological tissue, biological fluid, organic or inorganic matter, such as, for example, clothing, dirt, plastic, water. In some embodiments, agricultural samples include or consist of organic matter, such as leaves, petals, bark, wood, seeds, plants, fruits, etc.

[0102] Single-stranded ligation: As used herein, "single-stranded ligation" is a ligation procedure that begins with at least one single-stranded substrate and typically involves one or more double-stranded or partially double-stranded adapters.

[0103] Solid support: As used herein, "solid support" refers to any solid material capable of interacting with a capture moiety. A solid support can be a solution phase support (e.g., glass beads, magnetic beads, or another similar particle) that can be suspended in a solution, or a solid phase support (e.g., a silicon wafer, a glass slide, or a similar support). Examples of liquid phase supports include superparamagnetic spherical polymer particles such as DYNABEADS magnetic beads from INVITROGEN, or magnetic glass particles such as described in U.S. Patents 656568, 6274386, 7371830, 6870047, 6255477, 6746874, and 6258531.

[0104] Substantially: As used herein, the term "substantially" refers to the qualitative condition of exhibiting the full or nearly full range or degree of a characteristic or property of interest. One of ordinary skill in the biological arts will appreciate that biological and chemical phenomena rarely, if ever, go to completion and / or proceed to completion or achieve or avoid an absolute result. Thus, the term "substantially" is used herein to capture the potential lack of completeness inherent in many biological and chemical phenomena.

[0105] Synthetic: As used herein, the term "synthetic" means produced by the hand of man, and therefore produced in a form that does not occur in nature, either because it has a structure that does not occur in nature, or because it is combined with one or more other components (with which it is not combined in nature), or is not combined with one or more other components (with which it is combined in nature).

[0106] Universal primer: As used herein, "universal primer" and "universal priming site" refer to primers and priming sites that are not naturally present in the target sequence. Typically, the universal priming site is present in an adapter or a target-specific primer. The universal primer can bind to the universal primer site and direct primer extension from the universal primer site.

[0107] Variant: As used herein, the term "variant" refers to an entity that displays significant structural identity to a reference entity, but is structurally different from the reference entity in the presence or level of one or more chemical moieties compared to the reference entity. In many embodiments, a variant is also functionally different from its reference entity. In general, whether a particular entity is appropriately considered a "variant" of a reference entity is based on its degree of structural identity to the reference entity. As will be appreciated by those skilled in the art, any biological or chemical reference entity has certain characteristic structural elements. By definition, a variant is a unique chemical entity that shares one or more such characteristic structural elements. To name just a few examples, a small molecule may have a characteristic core structural element (e.g., a macrocyclic core) and / or one or more characteristic side groups, such that a variation of a small molecule is a variation that shares the core structural element and the characteristic side groups, but differs in other side groups and / or in the type of bonds present in the core (single vs. double, E vs. Z, etc.), a polypeptide may have a characteristic sequence element consisting of a plurality of amino acids that have a specified position relative to each other in linear or three-dimensional space and / or contribute to a specific biological function, and a nucleic acid may have a characteristic sequence element consisting of a plurality of nucleotide residues that have a specified position relative to one another in linear or three-dimensional space. For example, a variant polypeptide may differ from a reference polypeptide due to one or more differences in the amino acid sequence and / or one or more differences in the chemical moieties (e.g., carbohydrates, lipids, etc.) covalently attached to the polypeptide backbone. In some embodiments, the variant polypeptide exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 99% overall sequence identity with the reference polypeptide. Alternatively or additionally, in some embodiments, variant polypeptides do not share at least one characteristic sequence element with reference polypeptides. In some embodiments, reference polypeptides have one or more biological activities. In some embodiments, variant polypeptides have one or more of the biological activities of reference polypeptides. In some embodiments, variant polypeptides lack one or more of the biological activities of reference polypeptides. In some embodiments, variant polypeptides show one or more biological activity levels reduced compared to reference polypeptides. In many embodiments, if the amino acid sequence of the target polypeptide is identical to the amino acid sequence of the parent except for a small amount of sequence changes at a specific position, the target polypeptide is considered to be a "variation" of the parent or reference polypeptide. Typically, compared to the parent, less than 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% of the residues in the variation are substituted. In some embodiments, compared to the parent, the variation has 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 substituted residues. Typically, the variation has a very small amount (e.g., less than 5, 4, 3, 2 or 1) of substituted functional residues (i.e., residues involved in a specific biological activity).In addition, the variation generally has no more than 5, 4, 3, 2 or 1 additions or deletions compared to the parent, and generally has no additions or deletions. In addition, any additions or deletions are generally less than about 25, about 20, about 19, about 18, about 17, about 16, about 15, about 14, about 13, about 10, about 9, about 8, about 7, about 6 residues, and generally less than about 5, about 4, about 3 or about 2 residues. In some embodiments, the variation can also have one or more functional defects and / or can be considered as "mutational variant" in addition. In some embodiments, the parent or reference polypeptide is a polypeptide found in nature. As will be appreciated by those of ordinary skill in the art, multiple variations of a particular target polypeptide can generally be found in nature, particularly when the target polypeptide is an infectious agent polypeptide.

[0108] II. Detailed Description of Certain Embodiments

[0109] For many nucleic acid enrichment techniques, it is useful to first provide a shotgun library of nucleic acids, in which longer nucleic acid sequences derived from a sample are subdivided into smaller fragments (i.e., about 50 to 500 nucleotides) that are compatible with short-read sequencing techniques. To prepare a shotgun library, a high molecular weight nucleic acid strand (usually cDNA or genomic DNA) is sheared into random fragments, optionally modified by ligating common end sequences (i.e., adapters), and size selected for downstream processing and analysis. For example, it may be useful to selectively capture a portion of the nucleic acids in a shotgun library.

[0110] At present, there are two main categories of capture technology: hybridization-based capture and amplification-based capture. The advantage of hybridization-based capture methods is that they can recover all of the original shotgun library fragments, rather than just copying and recovering a subset of the original library fragments. However, hybridization-based capture is generally associated with a lower on-target rate than amplification-based methods. Notably, the lower on-target rate results in a waste of sequencing capacity due to the need to sequence off-target capture products. In addition, the workflow associated with hybridization-based capture methods can be more complex and have a longer turnaround time relative to amplification-based methods. In contrast, amplification-based methods, such as anchored multiplex PCR methods, have advantages such as simple workflows, fast turnaround times, and high on-target rates relative to hybridization-based methods, but they also have some disadvantages. For example, the incorporation of library fragments after amplification of target-specific primer sequences results in a waste of sequencing capacity. In addition, library fragments are not necessarily representative of the original shotgun library because the template must be truncated at the target-specific primer binding site. Therefore, there is still an unmet need for methods for rapid and simple target enrichment that will also accommodate unknown structural variations in the target sequence.

[0111] These and other challenges can be overcome according to the method for target enrichment by unidirectional dual probe primer extension disclosed herein.On the one hand, the present disclosure describes the general method and improvement thereof of enrichment based on unidirectional dual probe primer extension.For this reason, the present disclosure provides primer extension and capture based on hybridization to a combination on a solid carrier, which is used to enrich one or more target nucleic acids from a target nucleic acid library. The present disclosure further provides an overall workflow with many aforementioned advantages of the enrichment method based on anchoring multiple amplification and hybrid capture method without many aforementioned shortcomings. The advantages of the kit, composition and method disclosed herein include recovery of library molecules derived from whole shotgun libraries, simple workflow (e.g., fewer total steps and less hands-on time), rapid turnaround time, higher on-target rate and lower overall material cost relative to many existing capture methods based on hybridization and capture methods based on anchoring multiple amplification.

[0112] In one embodiment, the present invention is a method for enriching at least one target nucleic acid in a nucleic acid library. The method may include hybridizing a first oligonucleotide to a target nucleic acid in a nucleic acid library. Each of the nucleic acids in the nucleic acid library may have a first end comprising a first adapter and a second end comprising a second adapter. The method further includes extending the hybridized first oligonucleotide with a first polymerase, thereby generating a first primer extension complex comprising the target nucleic acid and the extended first oligonucleotide.

[0113] On the one hand, the method may further include capturing the first primer extension complex and enriching the first primer extension complex relative to the nucleic acid library. The extension product of the first oligonucleotide can be captured via the capture moiety present on the first oligonucleotide. Alternatively, the method can utilize a capture oligonucleotide, such as an oligonucleotide complementary to at least a portion of the first oligonucleotide. The first oligonucleotide may include a universal sequence that is at least partially complementary to the capture oligonucleotide. The capture oligonucleotide may include a capture moiety and may be combined with a solid substrate via the capture moiety. On the other hand, the method may include hybridizing the second oligonucleotide with the target nucleic acid, and extending the hybridized second oligonucleotide with a second polymerase, thereby generating a second primer extension complex comprising the target nucleic acid and the extended second oligonucleotide, thereby releasing the extended first oligonucleotide from the first primer extension complex. The method may further include amplifying the target nucleic acid with a third polymerase, a first amplification primer, and a second amplification primer. The first amplification primer has a 3' end complementary to the first adapter, and the second amplification primer has a 3' end complementary to the second adapter.

[0114] The first, second and third polymerases can be any suitable polymerases. An example of a polymerase is Taq or a Taq-derived polymerase (e.g., KAPA 2G polymerase from KAPA BIOSYSTEMS). Another example of a polymerase is a B family DNA polymerase (e.g., KAPA HIFI polymerase from KAPA BIOSYSTEMS).

[0115] In another embodiment, the present disclosure provides a kit for enriching at least one target nucleic acid in a nucleic acid library. The kit may include a first oligonucleotide complementary to the target nucleic acid in the nucleic acid library. Each of the nucleic acids in the nucleic acid library has a first end comprising a first adapter and a second end comprising a second adapter. The kit may further include a second oligonucleotide complementary to the target nucleic acid, a first amplification primer, and a second amplification primer. The first oligonucleotide may include a capture portion. The first oligonucleotide may include a capture portion. Alternatively, the kit may include a capture oligonucleotide complementary to at least a portion of the first oligonucleotide, wherein the first oligonucleotide includes a universal sequence that is at least partially complementary to the capture oligonucleotide. The capture oligonucleotide may include a capture portion and may be bound to a solid matrix via the capture portion or have a capture portion supplied separately in the kit. The second oligonucleotide may hybridize with the target nucleic acid at a position 5' relative to the first oligonucleotide. The first amplification primer has a 3' end complementary to the first adapter, and the second amplification primer has a 3' end complementary to the second adapter.

[0116] In another embodiment, the present disclosure provides a kit for enriching at least one target nucleic acid in a nucleic acid library. The kit may include a first oligonucleotide complementary to the target nucleic acid in the nucleic acid library. Each of the nucleic acids in the nucleic acid library may have a first end comprising a first adapter and a second end comprising a second adapter. The kit may further include a modified nucleotide with a capture portion, a second oligonucleotide complementary to the target nucleic acid, a first amplification primer, and a second amplification primer. The second oligonucleotide hybridizes with the target nucleic acid at a position 5' relative to the first oligonucleotide, and the first amplification primer has a 3' end complementary to the first adapter, and the second amplification primer has a 3' end complementary to the second adapter. The kit may further include a capture oligonucleotide complementary to at least a portion of the first oligonucleotide and optionally bound to a solid support or supplied by a solid support.

[0117] In another embodiment, the present disclosure provides a composition including a nucleic acid library, which includes at least one target nucleic acid. Each of the nucleic acids in the nucleic acid library has a first end including a first adapter, a second end including a second adapter, and a target region between the first adapter and the second adapter. The composition further includes an extended first oligonucleotide hybridized with the target region of the target nucleic acid. The extended first oligonucleotide includes at least one capture portion. The composition further includes a solid support combined with at least one capture portion, a second oligonucleotide hybridized with the target nucleic acid at a position 5' relative to the first extended oligonucleotide, and a polymerase associated with the 3' end of the second oligonucleotide. The composition may further include a capture oligonucleotide, such as an oligonucleotide complementary to at least a portion of the first oligonucleotide. The first oligonucleotide may include a universal sequence at least partially complementary to the capture oligonucleotide. The capture oligonucleotide may include a capture portion. The capture oligonucleotide may be combined with a solid substrate (e.g., a bead) via a capture portion.

[0118] The methods of the present invention can be used as part of a sequencing protocol, including a high-throughput single-molecule sequencing protocol. The methods of the present invention generate a library of target nucleic acids to be sequenced. The target nucleic acids in the library can be incorporated with barcodes for molecular identification and sample identification.

[0119] The present invention includes at least one linear primer extension step using a target-specific primer. Compared with the exponential amplification practiced in the art, the linear extension step has multiple advantages. Each target nucleic acid is characterized by a unique synthesis rate, which depends on the annealing rate of the target-specific primer and the rate at which the polymerase can read a specific target sequence from beginning to end. Differences in extension rate and synthesis rate can produce deviations, which may lead to slight differences in a single round of synthesis. However, slight differences are exponentially amplified during PCR. The resulting gap is called PCR deviation. Deviations may mask any differences in the initial number of each sequence in the sample and hinder any quantitative analysis.

[0120] The present invention limits the extension of target-specific primers (including gene-specific primers and occasional degenerate primers that are specific to binding sites within the genome) to a single step. Any exponential amplification is performed using universal primers, which are not affected by template-dependent biases, or are affected by smaller biases than target-specific primers.

[0121] Reference now Figure 1, a method 100 for target enrichment by unidirectional dual probe primer extension includes a step 102 of preparing nucleic acid library fragments. In one aspect, nucleic acid library fragments can be prepared from any nucleic acid source including one or more target nucleic acids. Generally speaking, the target nucleic acid will include a target region or sequence, and the method 100 enables preferential enrichment of one or more target nucleic acids relative to non-target nucleic acids in the nucleic acid library for downstream detection and analysis of those target regions or sequences.

[0122] Continuing with reference to step 102, the nucleic acid is optionally fragmented and an adapter is connected to each end of the nucleic acid. Exemplary methods for preparing nucleic acid fragment libraries for the present disclosure include transposon-mediated fragmentation and labeling, mechanical shearing, enzymatic digestion, overhanging ends (e.g., T / A) or blunt end connection, template switching-mediated adapter connection, etc. and combinations thereof. Ultimately, the product of step 102 of preparing nucleic acid library fragments can produce a nucleic acid library, wherein each of the nucleic acids in the nucleic acid library has a first end comprising a first adapter and a second end comprising a second adapter. It is worth noting that the first adapter and the second adapter may be the same or different, and may further present various forms, including but not limited to forked or Y-shaped adapters, blunt-end adapters, overhanging end adapters, hairpin adapters, etc. and combinations thereof, having complementary and non-complementary portions. In general, at least a portion of the aforementioned adapters is double-stranded; however, other adapter configurations may also be used to prepare nucleic acid fragment libraries according to the present disclosure. In addition, with respect to hairpin adapters, including blocking elements (e.g., 3' dideoxynucleotides or phosphate groups) may help prevent self-priming events.

[0123] The next step 104 of method 100 can include hybridizing the first oligonucleotide primer with the target nucleic acid present in the nucleic acid library to form an unextended first primer-target complex. In one embodiment, the first oligonucleotide primer is a target-specific primer with a defined sequence complementary to the target nucleic acid sequence. An example of a target-specific primer is a gene-specific primer designed to hybridize with a target gene (e.g., cDNA, genomic DNA) or its vicinity (e.g., upstream or 5'). The target nucleic acid can be RNA, DNA or a combination thereof. The first oligonucleotide primer can be an oligonucleotide primer consisting of ribonucleic acid, deoxyribonucleic acid, modified nucleic acid (e.g., biotinylated, locked nucleic acid, inosine, Seela bases, etc.) or other nucleic acid analogs known in the art.

[0124] In various embodiments of the present disclosure, the first oligonucleotide primer may include one or more modified bases, capture moiety or its combination. In the case where the first oligonucleotide primer includes a capture moiety, before the step 104 of hybridizing the first oligonucleotide primer with the target nucleic acid, the first oligonucleotide primer may be attached to a solid support or be free in solution (that is, not in conjunction with or otherwise attached to a solid support). In the embodiment where the first oligonucleotide primer including the capture moiety is not attached to a solid support via the capture moiety, step 104 may be carried out in solution. In the embodiment where the first oligonucleotide primer including the capture moiety is attached to a solid support via the capture moiety, step 104 may be carried out in situ. It is noteworthy that in the case of in situ reaction, the primer-target complex not extended by the obtained will be attached to a solid support. Any non-target nucleic acid or target nucleic acid not annealed with the first oligonucleotide primer retained in the solution may be removed by separating the solution from the solid support combined with the primer-target complex.

[0125] The next step 106 of method 100 includes performing a first primer extension reaction. On the one hand, step 106 includes extending the hybridized first oligonucleotide primer with a first polymerase. After the first oligonucleotide primer is hybridized with the target nucleic acid template in step 104, the first oligonucleotide primer is extended by the first polymerase, thereby generating a first primer extension product or complex comprising the 3' region of the extended first oligonucleotide primer, which region comprises the reverse complement of at least a portion of the target nucleic acid template. As described herein, hybridization and extension reactions are optionally performed simultaneously, while in other embodiments, hybridization and extension reactions are performed separately (e.g., sequentially) and can be separated by a washing step of removing unannealed and uncaptured target nucleic acids from the reaction mixture. In addition, step 104 may further include the termination of the primer extension reaction to control the length of the extended first oligonucleotide primer. It is noteworthy that the length of the extended first oligonucleotide primer product can be actively controlled by techniques (such as inactivating the polymerase added in step 104), or passively controlled by allowing the reaction to complete (such as by consuming the limiting reactant) or by controlling / selecting the size of the nucleic acid fragments in the nucleic acid library in step 102 of method 100.

[0126] Method 100 further includes a step 108 of capturing a first primer extension complex. The capture of the first primer extension complex can be achieved in a variety of ways disclosed herein, and can be achieved before, simultaneously, or after step 104 and step 106 of method 100. As described above, the first oligonucleotide can include a capture portion, which can be used to capture the first oligonucleotide primer on a solid support before, during, or after step 104 or step 106 of method 100. In another example, the extension of the first oligonucleotide primer after hybridization with the target nucleic acid includes the incorporation of one or more modified nucleotides. The modified nucleotides can include a capture portion or can be configured to enable downstream modification of the modified nucleotides to attach or otherwise incorporate the capture portion into the extension portion of the first primer extension complex. Therefore, the first primer extension complex can be captured by a capture portion associated with one or more modified nucleotides during or after step 106. The choice of whether to capture the target nucleic acid, annealed primer-target complex, or target-extended primer complex further determines whether steps 104 and 106 of the method are performed in solution or in situ.

[0127] The next step 110 of method 100 may include enriching the first primer extension complex. In one aspect, step 110 includes one or more purification and enrichment steps for recovering the first primer extension complex from non-target nucleic acids and other molecules in the library, such as unused reaction components (e.g., nucleotides, primer molecules, ATP, etc.), enzymes, buffers, etc. In some embodiments, step 110 includes enzymatic digestion, size exclusion-based purification, affinity-based purification, etc. or a combination thereof. It is noteworthy that the enrichment of the first primer extension product can be measured relative to the total amount of the nucleic acid library. In one aspect, enrichment involves increasing the concentration of the target nucleic acid by consuming (i.e., removing) other members of the nucleic acid library that are not target nucleic acids.

[0128] The next step 112 of method 100 can include hybridization of the target nucleic acid present in the second oligonucleotide primer and the nucleic acid library. On the one hand, the second oligonucleotide primer is a target-specific primer (opposite to hybridization or complementation with one or both of the first adapter and the second adapter) combined with the target region in the target nucleic acid. On the other hand, the target nucleic acid is a part of the first primer extension complex during step 112. For example, the second oligonucleotide primer can be hybridized with the target nucleic acid at the 5' position (i.e. upstream) of the first oligonucleotide primer extended in the first primer extension complex. In this case, the unextended second primer-target complex obtained includes the first extended oligonucleotide primer, the target nucleic acid hybridized with the first extended oligonucleotide primer, and the second (unextended) oligonucleotide primer. When the first primer extension product is attached to a solid support during step 112, the unextended second primer-target complex will be attached to the solid support similarly. In other embodiments, the first primer extension product is released from the solid support and is in solution (eg, after removal of non-target nucleic acids from the reaction mixture) to enable hybridization of the second oligonucleotide primer in solution in step 112 .

[0129] The next step 114 of method 100 includes performing a second primer extension reaction. After the second oligonucleotide primer hybridizes with the target nucleic acid template in step 112, the second oligonucleotide primer is extended by the second polymerase, thereby generating a second primer extension product or complex comprising the target nucleic acid. The extended second oligonucleotide primer includes a 3' region of the reverse complement of at least a portion of the target nucleic acid template. On the one hand, the second oligonucleotide primer is extended with the second polymerase to release the extended first oligonucleotide primer from the complex with the target nucleic acid. The extended first oligonucleotide from the first primer extension complex can include one or more of strand displacement (e.g., by polymerase) or digestion (e.g., by nuclease). For example, the release of the extended first oligonucleotide can be achieved with an enzyme having at least one of strand displacement activity, 5' to 3' exonuclease activity and flap endonuclease activity.

[0130] As described herein, step 112 and step 114 are optionally performed simultaneously, while in other embodiments, step 112 and step 114 are performed separately (e.g., sequentially). In addition, step 114 may further include termination of the primer extension reaction to control the length of the extended second oligonucleotide primer. It is noteworthy that the length of the extended second oligonucleotide primer product can be actively controlled by technology (such as inactivating the polymerase added in step 114), or passively controlled by enabling the reaction to be completed (such as by consuming limiting reactants) or by controlling / selecting the size of the nucleic acid fragments in the nucleic acid library.

[0131] In the case where the extended first primer includes one or more capture moieties attached to a solid support, the release of only the extended first oligonucleotide in step 114 leaves the second primer extension complex free in solution, rather than attached to the solid support. Thus, as described in step 110 of method 100, one or more purification techniques may be performed after step 114 to recover the unbound second extension product or complex including the target nucleic acid from the support-attached first extended oligonucleotide primer, the second polymerase, other reaction components, etc., and combinations thereof.

[0132] In some embodiments, the first primer and the extended primer have a capture sequence that is at least partially complementary to the capture oligonucleotide. This sequence can be referred to as a "universal capture sequence". The capture oligonucleotide contains a sequence that is at least partially complementary to the capture sequence in the first primer. The capture oligonucleotide can be referred to as a "universal capture oligonucleotide". The capture oligonucleotide is not extendable by a nucleic acid polymerase and cannot act as a primer itself. In some embodiments, the capture oligonucleotide comprises a capture portion. In other embodiments, the capture oligonucleotide is attached to a solid support. For detailed descriptions of these embodiments, see Fig. 8A , Figure 8B , Figure 8C , Fig.8D and Fig. 8E as well as Fig.9A and Fig. 9B .

[0133] Method 100 further includes an amplification step 116. Step 116 can involve linear or exponential amplification (e.g., PCR). In general, step 116 includes amplifying the target nucleic acid molecule with a third polymerase, a first amplification primer, and a second amplification primer. On the one hand, the first amplification primer and the second amplification primer are designed to be complementary to the adapter sequence of the target nucleic acid incorporated into the nucleic acid library in step 102. For example, the first amplification primer can have a 3' end complementary to the first adapter, and the second amplification primer can have a 3' end complementary to the second adapter. However, the amplification primer can include any sequence (e.g., gene / target specific primers, universal primers, etc.) present in the target nucleic acid to be amplified, and can support the synthesis of one or two chains (i.e., both the upper and lower chains of the double-stranded nucleic acid corresponding to the template of the amplification reaction).

[0134] In some embodiments, step 116 enables selective amplification of target nucleic acid from nucleic acid library, which is opposite to any one of the first or second extended oligonucleotide primers derived from target nucleic acid. In one example, uracil compatible polymerase and dUTP are included in one or both of the extension reactions carried out in step 106 and step 114. The extended oligonucleotide primer produced by the reaction will include at least one uracil nucleotide, and the target nucleic acid template can be a DNA template without uracil nucleotide. Thereafter, uracil incompatible polymerase is included in step 116 to amplify target nucleic acid. Uracil incompatible polymerase can amplify target nucleic acid without uracil nucleotide; However, uracil incompatible polymerase will not be able to replicate the extended oligonucleotide primer containing uracil. Alternatively or in addition, the product containing uracil can be selectively digested or otherwise degraded, thus leaving only the original molecule from the nucleic acid library.

[0135] After amplification step 116, method 100 may include step 118 of analyzing the amplified target nucleic acid. Step 116 may include any method for determining the nucleic acid sequence of one or more products of method 100. Step 116 may further include sequence alignment, identification of sequence variations, counting of unique primer extension products, the like, or a combination thereof.

[0136] In addition to the key elements of the present disclosure summarized in method 100, it may also be useful to consider that many additional considerations are present when implementing the test kit, composition and method described herein.On the one hand, the primer hybridization step is mediated by the target specific region of primers.In certain embodiments, the target specific region can be hybridized with the gene region in the exon, intron or non-translated part or the non-transcribed part (such as promoter or enhancer) of the gene being positioned at.In certain embodiments, the gene is a protein coding gene, but in other embodiments, the gene is not a protein coding gene, such as an RNA coding gene or a pseudogene.In other embodiments again, the target specific region is located in the intergenic region.For mRNA or cDNA targets, primers can include oligo-dT sequences.

[0137] Primer can contain degenerate sequence (i.e. a string of randomly incorporated nucleotides), rather than pre-designed target specific region. Such primers can also find binding site in genome and serve as target specific primers of this binding site. It should be noted that the fully degenerate primers of each nucleotide position degenerate may not be used for targeted enrichment. However, only the partially degenerate primers of the partial nucleotide position degeneracy can be used for purposes according to the present disclosure. For example, primers with partial degeneracy at the single nucleotide position can be used for capturing a target sequence comprising one or more single nucleotide polymorphisms (SNPs).

[0138] In addition to the target specific region, primers can include other sequences. In certain embodiments, these sequences are located relative to the 5' end of the target specific region. In other embodiments, these sequences can be included elsewhere in the primer, as long as the target specific region can hybridize with the target and drive the primer extension reaction as described below. The other sequence in the primer can include one or more barcode sequences, such as unique molecular recognition sequence (UID) or multiple sample identification sequence (MID). The barcode sequence can exist as a single sequence or as two or more sequences.

[0139] In some embodiments, the additional sequences include sequences that facilitate ligation to the 5' end of the primer.The primers may contain universal ligation sequences that enable ligation of adaptors, as described in the following sections.

[0140] In some embodiments, the additional sequences include one or more binding sites for one or more universal amplification primers.

[0141] In some embodiments, the primers contain a universal capture sequence that enables capture of the primer and primer extension products via hybridization to a capture oligonucleotide (see Fig. 8A , Figure 8B , Figure 8C , Fig.8D and Fig. 8E as well as Fig.9A and Fig. 9B ).

[0142] The primer extension step is performed by a nucleic acid polymerase. Depending on the type of nucleic acid being analyzed, the polymerase can be a DNA-dependent DNA polymerase ("DNA polymerase") or an RNA-dependent DNA polymerase ("reverse transcriptase").

[0143] In certain embodiments, it is desirable to control the length of the nucleic acid chain synthesized in the primer extension reaction. As explained below, the length of the chain determines the length of the nucleic acid subjected to the subsequent steps of the method and any downstream applications. The extension reaction can be terminated by any method known in the art. For example, the reaction can be physically stopped by changing the temperature or adding a polymerase inhibitor. In certain embodiments, the reaction is stopped by placing the reaction on ice. In other embodiments, the reaction is stopped by raising the temperature to inactivate a non-thermostable polymerase. In other embodiments, the reaction is stopped by adding a chelating agent, such as EDTA, a key cofactor capable of chelating an enzyme, or another chemical or biological substance compound capable of reversibly or irreversibly inactivating an enzyme.

[0144] Another method to control the length of primer extension products is to directly limit the extension length or Mg by limiting key components (e.g., dNTPs). 2+To starve the extension reaction, thereby slowing the extension rate and improving the ability to control the extension stop point. One skilled in the art can experimentally or theoretically determine the appropriate amount of the key component that allows limited primer extension to produce primarily products of the desired length.

[0145] Another method of controlling the length of primer extension products is to add terminator nucleotides, including reversible terminator nucleotides. One skilled in the art is able to experimentally or theoretically determine the appropriate ratio of terminator and non-terminator nucleotides that allows limited primer extension to produce primarily products of the desired length. Examples of terminator nucleotides include dideoxynucleotides; 2'-phosphate nucleotides, as described in U.S. Pat. No. 8,163,487 to Gelfand et al.; 3'-O-blocked reversible terminators and 3' unblocked reversible terminators, as described, for example, in U.S. Patent Application Publication No. 2014 / 0242579 to Zhuo et al. and Guo, J. et al., Four-color DNA sequencing with 3'-O-modified nucleotide reversible terminators and chemically cleavable fluorescent dideoxynucleotides, PNAS 2008 105 (27) 9145-9150. Yet another method of controlling the length of primer extension products is to add a limited amount of uracil (dUTP) to the primer extension reaction. The DNA containing uracil can then be treated with uracil-N-DNA glycosylase to produce abasic sites. DNA with abasic sites can be degraded by heat treatment and optionally adding alkali to improve degradation efficiency, as described in U.S. Pat. No. 8,669,061 of Gupta et al. Those skilled in the art can experimentally or theoretically determine the appropriate ratio of dUTP to dTTP in an extension reaction that allows limited inclusion of dUTP to produce mainly desired length products after endonuclease treatment.

[0146] In some embodiments, the length of the extension product is essentially limited by the length of the input nucleic acid. For example, the cell-free DNA present in maternal plasma is less than 200 bp in length, with most being 166 bp in length. Yu, SCY et al., Size-based molecular diagnostics using plasma DNA for noninvasive prenatal testing, PNAS USA 2014; 111(23):8583-8. The median length of cell-free DNA found in the plasma of healthy individuals and cancer patients is about 185 bp to 200 bp. Giacona, MB et al., Cell-free DNA in human blood plasma: length measurements in patients with pancreatic cancer and healthy controls, Pancreas 1998; 17(1):89-97. Poorly preserved or chemically treated samples may contain chemically or physically degraded nucleic acids. For example, formalin-fixed paraffin-embedded tissue (FFPET) typically produces nucleic acids with an average length of 150 bp.

[0147] In certain embodiments, the method of the present invention is included in one or more purification steps after primer extension by DNA polymerase or reverse transcriptase.Purification will remove unused primer molecules and template molecules for producing primer extension products.In certain embodiments, template nucleic acid and all nucleic acid fragments except the extended primer are removed by exonuclease digestion.In this embodiment, the primer used in primer extension can have 5'-end modification so that primer and any extension product resist exonuclease digestion.The example of such modification includes thiophosphate bonding.In other embodiments, RNA template can be removed by enzymatic treatment, which will retain DNA, such as RNA enzyme digestion, including RNA enzyme H digestion.In other embodiments, by size exclusion method such as gel electrophoresis, chromatography or isotachophoresis or accelerated electrophoresis (epitachophoresis), primer and large-size template DNA are separated from extension product.

[0148] In certain embodiments, purification is carried out by affinity binding. In a variation of this embodiment, affinity is directed to a specific target sequence (sequence capture). In other embodiments, the primer comprises an affinity tag. Any affinity tag known in the art can be used, such as biotin, an antibody, or an antigen in which a specific antibody is present. The affinity partner of the affinity tag can be present in a solution, for example, on a solid phase solid carrier (such as a suspended particle or a bead), or combined with a solid support. In the affinity purification process, unbound components in the reaction mixture are washed away. In certain embodiments, additional steps are taken to remove unused primers. In certain embodiments, affinity capture changes the charge of the primer extension product. For example, one or more biotinylated nucleotides are included and combined or streptavidin produces a changed charge on a nascent nucleic acid chain. The changed charge can be used to separate nascent chains (primer extension products) by isotachophoresis or accelerated electrophoresis.

[0149] It is noteworthy that the methods of the present disclosure do not require a connection step (e.g., adding a common sequence to the extended first or second oligonucleotide primer). However, in some embodiments, the present invention includes a connection step. For example, a homopolymer tail can be added to the 3' end of the nucleic acid. In this embodiment, the homopolymer can act as a binding site for a reverse complementary homopolymer (similar to a poly-A tail with a poly-T primer for mRNA). Connection adds one or more adapter sequences to the primer extension product generated in the previous step. The adapter sequence supplies one or more universal priming sites (for amplification or sequencing) and optionally one or more barcodes. The exact mode of connecting the adapter is not important, as long as the adapter is associated with the primer extension product and enables the following subsequent steps to be performed.

[0150] In some of the above embodiments, the method relates to a target-specific primer that includes a universal priming sequence ("priming site") and produces a primer extension product with a single priming site. In such embodiments, only one additional priming sequence ("priming site") is required to achieve exponential amplification. In other embodiments, the target-specific primer does not include a universal priming site. In such embodiments, two priming sites need to be provided to enable exponential amplification. The adapter with a universal priming site can be added by any single-stranded ligation method available in the art.

[0151] An example of single-stranded ligation method can be used in embodiments where the extended primer includes a universal ligation site. In such embodiments, an adapter having a double-stranded region and a single-stranded overhang complementary to the universal ligation site in the primer can be annealed and connected. Annealing the single-stranded 3' overhang of the adapter to the universal ligation site at the 5' end of the primer will produce a double-stranded region, which has a gap in the chain containing the primer extension product. The two chains can be connected at the nick by DNA ligase or another enzyme or a non-enzymatic reagent that can catalyze the reaction between the 5' phosphate of the primer extension product and the 3' OH of the adapter. By connecting the adapter, a universal priming site is provided at one end of the primer extension product.

[0152] Another example of the single-stranded connection method can be used to add a universal priming site to the opposite end of the primer extension product (or, in an embodiment where the extension primer does not include a universal connection site, to both sides of the extension product). For this embodiment, one or both ends of the primer extension product to be connected do not have a universal connection site. Further, in some embodiments, at least one end of the primer extension product to be connected has an unknown sequence (e.g., due to a random termination event or an unknown sequence variation). In such an embodiment, a single-stranded connection method that does not depend on the sequence is adopted. An exemplary method is described in U.S. Application Publication No. 20140193860. In essence, the method uses a group of adapters whose single-stranded 3' ends protrude instead of having a universal connection site, and the adapter has a random sequence, such as a random hexamer sequence. In some embodiments of the method, the adapter also has a hairpin structure. Another example is a method performed by ACCEL-NGS1SDNA library kit (SwiftBiosciences, Ann Arbor, Mich.).

[0153] The ligation step of the method utilizes a ligase or another enzyme or non-enzymatic reagent with similar activity. The ligase can be a DNA or RNA ligase, such as a ligase of viral or bacterial origin, such as T4 or E. coli ligase, or a thermostable ligase Afu, Taq, Tfl or Tth. In some embodiments, alternative enzymes, such as topoisomerases, can be used. Further, as described and cited in U.S. Patent Application Publication 2014 / 0193860 by Bevilacqua et al., a non-enzymatic reagent can be used to form a phosphodiester bond between the 5' phosphate of the primer extension product and the 3' OH of the adapter.

[0154] In some embodiments of the method, the first connection of the adapter is followed by optional primer extension. The connected adapter has a free 3' end, which can be extended to produce a double-stranded nucleic acid. Then, the end opposite to the adapter will be suitable for the flat end connection of another adapter. Avoiding the need for single-stranded connection procedures, this double-stranded end of the molecule can be connected to the double-stranded adapter by any ligase or another enzymatic or non-enzymatic manner. The double-stranded adapter sequence supplies one or more universal priming sites (for amplification or sequencing) and optional one or more barcodes.

[0155] In some embodiments, the methods of the invention include one or more purification steps after the ligation step. Purification will remove unused adaptor molecules. Adaptors and oversized ligation products are separated from extension products by size exclusion methods such as gel electrophoresis, chromatography, or isotachophoresis.

[0156] In some embodiments, purification is performed by affinity binding. In a variation of this embodiment, affinity is directed to a specific target sequence (sequence capture). In other embodiments, the adapter comprises an affinity tag. Any affinity tag known in the art (e.g., biotin or an antibody or an antigen for which a specific antibody exists) can be used. The affinity partner of the affinity tag can be associated with a solution phase support (e.g., on a suspended particle or a bead), or can be combined with a solid support. During affinity purification, unbound components in the reaction mixture are washed away. In some embodiments, additional steps are taken to remove unused adapters.

[0157] In some embodiments, the present invention includes an amplification step. This step may involve linear or exponential amplification (e.g., PCR). The primers used for amplification may include any sequence present in the amplified nucleic acid and that can support the synthesis of one or two chains. Amplification may be isothermal or involve thermal cycling.

[0158] In some embodiments, amplification is exponential and involves PCR. It is desirable to reduce PCR amplification deviation. If one or more gene-specific primers are used, in order to reduce deviation, the method involves a limited number of amplification cycles (e.g., about 10 or less cycles). In other variations of these embodiments, universal primers are used to synthesize two chains. The universal primer sequence can be a part of the original extension primer of one or two connected adapters. One or two universal primers can be used. The above-mentioned extension primer and one or two adapters can be engineered to have the same primer binding site. In this embodiment, a single universal primer can be used to synthesize two chains. In other embodiments, the extension primer (or adapter) on one side of the molecule to be amplified and the adapter on the other side contain different universal primer binding sites. The universal primer can be paired with another universal primer (of the same or different sequence). In other embodiments, the universal primer can be paired with a gene-specific primer. Since the use of universal primers to carry out PCR reduces sequence deviation, there is no need to limit the number of amplification cycles to the same extent as the use of gene-specific primers to carry out PCR. The number of amplification cycles using universal primers can be lower, but can also be up to about 20, 30 or more cycles.

[0159] The present invention includes the use of molecular barcodes. Barcodes are generally composed of 4 to 36 nucleotides. In some embodiments, barcodes are designed to have melting temperatures that differ by 10°C or less from each other. Barcodes can be designed to form a minimized cross-hybridization group, i.e., a sequence combination that forms as few stable hybrids as possible under the desired reaction conditions. The design, placement, and use of barcodes for sequence identification and counting are known in the art. See, for example, U.S. Patent Nos. 7,393,665, 8,168,385, 8,481,292, 8,685,678, and 8,722,368.

[0160] A barcode can be used to identify each nucleic acid molecule in a sample and its progeny (ie, a set of nucleic acid molecules generated using the original nucleic acid molecule). Such a barcode is a "unique ID" (UID).

[0161] Barcodes can also be used to identify the sample from which the analyzed nucleic acid molecule originated. Such barcodes are "multiple sample IDs" ("MIDs"). All molecules from the same sample share the same MID.

[0162] Barcodes include unique nucleotide sequences specific to each barcode. In certain embodiments, the sequence of the barcode is pre-designed. In other embodiments, the barcode sequence is random. All or some nucleotides in the barcode can be random. The random sequence and random nucleotide bases in a known sequence are referred to as "degenerate sequences" and "degenerate bases", respectively. In certain embodiments, a molecule includes two or more barcodes: one for molecule identification (UID) and one for sample identification (MID). Sometimes, UID or MID each include several barcodes, which together enable identification of molecules or samples.

[0163] In some embodiments, the number of UIDs in the reaction can exceed the number of molecules to be labeled. In some embodiments, one or more barcodes are used to group or bin sequences. For example, in some embodiments, one or more UIDs are used to group or bin sequences, wherein the sequences in each bin contain the same UID, i.e., are amplicons derived from a single target molecule. In some embodiments, UIDs are used to align sequences. In other embodiments, target-specific regions are used to align sequences. In some embodiments of the invention, UIDs are introduced in the initial primer extension event, and sample barcodes (MIDs) are introduced in the connected adapters.

[0164] After connection has been carried out, the nucleic acid product can be sequenced.Sequencing can be implemented by any method known in the art.Especially advantageous is high-throughput single-molecule sequencing.The example of such technology includes 454LIFE SCIENCES GS FLX platform (454LIFE SCIENCES) ILLUMINA HISEQ platform (ILLUMINA), ION TORRENT platform (LIFETECHNOLOGIES), PACIFIC BIOSCIENCES platform (PACIFIC BIOSCIENCES) utilizing SMRT sequencing technology and any other currently existing or future single-molecule sequencing technology involving or not involving sequencing while synthesizing.In the variation of these embodiments, sequencing utilizes universal primer sites present in one or two adapter sequences or present in one or two primer sequences.In other variations of these embodiments again, gene-specific primers are used to sequence.However, it should be noted that, compared with gene-specific primers, universal primers are relevant to the sequencing deviation reduced.

[0165] In certain embodiments, the sequencing step involves sequence analysis. In certain embodiments, a consensus sequence is determined from a plurality of sequences (e.g., a plurality of sequences with the same unique molecule ID (UID)) using comparison. In certain embodiments, comparison is used to identify sequence variations, such as single nucleotide variations (SNVs). In certain embodiments, the consensus sequence is determined from a plurality of sequences all with the same UID. In other embodiments, UID is used to eliminate artifacts, i.e., variations (characterized by specific UIDs) present in single molecule offspring. Such artifacts derived from PCR errors or sequencing errors can be eliminated using UIDs.

[0166] In some embodiments, the number of each sequence in the sample can be quantified by quantifying the relative number of sequences of each UID in a population with the same multiple sample ID (MID). Each UID represents a single molecule in the original sample, and counting the different UIDs associated with each sequence variation can determine the proportion of each sequence variation in the original sample, where all molecules share the same MID. Those skilled in the art will be able to determine the number of sequence reads necessary for determining the consensus sequence. In some embodiments, for accurate quantitative results, each UID ("sequence depth") needs to read the relevant number. In some embodiments, the desired depth is 5-50 reads per UID.

[0167] The sample used in the inventive method includes any individual (e.g., people, patients) or environmental sample containing nucleic acid. Polynucleotides can be extracted from the sample, or the sample can be directly subjected to the method of the present invention. The initial sample can also be nucleic acid, DNA or RNA extracted or separated. The sample can constitute any tissue or fluid obtained from an organism. For example, the sample can be a tumor biopsy or a blood or plasma sample. In certain embodiments, the sample is a formalin-fixed, paraffin-embedded (FFPE) sample. The sample can include nucleic acids from one or more sources (e.g., one or more patients). In certain embodiments, tissue can be infected by pathogens and therefore contain nucleic acids of host and pathogens.

[0168] DNA extraction methods are well known in the art. See J. Sambrook et al., "Molecular Cloning: A Laboratory Manual", 1989, 2nd edition, Cold Spring Harbor Laboratory Press: New York, NY. Various kits are commercially available for extracting nucleic acids (DNA or RNA) from biological samples (e.g., BDBIOSCIENCES CLONTECH (Palo Alto, Cal.), EPICENTRE TECHNOLOGIES (Madison, Wisc.); GENTRA SYSTEMS, INC. (Minneapolis, Minn.); and QIAGEN, INC. (Valencia, Cal.), AMBION, INC. (Austin, Tex.); BIORAD LABORATORIES (Hercules, Cal.); etc.

[0169] In certain embodiments, the starting sample used in the method of the present invention is a library, for example a genomic library or an expression library comprising a plurality of polynucleotides. In other embodiments, a library is created by the method of the present invention. By taking a biological sample as a starting material, the method creates an amplification library or an amplicon set representing a variety or sequence. The library can be stored and used repeatedly to further amplify or order-check the nucleic acid in the library.

[0170] According to one embodiment of the present disclosure, a method for primer extension target enrichment may include primer-mediated capture of target nucleic acids in solution. Figure 2A , Figure 2B , Figure 2C , Figure 2D and Figure 2E , the nucleic acid library includes a target nucleic acid 200, which includes a region of interest (ROI) 202 ( Figure 2A ). The target nucleic acid 200 further includes a first end comprising a first adaptor 204 and a second end comprising a second adaptor 206. Figure 2A , Figure 2B , Figure 2C , Figure 2D and Figure 2E, the target nucleic acid 200 is shown as a single-stranded nucleic acid, wherein the first adaptor 204 is located at the 3' end (i.e., the first end) of the target nucleic acid 200 and the second adaptor 206 is located at the 5' end (i.e., the second end) of the target nucleic acid 200. The first oligonucleotide 208 hybridizes with the target nucleic acid 200 in the nucleic acid library. The first oligonucleotide 208 includes a 3' target-specific region 210 complementary to the target nucleic acid and a capture portion 212. In the illustrated embodiment, the target-specific region 210 is complementary to the ROI 202.

[0171] like Figure 2B As shown, the hybridized first oligonucleotide 208 is extended with a first polymerase (not shown), thereby generating a first primer extension complex 214 comprising the target nucleic acid 200 and the extended first oligonucleotide 216 (wherein the dotted line indicates the extended portion of the extended first oligonucleotide 216). The first primer extension complex 214 is captured on a solid support 218. The solid support can be a solution phase support (e.g., a bead or another similar particle) or a solid phase support (e.g., a silicon wafer, a glass slide, etc.). For example, magnetic glass particles and devices using the magnetic glass particles can be used, as described in U.S. Patents 656568, 6274386, 7371830, 6870047, 6255477, 6746874 and 6258531. In Figure 2B In the illustrated embodiment, the first primer extension complex 214 is captured on a solid support via a capture moiety 212. After capture, the first primer extension complex 214 is enriched relative to the nucleic acid library.

[0172] Steering Figure 2C , the second oligonucleotide 220 hybridizes to the target nucleic acid 200. The second oligonucleotide 220 is complementary to the target nucleic acid 200 and hybridizes to the target nucleic acid 200 at a 5' position relative to the target specific region 210 of the first oligonucleotide 208. In the illustrated embodiment, the second oligonucleotide 220 is complementary to and hybridizes to the target nucleic acid 200 at a position just outside the ROI 202; however, it should be understood that the first oligonucleotide 208 and the second oligonucleotide 220 can be designed to hybridize at any defined position along the length of the target nucleic acid 200, wherein the second oligonucleotide 220 hybridizes to the target nucleic acid 200 at a 5' position relative to the target specific region 210 of the first oligonucleotide 208. Figure 2C It can be seen that both the first extended oligonucleotide 216 (which is attached to the solid support 218 ) and the second oligonucleotide 220 are hybridized to the target nucleic acid 200 .

[0173] refer to Figure 2D, the hybridized second oligonucleotide 220 is extended with a second polymerase (not shown), thereby generating a second primer extension complex 222 including the target nucleic acid 200 and the extended second oligonucleotide 224 (wherein the dotted line indicates the extended portion of the extended second oligonucleotide 224). On the one hand, the extension of the hybridized second oligonucleotide 220 releases the extended first oligonucleotide 216 from the first primer extension complex 214. On the other hand, the extended first oligonucleotide 216 (including the first oligonucleotide primer 208) remains attached to the solid support 218.

[0174] like Figure 2E As shown, target nucleic acid 200 is amplified using a third polymerase (not shown), a first amplification primer 226, and a second amplification primer 228. First amplification primer 226 includes a 3' end complementary to first adaptor 204, and second amplification primer 228 includes a 3' end complementary to the same sequence as second adaptor 206.

[0175] According to another embodiment of the present disclosure, a method for primer extension target enrichment may include in situ primer-mediated capture of target nucleic acid. Figure 3A and Figure 3B , the nucleic acid library includes a target nucleic acid 300, which includes a region of interest (ROI) 302 ( Figure 3A ). The target nucleic acid 300 further includes a first end comprising a first adaptor 304 and a second end comprising a second adaptor 306. Figure 3A and Figure 3B , the target nucleic acid 300 is shown as a single-stranded nucleic acid, wherein the first adaptor 304 is located at the 3' end (i.e., the first end) of the target nucleic acid 300 and the second adaptor 306 is located at the 5' end (i.e., the second end) of the target nucleic acid 300. A first oligonucleotide 308 hybridizes with the target nucleic acid 300 in the nucleic acid library. The first oligonucleotide 308 includes a 3' target-specific region 310 complementary to the target nucleic acid 300 and a capture portion 312. In the illustrated embodiment, the target-specific region 310 is complementary to the ROI 302.

[0176] and Figure 2A , Figure 2B , Figure 2C , Figure 2D and Figure 2E Compared to the embodiment shown, the first oligonucleotide 308 is captured on a solid support 318 before or while the first oligonucleotide 308 is hybridized to the target nucleic acid 300. The solid support 318 can be a solution phase support (e.g., a bead or another similar particle) or a solid phase support (e.g., a silicon chip, a glass slide, etc.). Figure 3A In the illustrated embodiment, the first oligonucleotide 308 is captured on a solid support 318 via a capture moiety 312. Figure 2B, the hybridized first oligonucleotide 308 is extended with a first polymerase (not shown), thereby generating a first primer extension complex 314 comprising the target nucleic acid 300 and the extended first oligonucleotide 316 (wherein the dotted line indicates the extended portion of the extended first oligonucleotide 316). It is worth noting that the first primer extension complex 314 is captured on the solid support 318, so that the target nucleic acid 300 can be enriched relative to the nucleic acid library. Thereafter, the nucleic acid library can be enriched as shown in FIG. Figure 2C and Figure 2D The second primer hybridization and extension reaction was performed as shown, followed by Figure 2E Amplification steps as shown.

[0177] According to yet another embodiment of the present disclosure, a method for primer extension target enrichment may include extension-mediated capture of target nucleic acid. Figure 4A , Figure 4B , Figure 4C and Figure 4D , the nucleic acid library includes a target nucleic acid 400, which includes a region of interest (ROI) 402 ( Figure 4A ). The target nucleic acid 400 further includes a first end comprising a first adaptor 404 and a second end comprising a second adaptor 406. Figure 4A , Figure 4B , Figure 4C and Figure 4D In FIG. 4 , the target nucleic acid 400 is shown as a single-stranded nucleic acid, wherein the first adaptor 404 is located at the 3' end (i.e., the first end) of the target nucleic acid 400 and the second adaptor 406 is located at the 5' end (i.e., the second end) of the target nucleic acid 400. The first oligonucleotide 408 hybridizes with the target nucleic acid 400 in the nucleic acid library. The first oligonucleotide 408 is complementary to the target nucleic acid 400. It is worth noting that Figure 2A Compared to the first oligonucleotide 208 including the capture portion 212, the first oligonucleotide 408 does not necessarily include the capture portion. Figure 4A In the illustrated example, the first oligonucleotide 408 is complementary to a portion of the ROI 402 .

[0178] like Figure 4B As shown, the hybridized first oligonucleotide 408 is extended with a first polymerase (not shown), thereby generating a first primer extension complex 414 comprising the target nucleic acid 400 and the extended first oligonucleotide 416 (wherein the dotted line indicates the extended portion of the extended first oligonucleotide 416). Figure 4A , Figure 4B , Figure 4C and Figure 4DIn the illustrated embodiment, extension of the first oligonucleotide 408 is performed in the presence of one or more modified nucleic acids 412. Each modified nucleic acid includes a capture portion 412a, or can be modified to add a capture portion 412a simultaneously with or after extension of the first oligonucleotide 416. The incorporation of one or more modified nucleic acids 412 including a capture portion 412a enables extension-mediated capture of the target nucleic acid 400 on a solid support 418. The solid support 418 can be a solution phase support (e.g., a bead or another similar particle) or a solid phase support (e.g., a silicon wafer, a glass slide, etc.). Figure 4B In the illustrated embodiment, the first primer extension complex 414 is captured on a solid support 418 via a modified nucleic acid 412 comprising a capture moiety 412a. After capture, the first primer extension complex 414 is enriched relative to the nucleic acid library.

[0179] Steering Figure 4C , the second oligonucleotide 420 hybridizes to the target nucleic acid 400. The second oligonucleotide 420 is complementary to the target nucleic acid 400 and hybridizes to the target nucleic acid 400 at a 5' position relative to the first oligonucleotide 408. In the illustrated embodiment, the second oligonucleotide 420 is complementary to and hybridizes to the target nucleic acid 400 at a position just inside the ROI 402; however, it should be understood that the first oligonucleotide 408 and the second oligonucleotide 420 can be designed to hybridize at any defined position along the length of the target nucleic acid 400, wherein the second oligonucleotide 420 hybridizes to the target nucleic acid 400 at a 5' position relative to the target specific region 410 of the first oligonucleotide 408.

[0180] refer to Figure 4C , the hybridized second oligonucleotide 420 is extended with a second polymerase (not shown), thereby generating a second primer extension complex 422 including the target nucleic acid 400 and the extended second oligonucleotide 424 (wherein the dotted line indicates the extended portion of the extended second oligonucleotide 424). Before the second oligonucleotide 420 is extended with the second polymerase, the first extended oligonucleotide 416 (which is attached to the solid support 418) and the second oligonucleotide 420 are each hybridized with the target nucleic acid 400. The extension of the hybridized second oligonucleotide 420 releases the extended first oligonucleotide 416 from the first primer extension complex 414. On the other hand, the extended first oligonucleotide 416 (including the first oligonucleotide primer 408 and the modified nucleic acid 412) remains attached to the solid support 418.

[0181] like Figure 4DAs shown, target nucleic acid 400 is amplified using a third polymerase (not shown), a first amplification primer 426, and a second amplification primer 428. First amplification primer 426 includes a 3' end complementary to first adaptor 404, and second amplification primer 428 includes a 3' end complementary to the same sequence as second adaptor 406.

[0182] In one aspect, the target nucleic acids and non-target nucleic acids in the nucleic acid library can exhibit molecular interactions that produce a daisy chain structure. Figure 5 As shown, the target nucleic acid 200 (see also Figure 2A ) includes a ROI, a first adaptor 204, and a second adaptor 206. A first oligonucleotide 208 hybridizes to the target nucleic acid 200. The first oligonucleotide 208 includes a 3' target-specific region 210 and a capture portion 212. The nucleic acid library may further include one or more non-target nucleic acids, which include a first non-target nucleic acid 500 and a second non-target nucleic acid 500'. Similar to the target nucleic acid 200, the first non-target nucleic acid 500 and the second non-target nucleic acid 500' each include a first end including first adaptors 504 and 504', respectively, and a second end including second adaptors 506 and 506', respectively. On the one hand, the first adaptor 204 is at least partially complementary to the first adaptor 504, and the second adaptor 506 is at least partially complementary to the second adaptor 506'. Therefore, the target nucleic acid 200 can form a daisy chain with the non-target nucleic acid 500 and the non-target nucleic acid 500', such as Figure 5 shown.

[0183] According to yet another embodiment of the present disclosure, a method for primer extension target enrichment may include primer-mediated capture of target nucleic acids in solution using a hybridization-driven capture mechanism. Figure 2A , Figure 2B , Figure 2C , Figure 2D and Figure 2E In contrast to the method shown, the capture moiety in the first oligonucleotide is replaced by a universal capture sequence. Capture is achieved by contacting the sample with a universal capture oligonucleotide that is capable of hybridizing to the capture sequence in the first oligonucleotide. The capture oligonucleotide may be referred to as a "universal capture oligonucleotide".

[0184] The capture oligonucleotide is not extendable by nucleic acid polymerase and cannot act as a primer itself. In some embodiments, the capture oligonucleotide comprises a capture portion ( Fig. 8A , Figure 8B , Figure 8C , Fig.8D and Fig. 8E). In some embodiments, the capture moiety renders the capture oligonucleotide non-extendable. For example, the capture moiety can be biotin conjugated to the 3' end of the capture oligonucleotide. Having universal capture oligonucleotides (including universal biotinylated capture oligonucleotides) enables significant cost savings compared to generating a set of multiple biotinylated target-specific primers ("first primers") for each application. Reducing the cost of target-specific oligonucleotides ("first primers") further enables increasing their concentration and improving target nucleic acid recovery. In some embodiments, having a universal capture sequence (e.g., Fig. 8A , Figure 8B , Figure 8C , Fig.8D and Fig. 8E ) can be a first primer having a capture moiety (e.g., biotin, e.g., as in Figure 2A , Figure 2B , Figure 2C , Figure 2D and Figure 2E The excess first primer can be removed, for example, by exonuclease digestion prior to capture with a capture oligonucleotide.

[0185] like Fig. 8A , Figure 8B , Figure 8C , Fig.8D and Fig. 8E As shown, the nucleic acid library includes a target nucleic acid 800, which includes a region of interest (ROI) 802 ( Fig. 8A ). The target nucleic acid 800 further includes a first end comprising a first adaptor 804 and a second end comprising a second adaptor 806. Fig. 8A , Figure 8B , Figure 8C , Fig.8D and Fig. 8E , a target nucleic acid 800 is shown as a single-stranded nucleic acid, wherein a first adaptor 804 is located at the 3' end (i.e., the first end) of the target nucleic acid 800 and a second adaptor 806 is located at the 5' end (i.e., the second end) of the target nucleic acid 800. A first oligonucleotide 808 hybridizes with the target nucleic acid 800 in the nucleic acid library. The first oligonucleotide 808 includes a 3' target-specific region 810 that is complementary to the target nucleic acid. The oligonucleotide 808 further includes a universal sequence 812 in its 5'-portion.

[0186] like Figure 8BAs shown, the hybridized first oligonucleotide 808 is extended with a first polymerase (not shown), thereby generating a first primer extension complex 814 comprising the target nucleic acid 800 and the extended first oligonucleotide 816 (wherein the dashed line indicates the extended portion of the extended first oligonucleotide 816). Universal capture oligonucleotide 813 present in the solution hybridizes with universal sequence 812. Universal capture oligonucleotide 813 comprises a capture portion 815.

[0187] In some embodiments, more than one capture oligonucleotide can be used. For example, different types of target nucleic acids (e.g., abundant and less abundant target sequences) can have target-specific primers ("first oligonucleotides" 808) with different capture sequences. The melting temperatures (Tm) of the capture sequences may be different, so that the capture of different target sequences (e.g., abundant and less abundant target sequences) can be performed at different temperatures, and one type of target can be depleted or removed before capturing another type of target. In some embodiments, the use of different capture sequences allows the generation of a more evenly distributed capture nucleic acid library (normalized library).

[0188] In some embodiments, the capture oligonucleotide may contain one or more modified nucleotides that change the melting temperature (Tm) of the duplex DNA. The modified nucleotides may be selected from 5-methylcytosine, 2,6-diaminopurine, SuperT (5-hydroxybutynyl-2-deoxyuridine) and Super G (8-aza-7-deazaguanosine). In addition, the modified nucleotides that confer an increase in Tm include non-DNA nucleotides, including locked nucleic acid (LNA) nucleotides, ribonucleotides, or 2'-O-methyl ribonucleotides.

[0189] like Figure 8C It is further shown that the first primer extension complex 814 is captured on a solid support 818 by capturing a capture moiety 815 conjugated to a universal capture oligonucleotide 813. The solid support 818 can be a solution phase support (e.g., a bead or another similar particle) or a solid phase support (e.g., a silicon wafer, a glass slide, etc.). For example, magnetic glass particles and devices using the magnetic glass particles can be used, as described in U.S. Patents 6274386, 7371830, 6870047, 6255477, 6746874, and 6258531. After capture, the first primer extension complex 814 is enriched relative to the nucleic acid library including the target nucleic acid 800. As Figure 8C Further shown is a second oligonucleotide 820 hybridized to the target nucleic acid 800 within the captured complex 814. The second oligonucleotide 820 is complementary to the target nucleic acid 800 and hybridizes to the target nucleic acid 800 at a 5' position relative to the target specific region 810 of the first oligonucleotide 808. Figure 8CIt can be seen that both the first extended oligonucleotide 816 and the second oligonucleotide 820 are hybridized to the target nucleic acid 800. The second oligonucleotide 820 may be referred to as a "release primer."

[0190] like Fig.8D As shown, the hybridized release primer 820 is extended with a second polymerase (not shown), thereby generating a second primer extension complex 822 including the target nucleic acid 800 and the extended release primer 824 (wherein the dashed line indicates the extended portion of the extended release primer 824). In one aspect, the extension of the hybridized release primer 820 releases the extended first oligonucleotide 816 from the first primer extension complex 814. The released extended first oligonucleotide 816 (including the first oligonucleotide primer 808) remains attached to the solid support 818 via the capture portion 815 conjugated to the universal capture oligonucleotide 813. In some embodiments, the release of the extended first oligonucleotide 816 is achieved by the strand displacement activity, 5' to 3' exonuclease activity, or flap endonuclease activity of a DNA polymerase.

[0191] like Fig. 8E As shown, target nucleic acid 800 is amplified using a third polymerase (not shown), a first amplification primer 826, and a second amplification primer 828. First amplification primer 826 includes a 3' end complementary to first adaptor 804, and second amplification primer 828 includes a 3' end complementary to the same sequence as second adaptor 806.

[0192] According to another embodiment of the present disclosure, Fig. 8A , Figure 8B , Figure 8C , Fig.8D and Fig. 8E The universal capture oligonucleotide shown in is not present in solution but is bound to a solid support. Fig.9A and Fig. 9B As shown, the sample is contacted with a solid support (e.g., beads) coated with a universal capture oligonucleotide. Fig.9A As shown, the nucleic acid library includes a target nucleic acid 900, which includes a target region (ROI) 902. The target nucleic acid 900 further includes adapters 904 and 906. A first oligonucleotide 908 hybridizes with the target nucleic acid 900. The first oligonucleotide 908 includes a 3' target-specific region 910 and a universal sequence 912 in its 5' portion. While or after extending the first oligonucleotide 908 to form an extension product 914 (wherein the extension portion 916 is shown as a dotted line), the first oligonucleotide 908 contacts a universal capture oligonucleotide 913 and hybridizes with the universal sequence 912. In this embodiment, the universal capture oligonucleotide 913 is bound to a solid support 918 via a capture portion 915. Each solid support unit can have a plurality of capture oligonucleotides (not shown) bound thereto.

[0193] In various situations, it may be useful to minimize or eliminate the formation of daisy-chain structures. For example, the capture of target nucleic acid 200 by hybridization and extension of first oligonucleotide 208 can be captured by associating non-target nucleic acid 500' and non-target nucleic acid 500, which can reduce the specificity of the capture and enrichment method. In order to reduce the intermolecular interaction between the adapter ends of target nucleic acid and non-target nucleic acid in the nucleic acid library, the blocking oligonucleotide can be hybridized to the adapter end sequence.

[0194] In order to promote the reduction of off-target hybridization, the blocking oligonucleotide has a sequence complementary to the adapter (e.g., the first adapter 204 and the second adapter 206), and preferentially hybridizes with these adapter sequences. The blocking oligonucleotide can be used in single and multiple forms. In the case of multiple needs, a variety of sample index sequences can be incorporated into the adapter. However, this requires the use of matching blocking oligonucleotides. In the case of using a large number of sample indexes (e.g., 24, 96, etc.), a possibility is to use a "universal" blocking oligonucleotide. Universal blocking oligonucleotides have a unique sequence including non-natural nucleotides that can be combined with a large number of different sample index sequences. As a result, only a single blocking oligonucleotide is added to the nucleic acid sample. Alternatively (or in addition), a single universal blocking oligonucleotide can be a mixture of oligonucleotides that together constitute a universal blocking oligonucleotide composition.

[0195] In one aspect, the universal blocking oligonucleotide comprises a non-specific region flanked by a first and a second specific region. The non-specific region comprises, for example, a run of inosines that align with the sample index sequence when the universal blocking oligonucleotide hybridizes to the target adapter sequence. The specific region of the universal blocking oligonucleotide is complementary to the invariant portion of the adapter sequence and comprises one or more melting temperatures (T m ) modified bases to increase the T of the blocking oligonucleotide-adapter duplex m Table 1 shows the T m Examples of modified base substitutions.

[0196] Table 1:

[0197]

[0198]

[0199] On the other hand, if the adapter ends do not hybridize to each other, an unamplified nucleic acid library prepared with two different adapter sequences can be processed without blocking oligonucleotides. Types of adapters suitable for this method include forked and Y-shaped adapters.

[0200] In some applications of next generation sequencing, target enrichment methods have been used to enrich specific variant alleles relative to reference alleles. As used herein, variant alleles include nucleic acid sequences with one or more variant bases (i.e., core base differences) relative to reference alleles. An example of variant alleles is single nucleotide variation (SNV). By enriching these variant alleles relative to reference alleles before sequencing, the sequencing reads required for detecting variant alleles are fewer. This reduces the overall sequencing cost in applications where the smaller variant allele fraction is in low frequency (<10%, <1%, <0.1%, <0.01%, etc.). An exemplary application is the variant alleles present in enrichment circulating tumor DNA (ctDNA), and the frequencies of these alleles are usually very low (<1%, <0.1%, <0.01%, 0.001%, etc.). Probe hybridization capture methods have been used to achieve this goal (Gydush et al., “Massively parallel enrichment of low-frequency alleles enables duplex sequencing at low depth,” Nat. Biomed. Eng. 6(3):257-266 (2022)).

[0201] The present disclosure also relates to a faster and easier method (KAPAHyperPETE) for target capture using primer extension reactions, which can improve ease of use, turnaround time, and variant allele specificity. This is achieved by modifying and improving existing target enrichment methods (e.g., those described in U.S. Patent Publication Nos. US2020 / 0032244A1 and US2020 / 0392483A1, both of which are incorporated herein by reference in their entirety), designing target enrichment primers to specifically enrich library fragments based on the relative position of variant bases in primers, utilizing polymerases with better priming specificity, designing variant bases in capture primers, designing variant bases in release primers, and / or designing variant-specific primers for both the positive and negative strands of target library fragments. Another method that can be used to further improve the specificity of variant allele capture is to further deplete the enriched reference allele from the primer extension reaction by using "toxic primers" (e.g., as described in International Patent Publication No. WO 2022 / 008578 A1, which is incorporated herein by reference in its entirety). These toxic primers will be designed to target the reference allele, but will not contain a biotin capture moiety. These will be extended and thereby prevent the reference allele fragment from being potentially misprimed by the biotinylated variant allele primer.

[0202] In certain embodiments, the present disclosure relates to a target capture method using a primer extension reaction (KAPAHyperPETE), which can be extended by extending certain enrichment methods disclosed herein (e.g., reference Figure 1 2) to improve variant allele specificity. Exemplary methods may include more than one cycle or round of target capture or target enrichment. For example, the method may include a dual capture workflow that repeats one or more of the following steps (a) to (g), which describes a workflow for unidirectional dual probe primer extension or enrichment of a target nucleic acid comprising at least one variant base (e.g., "variant allele"). Step (a): hybridize a first oligonucleotide (e.g., "capture primer") with a target nucleic acid in a nucleic acid library. In certain embodiments, the nucleic acids in the library each include a heterologous adapter connected to the terminal 5' and 3' ends. In certain embodiments, the capture primer may be "off-target" or "on-target" relative to the variant base. For example, an "off-target" capture primer may hybridize with a sequence in a target nucleic acid outside the variant base position, such as "upstream" or "downstream" of the variant base. In contrast, an "on-target" capture primer may hybridize with a sequence in a target nucleic acid comprising a variant base. In one embodiment, a target primer may be designed so that the last 3' base of the primer hybridizes with a variant base in a target nucleic acid. Step (b): Extending the hybridized first oligonucleotide with a first polymerase, thereby generating a first primer extension complex comprising a target nucleic acid and the extended first oligonucleotide. Step (c): Capturing the first primer extension product. Step (d): Enriching the first primer extension product relative to a nucleic acid library, for example, by one or more purification steps. Step (e): Hybridizing a second oligonucleotide (e.g., a "release primer") with a target nucleic acid. In certain embodiments, the capture primer can also be "off-target" or "on-target" relative to a variant base. Step (f): Extending the hybridized second oligonucleotide with a second polymerase, thereby generating a second primer extension complex comprising a target nucleic acid and the extended second oligonucleotide, thereby releasing the extended first oligonucleotide from the first primer extension complex. In certain embodiments, the extended first oligonucleotide includes a capture portion attached to a solid support, so that the release of the extended first oligonucleotide from the first primer extension product releases the second primer extension complex from the solid support and enters the solution. One or more purification techniques may be implemented after this step to recover the second primer extension product or complex comprising the target nucleic acid from other reaction components. Step (g): Amplify the target nucleic acid using a third polymerase and an amplification primer suitable for the application. In certain embodiments, the amplification primer is designed to hybridize with the adapters connected to the ends 5' and 3' ends of the target nucleic acid. Advantageously, this enables amplification of the entire target nucleic acid, which may include genome or circulating tumor DNA (ctDNA) in certain embodiments.

[0203] In an exemplary dual capture enrichment method, the single capture method described above with reference to steps (a) to (g) can be extended by repeating each of the ordered steps (a) to (g) for a second time, i.e., performing a second round of enrichment method. In some embodiments, the same capture and release primer pairs (e.g., the first oligonucleotide and the second oligonucleotide of steps (a) and (e)) can be used for the first round of enrichment and the second round of enrichment. In other embodiments, different capture and release primer pairs can be used in the first and subsequent rounds of enrichment. In certain embodiments, the amplification of the enriched target nucleic acid (e.g., the amplification of the target variation in step (g)) can include a different number of cycles in the first round of enrichment (i.e., the first PCR amplification) relative to subsequent enrichment rounds (e.g., the second PCR amplification). For example, the first PCR amplification step can include a greater number of PCR cycles than the second PCR amplification step.

[0204] In another exemplary dual capture method, the single capture enrichment method described above with reference to steps (a) to (g) can be expanded by first performing steps (a) to (d), and then introducing a new step in which the first primer extension complex is subjected to denaturing conditions such that the target nucleic acid is released from the complex into solution. For example, the target nucleic acid can be "melted away" by heat treatment of the first primer extension complex bound to the solid support. Subsequently, a sample of unbound, released target nucleic acid can be recovered and subjected to a second round of enrichment by performing the original steps (a) to (g).

[0205] In yet another exemplary dual capture enrichment method, the single capture method described above with reference to steps (a) to (g) can be extended by first performing steps (a) to (f) to produce a sample of unbound target nucleic acid released from the first primer extension complex bound to the solid support. Subsequently, the sample can be recovered and subjected to a second round of enrichment by performing sequential steps (a) to (g).

[0206] In order to design target enrichment primers to specifically enrich library fragments, any position in the capture primer sequence can be modified / targeted, including but not limited to the last 3' base, the second to last 3' base, the third to last 3' base base, etc. or any combination thereof. In order to design target enrichment primers to specifically enrich library fragments, any position in the release primer sequence can be modified / targeted, including but not limited to the last 3' base, the second to last 3' base, the third to last 3' base base, etc. or any combination thereof. Similarly, in order to design specific toxic primers, any position in the toxic primer sequence can be modified / targeted, including but not limited to the last 3' base, the second to last 3' base, the third to last 3' base base, etc. or any combination thereof. In addition, variant allele primers (e.g., capture primers or release primers or toxic primers) are designed for positive and negative chains and are used in combination to improve capture efficiency. In addition, primers can include modified bases in primers to increase the specificity of extension (LNA, methyl C, 7 deaza dGTP, etc.). Primers containing mismatches or unannealed bubbles (1 base away, 2 bases away, 3 bases away, 4 bases away, n bases away, etc.) to the variant allele base in the primer – The variant allele primer has only one mismatch to the variant allele target, while the reference target has 2 mismatches. That is, adding intentional mismatches elsewhere in the primers designed for the variant may make priming to the reference less likely, because there are now two mismatches: (i) the variant base, and (ii) the intentional mismatch. Thus, introducing random mismatches in the primers may make enrichment for the variant base / allele even more enhanced. In addition, a combination of a DNA polymerase with increased specificity and a variant allele-specific primer is used, and any number may be employed, such as KAPA 2G polymerase, Taq polymerase, ΔZ05 (a truncated form of Z05 lacking the 5' nuclease domain), AS-1 (= Z05D580G E493K, selected for high allele specificity), and KAPA Hifi exo (-), or any combination thereof.

[0207] Examples

[0208] Example 1: Primer extension target enrichment by primer-mediated capture in solution (PETE-Cap)

[0209] Primer extension target enrichment by in-solution primer-mediated capture was performed according to the following protocol. Duplicate libraries of nucleic acid were prepared from 10 ng and 100 ng of NA12878 human genomic DNA (CORIELL) using the KAPA HYPERPLUS Library Preparation Kit according to the manufacturer's instructions, up to and including a 0.8X post-ligation cleanup step ( Fig. 6A). Thereafter, according to the embodiment shown in Figure 2, the target nucleic acid in the nucleic acid library is enriched by primer extension target enrichment (including primer-mediated capture in solution). Primers complementary to the positive or negative strands of the target nucleic acid are designed for the same exon of each target gene (i.e., target). The length of the first (inner) oligonucleotide primer is 20 to 25 nucleotides, and the length of the second (outer) oligonucleotide primer is 50 to 60 nucleotides. The extra length associated with the second oligonucleotide primer (compared with the first oligonucleotide primer) is due to the inclusion of a 5' non-complementary tail sequence. It is worth noting that the 5' non-complementary tail sequence can be omitted to reduce the total length of the second oligonucleotide primer.

[0210] The first oligonucleotide (internal) primer hybridization and extension reactions were set up according to Table 2. The nucleic acid library consisted of unamplified products prepared with the KAPA HYPERPLUS library preparation kit as described above. After the 0.8X post-ligation cleanup step, the total volume of the nucleic acid library recovered after elution was included in the reaction; the final concentration of the nucleic acid library was not determined (nd). The mastermix consisted of a customized KAPA 2G polymerase PCR Mastermix. The primer mixture consisted of a set of 377 first oligonucleotide target-specific internal primers present in equimolar concentrations. It is noteworthy that each of the first oligonucleotide target-specific internal primers includes a 5' biotin capture portion.

[0211] Table 2:

[0212]

[0213] The first oligonucleotide primer is hybridized to the target nucleic acid in the nucleic acid library and extended with a polymerase for a total time of about 1 hour according to the thermal profile in Table 3. It is worth noting that the protocol in Table 3 omits the use of thermal cycling.

[0214] Table 3

[0215]

[0216] After hybridization and extension using the biotinylated first oligonucleotide primer, the sample was mixed with DYNABEADSMYONE Streptavidin T1 capture beads (THERMO FISHER SCIENTIFIC) at a 1:1 ratio. Before adding to the DNA sample, the capture beads were prepared by washing twice with 1X binding and washing buffer and resuspending in 2X binding and washing buffer. The composition of the binding and washing buffer is listed in Table 4.

[0217] Table 4

[0218]

[0219] The sample was incubated with 50 μL MYONE capture beads on an automatic sample rotator at room temperature for 10 minutes. Once the biotinylated DNA was bound to the beads, the sample was placed on a magnet for 3 minutes to capture the beads, and the supernatant was removed and discarded. The beads were washed twice, once with 1X binding and washing buffer as described in Table 3, and once with 10 mM Tris-HCl (pH 8.0) to remove non-biotinylated DNA. The beads were then resuspended in 20 μL 10 mM Tris-Cl (pH 8.0).

[0220] According to Table 5, add the resuspended beads to the second oligonucleotide (outer) primer hybridization reaction mixture.

[0221] Table 5

[0222]

[0223] The reaction mixture listed in Table 5 was incubated at 55° C. for 165 minutes to allow the second oligonucleotide primer to hybridize with the target nucleic acid in the nucleic acid library, thereby allowing for increased specificity of target capture.

[0224] The samples were then washed and eluted as before (ie, washed once with 1x Binding and Wash Buffer and once with 10 mM Tris-HCl, then resuspended in 20 μL 10 mM Tris-HCl).

[0225] The resuspended beads were added to a second extension reaction, thereby causing extension of the second oligonucleotide primer and releasing the target nucleic acid molecule into solution. The composition of the second extension reaction is listed in Table 6.

[0226] Table 6

[0227]

[0228] After the second extension reaction, the samples were incubated at 50°C for 2 minutes and then placed directly on a magnet on ice for 1 minute. The supernatant was removed from the sample (without disturbing the beads) and added to an equal volume of KAPA PURE BEADS capture beads (KAPABIOSYSTEMS). A 1X cleanup was performed and the samples were eluted with 15 μL 10 mM Tris-Cl (pH 8.0).

[0229] The next step in the target enrichment protocol was an amplification reaction and KAPA PURE BEAD capture beads (KAPA BIOSYSTEMS) cleanup according to the manufacturer's instructions for the KAPA HYPERPLUS Library Preparation Kit. The final product was eluted in 25 μL Tris-HCl. The enriched target nucleic acid was then amplified and purified using the KAPA HYPERPLUS Library Preparation Kit (KAPABIOSYSTEMS) according to the manufacturer's instructions. Figure 6B The enriched, amplified libraries were sequenced on a MINISEQ DNA sequencer (ILLUMINA) using a mid-output kit with 2 x 150 bp reads, 1.6 pM loading concentration, and 1% PhiX DNA. The resulting sequencing data were processed using a pipeline developed for analyzing SEQCAP EZ Target Enrichment System (ROCHE) data to assess the extent of target enrichment ( Figure 7 ).

[0230] Example 2: Primer Extension Target Enrichment (PETE) Using Capture Oligonucleotides

[0231] In this example, a universal capture sequence was added to the 5' end of the target-specific primer in the 88kb capture primer panel. The nucleotide sequences of the target-specific primer (SEQ ID NO: 1) and the universal capture oligonucleotide (SEQ ID NO: 2) with a universal tail are shown in Table 7. In addition, the following modified universal capture oligonucleotides were designed: universal capture oligonucleotide, 3'-biotin; universal capture oligonucleotide, 3'-biotin-TEG (biotin-TEG is a modified biotin containing a tetraethylene glycol spacer arm, such as available from Integrated DNA Technologies (Coralville, Iowa)); universal capture oligonucleotide, 3'-biotin, phosphorothioate; and universal capture oligonucleotide, 3'-biotin, 5-methyl-dC (iMedC).

[0232] Table 7

[0233]

[0234] Primer extension was performed as described in Example 1, except that samples were contacted with 15, 45, or 150 pmoles of capture oligonucleotide prior to the addition of DYNABEADS MYONE Streptavidin T1 capture beads (THERMO FISHER SCIENTIFIC). Fig.1015, 45 and 150 on the DNA polymerase). A second primer was added and the captured nucleic acid was further processed as described in Example 1, including amplification and sequencing of the captured library on an Illumina MiniSeq sequencer. The extended first primer was released during the extension of the second primer, presumably due to the flap endonuclease activity of the DNA polymerase. Reference Fig.10 , sequencing data were evaluated to determine n-target rate (percentage of reads on target), uniformity (percentage of bases within a 2-fold range), and deduplication depth of coverage (deduplication_depth).

[0235] Mention Fig.10 All the figures in are technical replications of various experimental conditions. "Combination _15", "combination _45" and "combination _150" are experimental conditions that add 15, 45 or 150 pmoles of 3' biotinylated universal capture oligonucleotides during hybridization of the internal primer (capture primer, taking SEQ ID NO:1 as an example) as described in Example 1. In the "control" reaction, the biotinylated capture primer as described in Example 1 and the absence of universal capture oligonucleotides are used. The "prehybridization" experimental conditions are all completed using the following scheme: wherein first an excessive amount of universal biotinylated oligonucleotides is combined with streptavidin beads, unbound oligonucleotides are washed off, and then after hybridization and extension reactions using universal tailing capture primers, the product of hybridization and extension is captured using beads combined with universal oligonucleotides. The "prehyb" part of the experiment is used to prove that universal capture oligonucleotides can be directly used for capture primer extension reactions together with the control and "combination" workflows, and can also be used alone to functionalize the streptavidin beads (similar to the poly-T beads used in mRNA enrichment) that capture the extended capture primer product upstream.

[0236] Example 3: Specific variant allele enrichment using variant primers in the primer extension target enrichment (PETE) workflow

[0237] Using samples with single nucleotide polymorphisms (SNPs) and subsequent target enrichment protocols described herein, it was found that placing primers on variants resulted in an increase in allele frequency ("AF") (data not shown). To further examine this effect, allele frequencies were determined under the following conditions: (a) where the capture primer landed on the variant; (b) where the release primer landed on the variant; and (c) where the variant was between the capture and release primer pairs or beyond the capture release pair. The results are shown in Table 1. Fig.11 As shown, the figure shows that the relative enrichment of the variant target is higher under the condition where the capture primer lands on the variant (called "capture", peach) compared to other conditions, namely, where the release primer lands on the variant (called "release", green) or where the variant is between the capture and release primer pair or beyond the capture-release pair (called "none", blue) (see Fig.11 ).therefore, Fig.11 It was demonstrated that when capture primers were designed at variant positions, no matter which allele the capture target was designed to be, that allele would be enriched relative to the other alleles. Fig.11 It also tends to suggest that designing the target enrichment capture primers so that the variant base is located in the capture primer (i.e., the capture primer lands on the variant) results in improved enrichment of that variant target. To further examine the effect of the position of the variant base within the capture primer or release primer sequence on the relative ability to enrich for the variant target, variants were introduced into the 5' end, middle, or 3' end of the capture primer and the middle of the release primer. The results of this study are shown in Figure 2. Fig.12 shown. Fig.12 It is shown that relative targeted allele enrichment is greater when the variant base is located at the 3' end (called "3'", in blue) and in the middle (called "MID", in green) than when the variant base is located at the 5' end (called "5'", in peach). Fig.12 It was also shown that any variant base introduced in the capture primer (regardless of the position of the variant base) produced a greater relative targeted allele frequency compared to a variant base introduced in the middle of the release primer. These studies suggest that capture primers with variant bases may be more capable of enriching specific variant targets than release primers with variant bases. These studies also suggest that variant bases should be introduced in the middle and / or 3' end of the capture primer to improve the enrichment efficiency of the targeted variant. Fig.13 Exemplary mappings of reference primers against reference targets having positions in the reference sequence where a cytosine (C) is present and where a common variant has a thymine (T) at that same position are shown, with varying degrees of overlap. In particular, Fig.13 Shown are primers with no overlap (called "No Overlap", SEQ ID NO:3, 5'ACCAGAGTAAATGCTCACTTTTCAATC), primers that overlap at the last 3' position (called "Ult", SEQ ID NO:4, 5'CCAGAGTAAATGCTCACTTTTCAATCC), primers that overlap at the second to last 3' position (called "Penult", SEQ ID NO:5, 5'AGAGTAAATGCTCACTTTTCAATCCC), and primers that overlap at the third to last 3' position (called "Antepenult", SEQ ID NO:6, 5'AGTAAATGCTCACTTTTCAATCCCC).

[0238] Taken together, these studies demonstrate the ability to improve variant allele enrichment efficiency by designing target enrichment primers to specifically enrich library fragments based on the relative position of the variant base in the primers. Example 4: Specific variant allele enrichment using variant primers in a dual capture primer extension target enrichment (PETE) workflow

[0239] In order to improve the on-target rate of variant allele enrichment, a PETE workflow (i.e., a "double capture" workflow) that introduces repeated capture on the enriched library was studied. The library was prepared using the Twist cfDNA pan-cancer reference standard at 0.1% variant allele frequency (VAF) or 0% VAF (available from Twist Biosciences, San Francisco, CA). The reference standard consists of a synthetically designed variant sequence that simulates circulating tumor DNA (ctDNA) and is combined with background DNA derived from human cell-free DNA (cfDNA). The ctDNA sequence is designed as a tiled pool of approximately 167bp sequences that closely mimics natural ctDNA and covers 458 individual mutations with 132 clinically actionable mutations in 84 genes associated with cancer. Three replicates of each of Twist reference standards 0% and 0.1% were prepared as libraries in triplicate using 50 ng input, KAPA HyperPrep Library Prep Kit, KAPA Universal UMI Adapters, and KAPAUDI Primer Mix (available from Roche Sequencing). After overnight ligation and solid phase reversible immobilization (SPRI) bead cleanup, libraries of the same input sample were pooled and aliquoted again.

[0240] For target enrichment, capture primers were designed to 24 single nucleotide variants (SNVs) on both the positive (i.e., "sense") and negative (i.e., "antisense") strands, of which 21 of the 24 SNVs were present in the Twist Pan-Cancer Reference Standard 0.1% VAF. Capture primers were designed to hybridize upstream of the variant position ("outside the variant") or to the last 3' base of the primer that landed on the variant position ("on the variant"). Release primers were designed to hybridize upstream of the capture primer outside the variant. Primer lengths ranged from 18 to 30 nucleotides. Fig.15 Exemplary mapping of reference capture (blue) primers (variant out and variant on) and release (orange) primers against both the positive and negative strands of the reference target variant alleles is shown. The capture and release primers are listed in Table 8.

[0241] Table 8

[0242]

[0243]

[0244] In general, the PETE target enrichment protocol was performed as described herein and according to Chapter 4 of the KAPA HyperPETE Somatic Plasma cfDNA Workflow (v1.0) Instructions for Use (available from Roche Sequencing) using the KAPA HyperPETE kit with 15 μL of library sample as input and 19 PCR cycles.

[0245] For this experiment, three replicates of the Twist 0.1% VAF reference standard were prepared as libraries as described above and captured twice using variant upper capture primers. Samples subjected to dual capture were eluted in 15 μL at the end of the first capture and then subjected to a second capture via the PETE workflow. After the first capture, 19 PCR amplification cycles were performed, and after the second capture, 8 PCR amplification cycles were performed.

[0246] The enriched library NextSeq TM Sequencing was performed on a 500 system and analyzed using an in-house analysis pipeline at 5M, 4M, 2M, and 1M subsampled reads. Two replicates of the capture primer enriched sample on the Twist 0% VAF variant had 2.04M and 4.7M reads. All reads for both samples were used at a subsampling level above the maximum reads available. Observed allele frequencies (AF) were determined using non-deduplicated reads. On-target rate determinations are shown in Fig.16 It was observed that the on-target percentage or on-target rate (OTR) of samples captured once using variant-outside capture primers (median 64.1%, orange bars) was higher than that of samples captured once using variant-on capture primers, which is consistent with the fact that the allelic variation specificity of variant-on capture primers resulted in a significant reduction in the number of target sequences in low VAF samples and a correspondingly lower OTR. OTR was not affected by the low VAF in enrichment with variant-outside capture primers because the variant-outside capture primers were upstream of the variant position. However, samples captured twice using variant-on capture primers exhibited significantly improved OTR (median 54.2%, green bars) compared to samples captured once using variant-on capture primers (median 7.9%, blue bars).

[0247] The observed allele frequencies (AF) of the three samples are presented in Fig.17It was observed that the AF of samples captured once using variant capture (blue bars) was much higher than the AF of samples captured once using variant capture primers (orange bars), which resulted in AFs similar to the expected VAF of the samples (median 0.0881%). Notably, samples captured twice using variant capture primers exhibited higher AF (median 63.8%, green bars) compared to samples captured once using variant capture primers (median 3.71%, blue bars).

[0248] Altogether, these results suggest that dual capture using variant-specific capture primers improves OTR and observed AF and may therefore reduce the necessary sequencing depth required to identify low AF variants.

[0249] Example 5: Heterozygous SNP variant enrichment

[0250] The goal of this experiment was to design and test variant-specific primers that overlap the variant at different positions within the primer for variant enrichment.

[0251] Variant enrichment capture primers were designed to overlap 10 heterozygous SNPs present in genomic DNA derived from the NA12878 cell line (human B-cell lymphocytes) (see Table 9).

[0252] Table 9:

[0253]

[0254]

[0255] Fig.18 The primer placement scheme for an exemplary SNP target is depicted in . The capture primer is designed to have the third 5' (5', e.g., SEQ ID NO: 28), the middle third (Mid, e.g., SEQ ID NO: 27), the third to last 3' base (the third to last, e.g., SEQ ID NO: 25), the second to last 3' base (the second to last, e.g., SEQ ID NO: 24), or the last 3' base (the last, e.g., SEQ ID NO: 23) of the primer that falls on the variant base in the target. The capture primer is also designed to be located just upstream of the SNP ("outside", e.g., SEQ ID NO: 22). One set of variant overlapping capture primers is designed to be complementary to the variant allele (variant). Another set of variant overlapping capture primers is designed to be complementary to the reference allele (WT). Another set of variant overlapping capture primers designed to be complementary to the reference allele does not include a 5' biotin portion for use in reference allele depletion (i.e., "toxic primers").

[0256] Two release primers were designed, wherein a release primer (3'Rel, e.g., SEQ ID NO: 21) for both variant and WT capture primer sets was designed to be located upstream of the "outer" capture primer, so that the outer, third to last, second to last and last capture primers could be released. Another release primer (5'Rel, e.g., SEQ ID NO: 26) for both variant and WT capture primer sets was designed to be located upstream of the 5' capture primer, so that the 5' and Mid capture primers could be released. Capture and release primer sets were designed to be both the positive (+) strand (e.g., SEQ ID NO: 21-28) and negative (-) strand (e.g., SEQ ID NO: 29-36) of the genomic DNA target. The 5' to 3' nucleic acid sequences of primers are listed in Table 10.

[0257] Table 10

[0258]

[0259]

[0260] Primers were designed for the reference sequence using the "Primer 3" software program with Tm ranges of 57.2°C to 66.5°C, GC content of 0 to 100%, and lengths of 18 to 30 bases. Variant-specific primers were created by modifying the relevant bases of the reference allele to complement the variant allele. The entire primer array used for this analysis is listed in Table 11. (In the experiments described in this example, the positive strand primer pool was tested).

[0261] Table 11

[0262]

[0263]

[0264]

[0265] Genomic DNA (gDNA) from the NA12878 cell line was prepared into 48 libraries for 10 ng of non-formalin damaged gDNA following the Instructions for Use (IFU) KAPA HyperPETE Somatic Tissue DNA Workflow v1.0 Chapter 4. A step of pooling the eluate and aliquots into 20uL tubes was added after step 5 (0.8X purification after ligation using KAPA HyperPure beads) prior to amplification to minimize the variability of the input library prior to target enrichment, allowing accurate comparison of the designed variant enrichment panels.

[0266] For each of the mutations listed in Table 9, according to the IFU Chapter 5 cited above, target enrichment was performed using 10uL input library, KAPA HyperPETE HotSpot capture panel (used as internal process control, data not shown) and spike-in mutation capture panel. Five overlapping mutation capture primer positions (which have WT allele complementarity, variant allele complementarity or variant allele complementarity with the WT toxic primer of the same overlapping position) produce 15 different spike-in mutation enrichment panel conditions. When including an outer capture primer set, there are 16 different spike-in group conditions in total. Each individual target enrichment program is performed in triplicate, and each of the panel is tested in three individual target enrichment groups. Group 1 includes Mid+ mutation and 5'+ mutation, with and without corresponding toxic primers. Group 2 is the third to last + mutation and the second to last + mutation, with and without corresponding toxic primers. Group 3 is the last + mutation and mutation outside, with and without corresponding toxic primers. The design of this experiment is shown in Table 12 (where "b" indicates biotin bonding).

[0267] Table 12

[0268]

[0269] The concentration of variant enriched capture primers was the same as that of the HyperPETE capture panel, and the concentration of the toxic primer panel was 10 times that of the HyperPETE capture panel. Release hybridization was performed using the KAPA HyperPETE Hotspot panel release primers and 5'+ variant enriched release pools (for Mid+ and 5'+ capture primers, variants or WT, and with or without corresponding toxic primers) or 3'+ variant enriched release pools (for the third last +, second last + or last +, variants or WT, and with or without corresponding toxic primers). The release panel was used at the same concentration as that of the HyperPETE release panel. Seventeen cycles were used for amplification.

[0270] For next generation sequencing, enriched libraries were pooled and sequenced on an Illumina Nextseq 500 system. Sequencing data were analyzed in-house and subsampled to 15M total reads. Observed variant allele frequencies were determined from barcode-deduplicated SNV frequency files by dividing the variant allele depth by the total depth. Enrichment folds were calculated by dividing the observed variant allele frequency by the expected variant allele frequency of 50%. The results of this experiment are presented in Fig.19 and Fig. 20 middle.

[0271] like Fig.19As shown, when the "variant out" capture primer ("variant out", pink) is used, the observed variant allele frequency (AF) percentage is close to 50%, as expected. In contrast, when the variant capture primers ("Var", green, and "Var + toxicity", turquoise and indicated by vertical arrows) are used, the observed variant AF is higher than the expected value of 50%. The "last 3' variant" capture primer generates the highest observed variant AF, which decreases as the position of the variant base overlaps toward the 5' end of the variant capture primer. When the toxic primer is included in the target enrichment ("Var + toxicity", turquoise and indicated by vertical arrows), these values ​​are observed to be higher and less variable. When the WT capture primer ("WT", purple) is used, the observed variant AF is less than the expected value of 50%. The lowest variant AF is observed when the "last 3'WT" capture primer is used, and the variant AF increases as the position of the variant base overlaps toward the 5' end of the WT capture primer.

[0272] Variant enrichment results expressed as correlation between enrichment fold and total coverage are shown in Fig. 20 As shown (variant data points are in red and indicated by a single vertical arrow, and variant+toxicity data points are in blue and indicated by a double vertical arrow). It can be seen that low enrichment folds tend to be accompanied by high total coverage of the enriched variants.

[0273] In summary, the results of this experiment show that SNP variants can be significantly enriched when the PETE workflow includes variant-specific capture primers. The highest variant AF was observed when the last 3' base of the capture primer hybridized to the variant base in the target sequence. In addition, it was observed that including toxic primers in the enrichment process optimized variant enrichment. Finally, an inverse relationship between variant allele frequency and total coverage was noted.

[0274] Example 6: Variant Enrichment Optimization - Strand Testing and Toxicity Primer Titration on Low AF Cell Line Mix

[0275] The goal of this experiment was to use different amounts of toxic primers and to optimize variant enrichment performance by using primers that hybridize to the negative strand of the target template alone or in combination with primers that hybridize to the positive strand of the target template.

[0276] Genomic DNA isolated from human B lymphocyte cell lines NA24143 and NA12878 was mixed and 8 SNP variants not shared between the two cell lines (variants of Example 5) were used to assess low AF variant enrichment by using the panel described in Example 5. NA12878 and NA24143 cell line DNA were diluted to the same concentration and NA12878 DNA was mixed with NA24143 DNA at ratios of 1:50, 1:100, and 1:1000 to obtain 1%, 0.5%, and 0.1% of the expected variant AF, respectively.

[0277] For 10 ng of non-formalin damaged gDNA, shotgun libraries were prepared from 1%, 0.5%, and 0.1% variant AF cell line DNA mixtures, with 12 replicates for each mixture, for a total of 36 libraries, following the IFU KAPA HyperPETE Somatic Tissue DNA Workflow v1.0 Chapter 4. A step was added after step 5 (0.8X purification after ligation using KAPA HyperPure beads) to pool the eluate and aliquots into 20uL tubes before amplification in order to minimize the variability of the input library going into target enrichment, allowing for accurate comparison of the designed variant enrichment panels.

[0278] The prepared libraries were used as input to the target enrichment procedure of the HyperPETE workflow following the IFU KAPA HyperPETE Somatic Tissue DNA Workflow v1.0 Chapter 5. In order to leave the volume required for the combination of capture primer pools, only 5uL of input library was used for each target enrichment reaction. Each target enrichment reaction still provided greater than the minimum required 500ng input recommended by IFU. Two sets of target enrichment were performed, as summarized in Table 13. The variant enrichment panel was used alone with the same primer concentration as the HyperPETE capture panel.

[0279] Table 13

[0280]

[0281] The first set of target enrichment was performed using only the positive strand, only the negative strand, or both the positive strand and the negative strand of the last 3' variant primer with or without a toxic primer (corresponding to only the positive strand, only the negative strand, or both the positive strand and the negative strand of the last 3' toxic primer). The concentration of the toxic primer was 10 times that of the normal capture panel. The target sample was a 0.5% cell line mixture input library. A total of 12 samples were enriched in duplicate. Release hybridization was also performed using only the positive strand, only the negative strand, or both the positive strand and the negative strand of the 3' release primer. The samples were amplified using 23 PCR cycles.

[0282] The second set of target enrichment was performed on 1% and 0.1% cell line mixture input libraries using the positive and negative strands of the last 3' variant primer and the positive and negative strands of the corresponding toxic primers at 1X, 5X, 10X and 20X the normal HyperPETE capture primer concentration, with 3 replicates per library, for a total of 24 samples. Release hybridization was performed using the positive and negative strands of the 3' release primers. Samples were amplified using 23 PCR cycles.

[0283] The enriched libraries were pooled and sequenced on an Illumina Nextseq 500 system. Sequencing data were analyzed in-house and subsampled to 3M total reads. The observed variant allele frequency was determined from the non-deduplicated SNV frequency file by dividing the variant allele depth by the total depth. The enrichment fold was calculated by dividing the observed variant allele frequency by the expected variant allele frequency of 0.5%. The recovery percentage was determined from the barcode deduplicated SNV frequency file and calculated based on the input amount and expected variant AF by dividing the observed variant allele coverage by the expected variant allele copy number. The results of this experiment are presented in Figure 21 to Figure 23 middle.

[0284] like Fig.21 As shown, the median recovery percentage of samples captured using both the positive and negative strands ("positive and negative") of the last variant capture primer was higher than that of samples captured using either the positive or negative strand primer alone. In this experiment, the addition of toxic primers did not increase recovery to a significant level.

[0285] like Fig. 22 As shown, the median enrichment factor increases with increasing concentrations of toxic primers added to the capture extension. The theoretical maximum enrichment factor for the 0.1% AF sample (1000X) (where the variant AF is 100%) is much higher compared to the 1% AF sample (100%) due to the fact that the variant AF is expected to be lower. Therefore, the enrichment factor observed for the 0.1% AF sample is also higher compared to the 1% AF sample.

[0286] like Fig.23 As shown, there was no significant change in the average recovery percentage between different amounts of toxic primers in the capture extension reaction.

[0287] In summary, these data indicate that the use of positive and negative strand variant capture and corresponding release primers provides the highest percentage of variant allele copy recovery. Increasing the concentration of toxic primers greatly increased variant enrichment, but did not increase the percentage of variant allele copy recovery. The high enrichment factor may be due to more complete depletion of the WT allele. The use of toxic primers may be more beneficial when more variants are detected and the unwanted capture of WT allele fragments may lead to reduced capture or sequencing of other variant targets.

[0288] Example 7: Variant enrichment optimization - connection time test and PETE input test

[0289] The goal of this experiment was to optimize variant enrichment performance by increasing ligation time and input percentage for target enrichment.

[0290] For 10 ng of non-formalin-damaged gDNA, a mixture of cell line-derived genomic DNA with 0.1% AF and NA24143 cell line-derived genomic DNA alone (as 0% variant AF) was prepared as a shotgun library according to the IFU KAPA HyperPETE Somatic Tissue DNA Workflow v1.0 Chapter 4. For ligation, the library was incubated at 20°C for 15 minutes as described in the IFU, or at 16°C overnight (16 to 18 hours). Twelve replicate libraries were prepared for each AF level and ligation time, for a total of 48 libraries. An additional step of pooling the eluate and aliquots into 20uL tubes was added after step 5 (0.8X purification after ligation using KAPA HyperPure beads) and then amplified to minimize the variability of the input library entering the target enrichment, thereby accurately comparing the designed variant enrichment panel. The final library was eluted in 20uL, rather than 25uL as shown in the IFU, to enable higher input for target enrichment.

[0291] 40% (8uL) or 75% (15uL) of the prepared library was used as input to the target enrichment procedure of the HyperPETE workflow as per the IFU KAPA HyperPETE Somatic Tissue DNA Workflow v1.0 Chapter 5. The positive and negative strands were used alone for the last variant or variant out-enrichment panels at the same primer concentration as the HyperPETE capture panel. Release hybridization was performed for the positive and negative strands using 3' release primers. Samples were amplified using 23 PCR cycles.

[0292] The enriched libraries were pooled and sequenced on an Illumina Nextseq 500 system. Sequencing data were analyzed in-house and subsampled to 3M total reads. Percent recovery was determined from the barcode-deduplicated SNV frequency file and calculated based on the input amount and expected variant AF by dividing the observed variant allele coverage by the expected variant allele copy number. The experimental setup is listed in Table 14.

[0293] Table 14

[0294]

[0295]

[0296] like Fig.24 As shown, overnight ligation at 75% input exhibited the best percentage recovery of variant allele copies, followed by 15 min ligation at 75% input.

[0297] Together, these data indicate that overnight ligation at 75% input yields a higher percentage of recovery of variant allele copies.

[0298] Example 8: Enrichment of low AF variants using reference samples

[0299] The goal of this experiment was to demonstrate variant detection performance using variant enrichment in a reference sample with known variants AF.

[0300] In the same manner as described in Example 5, Seracare Seraseq TM The 24 SNV designed variant enrichment panels in the ctDNA mutation mixture v2 product are shown in Table 15. Of the 24 variant targets, 21 are present in the TwistcfDNA Pan-Cancer Reference Standard VAF 0.1%.

[0301] Table 15

[0302]

[0303]

[0304] For 50ng cfDNA, Seracare Seraseq TM ctDNA Mutation Cocktail v2 AF 0.5%, SeracareSeraseq TMctDNA Mutation Mix v2 WT (0%), Twist cfDNA Pan-Cancer Reference Standard VAF 0.1%, and Twist cfDNA Pan-Cancer Reference Standard VAF 0% (WT) samples were prepared as shotgun libraries according to the IFU KAPA HyperPETE Somatic Plasma cfDNA Workflow v1.0 Chapter 3. The libraries were incubated at 16°C overnight (16 to 18 hours) for ligation. Six replicate libraries were prepared for each sample, totaling 24 libraries, and each set of replicates was prepared separately. An additional step of pooling the eluate and aliquots into 20uL tubes was added after step 5 of Chapter 4 (0.8X purification after ligation using KAPA HyperPure beads) and then amplification to minimize the variability of the input library into the target enrichment to accurately compare the designed variant enrichment panels. The final library was eluted in 20uL instead of 25uL as shown in the IFU to enable higher input for target enrichment.

[0305] 15uL of the prepared library was used as input to the target enrichment procedure of the HyperPETE workflow as per the IFU KAPA HyperPETE Somatic Plasma cfDNA Workflow v1.0 Chapter 4. The positive and negative strands last variant or variant out-enrichment panels were used separately at the same primer concentrations as the HyperPETE capture panel, with 3 replicates per input sample as shown in Table 16. Release hybridization was performed for both positive and negative strands using 3' release primers. Samples were amplified using 19 PCR cycles.

[0306] Table 16

[0307]

[0308] The enriched libraries were pooled and sequenced on an Illumina Nextseq 500 sequencing system. Sequencing data were analyzed on an internal pipeline and subsampled to 5M total reads and downsampled to 4M, 3M, 2M, and 1M total reads. Two replicates of the last capture primer enriched sample of Twist 0% VAF had 2.04M and 4.7M reads. All reads for both samples were used for subsampling levels above the maximum reads available. Observed allele frequencies (AFs) were determined using non-de-duplicated reads. UMI de-duplicated reads were used for variant calling, and the cutoff was set to UMI family number >15 for C to T changes, UMI family number >8 for G to T changes, and UMI family size >7 for all other base changes. False positives were determined from 0% VAF samples.

[0309] like Fig.25As shown, the AF percentage observed for samples captured with the variant upper (last) capture primer is much higher than the AF percentage for samples captured with the variant outer capture primer, indicating that the variant AF percentage is similar to the expected VAF for samples indicated by the horizontal line. Seraseq TM The median enrichment fold (AF observed on variant / AF observed outside variant) for the 0.5% VAF samples was 38.1X, and the median enrichment fold for the Twist 0.1% VAF samples was 42.2X.

[0310] like Fig.26 As shown, the variant-out capture primer enriched samples (indicated by the single vertical arrow) did not achieve 100% variant calling performance, even at 2.5X the sequencing reads required to achieve 100% calling of the variant-on capture primer enriched samples. A 0.5% VAF obtained 100% variant calls by on-variant capture primer enrichment (indicated by the double vertical arrows), but only 75% variant calls were obtained by off-variant capture primer enrichment, with no false positives called.

[0311] Importantly, these data demonstrate that variants with AF values ​​as low as 0.1% can be enriched with variant-specific primers using the KAPA HyperPETE workflow. Low AF variants can be identified with less required sequencing when using a “last” capture primer compared to variant-outside capture primers.

[0312] The features, structures or characteristics of the present invention may be combined in any suitable manner in one or more embodiments. In the following description, many specific details are listed to provide a thorough understanding of the embodiments of the system. However, those skilled in the relevant art will recognize that the system and method can be practiced without one or more of the specific details or using other methods, components, materials, etc. In other cases, well-known structures, materials or operations are not shown or described in detail to avoid covering up various aspects of the present invention. Therefore, the foregoing description is intended to be exemplary and does not limit the scope of the inventive concept.

Claims

1. A method for enriching at least one target nucleic acid in a nucleic acid library, wherein the at least one target nucleic acid comprises at least one variant base, the method comprising: (a) hybridizing a first oligonucleotide to a target nucleic acid in a nucleic acid library, each of the nucleic acids in the nucleic acid library having a first end comprising a first adaptor and a second end comprising a second adaptor, wherein the first oligonucleotide is complementary to the target nucleic acid at the at least one variant base; (b) extending the hybridized first oligonucleotide with a first polymerase, thereby generating a first primer extension complex comprising the target nucleic acid and the extended first oligonucleotide; (c) capturing the first primer extension complex; (d) enriching the first primer extension complex relative to the nucleic acid library; (e) hybridizing a second oligonucleotide to the target nucleic acid; (f) extending the hybridized second oligonucleotide with a second polymerase, thereby generating a second primer extension complex comprising the target nucleic acid and the extended second oligonucleotide, thereby releasing the extended first oligonucleotide from the first primer extension complex; as well as (g) amplifying the target nucleic acid using a third polymerase, a first amplification primer and a second amplification primer, wherein the first amplification primer has a 3' end complementary to the first adaptor, and the second amplification primer has a 3' end complementary to the second adaptor. 2 . The method according to claim 1 , wherein the position of complementarity between the first oligonucleotide and the variant base of the target nucleotide is the last 3′ base of the first oligonucleotide. 3 . The method of claim 1 , wherein the position of complementarity between the first oligonucleotide and the variant base of the target nucleotide is the second to last 3′ base of the first oligonucleotide. 4 . The method of claim 1 , wherein the position of complementarity between the first oligonucleotide and the variant base of the target nucleotide is the third to last 3′ base of the first oligonucleotide.

5. The method according to any one of claims 1 to 3, wherein the frequency of the at least one variant base in the nucleic acid library is less than 1%.

6. The method according to any one of claims 1 to 3, wherein the frequency of the at least one variant base in the nucleic acid library is less than 0.1%.

7. The method according to any one of claims 1 to 3, wherein the frequency of the at least one variant base in the nucleic acid library is less than 0.01%.

8. The method according to any one of claims 1 to 3, wherein the frequency of the at least one variant base in the nucleic acid library is less than 0.001%.

9. The method according to any one of claims 1 to 8, further comprising in step (a) an additional oligonucleotide, wherein the additional oligonucleotide hybridizes to the strand opposite to the strand hybridized by the first oligonucleotide.

10. The method of claim 9, wherein the additional oligonucleotide is complementary to the target nucleic acid at the at least one variant base.

11. The method according to any one of claims 1 to 10, wherein one or more additional mismatches or unannealed bubbles are generated in the first oligonucleotide.

12. The method according to any one of claims 1 to 11, wherein the first oligonucleotide comprises one or more modified bases.

13. The method of claim 11, wherein the one or more modified bases comprise locked nucleic acid (LNA), methyl C or 7 deaza dGTP, or any combination thereof.

14. The method according to any one of claims 1 to 13, wherein the first, second and / or third DNA polymerase is KAPA 2G polymerase, ΔZ05 polymerase, AS-1 polymerase or KAPA HiFi Exo(-) polymerase, or any combination thereof.

15. The method according to any one of claims 1 to 14, wherein the second oligonucleotide is complementary to the target nucleic acid at the at least one variant base. 16 . The method of claim 15 , wherein the position of complementarity between the first oligonucleotide and the variant base of the target nucleotide is the last 3′ base of the second oligonucleotide.

17. The method of claim 15, wherein the position of complementarity between the first oligonucleotide and the variant base of the target nucleotide is the penultimate 3' base of the second oligonucleotide.

18. The method of claim 15, wherein the position of complementarity between the first oligonucleotide and the variant base of the target nucleotide is the third to last 3' base of the second oligonucleotide.

19. The method according to any one of claims 1 to 18, wherein the second oligonucleotide comprises one or more modified bases.

20. The method of claim 19, wherein the one or more modified bases comprise locked nucleic acid (LNA), methyl C, or 7 deaza dGTP, or any combination thereof.

21. The method of any one of claims 1 to 20, wherein one or more additional mismatches or unannealed bubbles are generated in the second oligonucleotide.

22. The method according to any one of claims 1 to 21, further comprising hybridizing nucleic acids other than the target nucleic acid in the nucleic acid library with toxic primers.

23. The method of claim 22, wherein the toxic primer depletes the nucleic acids in the nucleic acid library that are not the target nucleic acid.

24. The method according to any one of claims 1 to 23, further comprising sequencing the amplified target nucleic acid.

25. The method of any one of claims 1 to 24, wherein the first oligonucleotide comprises a capture moiety.

26. The method of any one of claims 1 to 25, wherein the first oligonucleotide is bound to a solid support prior to hybridizing the first oligonucleotide to a target nucleic acid, and wherein the first oligonucleotide is hybridized to the target nucleic acid and the hybridized first oligonucleotide is extended with a polymerase, thereby capturing the first primer extension complex on the solid support.

27. The method of any one of claims 1 to 26, further comprising incorporating at least one uracil into at least one of: The extended first oligonucleotide in the first primer extension complex and the extended second oligonucleotide in the second primer extension complex, thereby forming a uracil-containing oligonucleotide product.

28. The method of any one of claims 1 to 27, further comprising contacting the nucleic acid library with a blocking oligonucleotide.

29. The method of any one of claims 1 to 28, wherein the first adaptor and the second adaptor are forked adaptors.

30. The method of any one of claims 1 to 29, wherein the first adaptor and the second adaptor comprise at least one uracil.

31. The method of any one of claims 1 to 30, wherein the second oligonucleotide hybridizes to the target nucleic acid at a position 5' relative to the first oligonucleotide.

32. The method of any one of claims 1 to 31, wherein at least one of the first adaptor, the second adaptor, the first amplification primer, and the second amplification primer comprises at least one of a unique identifier (UID), a molecular identifier (MID) sequence.

33. A kit for enriching at least one target nucleic acid in a nucleic acid library, wherein the at least one target nucleic acid comprises at least one variant base, the kit comprising: (a) a first oligonucleotide complementary to a target nucleic acid in a nucleic acid library, each of the nucleic acids in the nucleic acid library having a first end comprising a first adaptor and a second end comprising a second adaptor, wherein the first oligonucleotide is complementary to the target nucleic acid at the at least one variant base; (b) a second oligonucleotide complementary to the target nucleic acid; (c) a first amplification primer; and (d) a second amplification primer, wherein the first oligonucleotide comprises a capture portion, wherein the second oligonucleotide hybridizes to the target nucleic acid at a position 5' relative to the first oligonucleotide, and wherein the first amplification primer has a 3' end that is complementary to the first adaptor, and wherein the second amplification primer has a 3' end that is complementary to the second adaptor.

34. The kit of claim 33, wherein the second oligonucleotide is complementary to the target nucleic acid at the at least one variant base.

35. A kit for enriching at least one target nucleic acid in a nucleic acid library, wherein the at least one target nucleic acid comprises at least one variant base, the kit comprising: (a) a first oligonucleotide complementary to a target nucleic acid in a nucleic acid library, each of the nucleic acids in the nucleic acid library having a first end comprising a first adaptor and a second end comprising a second adaptor, wherein the first oligonucleotide is complementary to the target nucleic acid at the at least one variant base; (b) modified nucleotides having capture moieties; (c) a second oligonucleotide complementary to the target nucleic acid; (d) a first amplification primer; and (e) a second amplification primer, wherein the second oligonucleotide hybridizes to the target nucleic acid at a position 5' relative to the first oligonucleotide, and wherein the first amplification primer has a 3' end that is complementary to the first adaptor, and wherein the second amplification primer has a 3' end that is complementary to the second adaptor.

36. The kit of claim 34, wherein the second oligonucleotide is complementary to the target nucleic acid at the at least one variant base.

37. A method for doubly enriching at least one target nucleic acid in a nucleic acid library, wherein the at least one target nucleic acid comprises at least one variant base, the method comprising: (a) hybridizing a first oligonucleotide to a target nucleic acid in a nucleic acid library, each of the nucleic acids in the nucleic acid library having a first end comprising a first adaptor and a second end comprising a second adaptor, wherein the first oligonucleotide is complementary to the target nucleic acid at the at least one variant base; (b) extending the hybridized first oligonucleotide with a first polymerase, thereby generating a first primer extension complex comprising the target nucleic acid and the extended first oligonucleotide; (c) capturing the first primer extension complex; (d) enriching the first primer extension complex relative to the nucleic acid library; (e) hybridizing a second oligonucleotide to the target nucleic acid; (f) extending the hybridized second oligonucleotide with a second polymerase, thereby generating a second primer extension complex comprising the target nucleic acid and the extended second oligonucleotide, thereby releasing the extended first oligonucleotide from the first primer extension complex; (g) amplifying the target nucleic acid with a third polymerase, a first amplification primer, and a second amplification primer, wherein the first amplification primer has a 3' end complementary to the first adaptor, and the second amplification primer has a 3' end complementary to the second adaptor, to produce a sample of amplified target nucleic acid; and (h) repeating each of the ordered steps (a) to (g) on ​​the sample of amplified target nucleic acid of step (g).

38. A method for doubly enriching at least one target nucleic acid in a nucleic acid library, wherein the at least one target nucleic acid comprises at least one variant base, the method comprising: (a) hybridizing a first oligonucleotide to a target nucleic acid in a nucleic acid library, each of the nucleic acids in the nucleic acid library having a first end comprising a first adaptor and a second end comprising a second adaptor, wherein the first oligonucleotide is complementary to the target nucleic acid at the at least one variant base; (b) extending the hybridized first oligonucleotide with a first polymerase, thereby generating a first primer extension complex comprising the target nucleic acid and the extended first oligonucleotide; (c) capturing the first primer extension complex; (d) enriching the first primer extension complex relative to the nucleic acid library; (e) denaturing the first primer extension complex to release the target nucleic acid from the first primer extension complex; (f) repeating each of the ordered steps (a) to (d) for the target nucleic acid of step (e); (g) hybridizing a second oligonucleotide to the target nucleic acid; (h) extending the hybridized second oligonucleotide with a second polymerase, thereby generating a second primer extension complex comprising the target nucleic acid and the extended second oligonucleotide, thereby releasing the extended first oligonucleotide from the first primer extension complex; as well as (i) amplifying the target nucleic acid using a third polymerase, a first amplification primer and a second amplification primer, wherein the first amplification primer has a 3' end complementary to the first adaptor, and the second amplification primer has a 3' end complementary to the second adaptor.

39. A method for doubly enriching at least one target nucleic acid in a nucleic acid library, wherein the at least one target nucleic acid comprises at least one variant base, the method comprising: (a) hybridizing a first oligonucleotide to a target nucleic acid in a nucleic acid library, each of the nucleic acids in the nucleic acid library having a first end comprising a first adaptor and a second end comprising a second adaptor, wherein the first oligonucleotide is complementary to the target nucleic acid at the at least one variant base; (b) extending the hybridized first oligonucleotide with a first polymerase, thereby generating a first primer extension complex comprising the target nucleic acid and the extended first oligonucleotide; (c) capturing the first primer extension complex; (d) enriching the first primer extension complex relative to the nucleic acid library; (e) hybridizing a second oligonucleotide to the target nucleic acid; (f) extending the hybridized second oligonucleotide with a second polymerase, thereby generating a second primer extension complex comprising the target nucleic acid and the extended second oligonucleotide, thereby releasing the extended first oligonucleotide from the first primer extension complex; (g) repeating each of the sequential steps (a) to (f) for the target nucleic acid of step (f); and (h) amplifying the target nucleic acid using a third polymerase, a first amplification primer and a second amplification primer, wherein the first amplification primer has a 3' end complementary to the first adaptor, and the second amplification primer has a 3' end complementary to the second adaptor.

Images