Compositions and methods for inhibiting factor XII gene expression

Abstract

The present disclosure relates to compositions and methods for inhibiting factor XII gene expression. RNA interfering substances for inhibiting expression of the Factor XII (FXII) gene are described. Also described are pharmaceutical compositions comprising one or more FXII RNAi substances and one or more excipients capable of delivering the RNAi substances to hepatocytes in vivo. Delivery of the FXII RNAi substance to hepatocytes in vivo provides inhibition of FXII gene expression and inhibition of angioedema, including hereditary angioedema (HAE), venous thromboembolism (VTE), and diseases associated with angioedema.

Description

[0001] This application is a divisional application of Chinese patent application No. 201880008973.6.

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] This application claims the benefit of U.S. Provisional Patent Application Serial No. 62 / 451,868, filed January 30, 2017, the contents of which are incorporated herein by reference in their entirety. Field of the Invention

[0004] Disclosed are RNA interference (RNAi) agents for inhibiting Factor XII gene expression, compositions comprising FXII RNAi agents, and methods of use thereof. Background Art

[0005] Factor XII (also known as FXII, F12 or Hagemann factor), a serine protease expressed primarily in the liver and found in the blood, has dual functions in the intrinsic coagulation pathway and the kinin-kallikrein system. The kinin-kallikrein system plays a role in inflammation, blood pressure control, coagulation and pain. The active form of factor XII binds to and cleaves factor XI in the coagulation cascade and prekallikrein in the kinin-kallikrein system to produce the active forms FXI and kallikrein, respectively.

[0006] Patients who completely lost FXII had no bleeding disorders. In addition, mice lacking FXII by gene knockout have been shown to be free from thrombosis (Renne et al., JEM 2005, 202: 271-281). The thromboprotective effect of FXII depletion was also observed in mice, rabbits and primates treated with FXII-inhibitory antibodies (Larsson et al., Science TransMed, 2014 6: 22ra17). Current treatments for thromboembolic events target enzymes downstream in the coagulation pathway, which are crucial for controlling injury-related blood loss through fibrin formation, and therefore, treatment with these agents has the disadvantage of potentially life-threatening bleeding. Especially in the case of contraindications to factor Xa inhibitors, the administration of current anticoagulant therapy increases the risk of major bleeding events.

[0007] Hereditary angioedema (HAE) is a rare disease characterized by recurrent episodes of severe swelling. The most common areas of the body that swell are the extremities, face, intestines, and airways. Attacks may be spontaneous or triggered by physical trauma or stress. Laryngeal (airway) edema can be life-threatening as it can lead to death from asphyxiation. Most HAE treatment options are given at the time of an attack and focus on C1INH replacement, inhibition of kallikrein, or signaling through the bradykinin 2 receptor. Currently, the only long-term preventive treatment is C1INH replacement therapy.

[0008] The RNAi material targeting FXII previously found is described in International Patent Application Publication No. WO2016 / 149331A2, the entire contents of which are incorporated herein as if fully set forth herein. In addition, FXII iRNA compositions are disclosed in International Patent Application Publication Nos. WO 2016 / 179342 and WO 2017 / 120397. However, the sequence and modification of the FXII RNAi material disclosed herein are different from those previously disclosed or known in the art. The FXII RNAi material disclosed herein provides effective and efficient inhibition of FXII gene expression. Summary of the invention

[0009] There is a need for novel FXII RNA interference (RNAi) substances (also referred to herein as RNAi substances, RNAi initiators or initiators) that can selectively and efficiently inhibit FXII expression. In addition, compositions of novel FXII-specific RNAi substances are needed. Since thrombosis (including venous thromboembolism, VTE) and angioedema are both believed to occur through overactive signaling of their respective pathways, inhibiting FXII gene expression can be used (especially) as a prophylactic treatment to prevent thrombosis and / or angioedema.

[0010] In general, the disclosure features FXII RNA interference (RNAi) agents, compositions containing FXII RNAi agents, and methods of using FXII RNAi agents and compositions containing FXII RNAi agents to inhibit FXII gene expression in vitro and / or in vivo. The FXII RNAi agents described herein can be used to treat diseases or conditions caused by overactivation of the kinin-kallikrein and intrinsic coagulation pathways, such as thrombosis and / or HAE.

[0011] The FXII gene-specific RNAi substances described herein can selectively and efficiently reduce the expression of FXII. The described FXII RNAi substances can be used for therapeutic treatment (including preventive treatment) of diseases and conditions associated with angioedema, including but not limited to: hereditary angioedema (HAE), acquired angioedema (AAE), ACE inhibitor-related angioedema, allergic angioedema, non-histaminergic angioedema (INAE), idiopathic angioedema, thrombosis, venous thromboembolism (VTE), thrombotic occlusive disease and perioperative venous occlusive disease prevention. The use of the FXII RNAi substances also provides methods for treating and preventing venous occlusive diseases such as deep vein thrombosis or pulmonary embolism, as well as treating or preventing arterial thromboembolic diseases. Such methods include administering the FXII RNAi substances shown herein to a subject, e.g., a human or animal subject, by any suitable means known in the art, such as subcutaneous injection or intravenous administration.

[0012] In one aspect, the disclosure features an RNAi substance for inhibiting human FXII gene expression, wherein the RNAi substance comprises a sense strand and an antisense strand. Also described herein is a composition comprising an RNAi substance capable of inhibiting FXII gene expression, wherein the RNAi substance comprises a sense strand and an antisense strand, and the composition further comprises at least one pharmaceutically acceptable excipient.

[0013] Each FXII RNAi material described herein comprises a sense strand and an antisense strand. The sense strand and the antisense strand can be partially, substantially or completely complementary to each other. The length of the sense and antisense strands of the RNAi material described herein can be 16-30 nucleotides. In some embodiments, the length of the sense and antisense strands is independently 17-26 nucleotides. The sense and antisense strands can be the same length or different lengths. In some embodiments, the length of the sense and antisense strands is independently 21-26 nucleotides. In some embodiments, the length of the sense and antisense strands is independently 21-24 nucleotides. In some embodiments, the length of the sense and / or antisense strands is independently 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides. The sense and antisense strands can be the same length or different lengths. The RNAi material described herein suppresses the in vivo or in vitro expression of one or more FXII genes after being delivered to cells expressing FXII.

[0014] FXII RNAi material comprises a sense strand (also referred to as a follower strand) and an antisense strand (also referred to as a guide strand). The sense strand of the FXII RNAi material described herein contains a nucleotide sequence having a core stretch of at least 85% homology to a sequence in FXII mRNA of at least 16 consecutive nucleotides. In some embodiments, the length of the sense strand core stretch having at least 85% homology to a sequence in FXII mRNA is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides. In some embodiments, the length of the sense strand core stretch having at least 85% homology to a sequence in FXII mRNA is 19 nucleotides. The antisense strand of the FXII RNAi material contains a nucleotide sequence having at least 85% complementarity to a core stretch of at least 16 consecutive nucleotides in a sequence in FXII mRNA and a corresponding sense strand. In some embodiments, the length of the antisense strand core stretch having at least 85% complementarity to a sequence in FXII mRNA or a corresponding sense strand is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides.

[0015] In some embodiments, the FXII RNAi agents disclosed herein target a portion of the FXII gene having a sequence of any one of the sequences disclosed in Table 1.

[0016] Examples of FXII RNAi agent sense and antisense strands that can be used in FXII RNAi agents are provided in Tables 2, 3, 4, and 6. Examples of duplexes comprising FXII RNAi agents are provided in Tables 5 and 6. Examples of RNAi agent 19 nucleotide core stretch sequences that may constitute or be included in the sense and antisense strands of certain FXII RNAi agents disclosed herein are provided in Table 2.

[0017] In another aspect, the disclosure features a method for in vivo delivery of FXII RNAi substances to liver cells of a subject (e.g., a mammal). In some embodiments, one or more FXII RNAi substances are delivered to target cells or tissues using any oligonucleotide delivery technology known in the art. Nucleic acid delivery methods include, but are not limited to, encapsulation in liposomes, iontophoresis, or by incorporation into other carriers, such as hydrogels, cyclodextrins, biodegradable nanocapsules, and bioadhesive microspheres, protein carriers, or Dynamic Polyconjugates. TM(DPC) (see, e.g., WO 2000 / 053722, WO 2008 / 0022309, WO 2011 / 104169, and WO 2012 / 083185, each of which is incorporated herein by reference). In some embodiments, the FXII RNAi agents disclosed herein can be used in conjunction with a delivery vehicle, such as a polymer, an amphiphilic polymer, a membrane active polymer, a peptide, such as melittin or a melittin-like peptide, a reversibly modified polymer or peptide, or a lipid.

[0018] In some embodiments, by covalently linking or coupling the RNAi material to a targeting group such as an asialoglycoprotein receptor ligand, the FXII RNAi material is delivered to a target cell or tissue. In some embodiments, the asialoglycoprotein receptor ligand includes, is composed of, or is substantially composed of: galactose or a galactose derivative cluster. In some embodiments, the FXII RNAi material is connected to a targeting ligand comprising galactose-derived N-acetyl-galactosamine. In some embodiments, the galactose derivative cluster comprises an N-acetyl-galactosamine trimer or an N-acetyl-galactosamine tetramer. In some embodiments, the galactose-derived cluster is an N-acetyl-galactosamine trimer or an N-acetyl-galactosamine tetramer. For example, exemplary targeting groups that can be used to deliver the disclosed RNAi material are described in U.S. Patent Application No. 15 / 452,324 and International Patent Application Publication No. WO 2017 / 156012, all of which are incorporated herein by reference.

[0019] The targeting group can be connected to the 3' or 5' end of the FXII RNAi material sense strand or antisense strand. In some embodiments, the targeting group is connected to the 3' or 5' end of the sense strand. In some embodiments, the targeting group is connected to the 5' end of the sense strand. In some embodiments, the targeting group is connected to the nucleotide interior on the RNAi material sense strand and / or antisense strand. In some embodiments, the targeting group is connected to the RNAi material via a joint.

[0020] A targeting group with or without a linker can be attached to the 5′ or 3′ end of any of the sense and / or antisense strands disclosed in Tables 2, 3, 4, and 6. A linker with or without a targeting group can be attached to the 5′ or 3′ end of any of the sense and / or antisense strands disclosed in Tables 2, 3, 4, and 6.

[0021] In another aspect, the disclosure features a composition comprising one or more FXII RNAi agents having a duplex structure disclosed in Table 5.

[0022] In another aspect, the disclosure features a composition comprising one or more FXII RNAi agents having a duplex structure disclosed in Table 6.

[0023] In some embodiments, described herein is such a composition, the composition comprises a combination or mixture of at least two FXII RNAi materials with different nucleotide sequences. In some embodiments, two or more different FXII RNAi materials are each separated and independently connected to a targeting group. In some embodiments, two or more different FXII RNAi materials are each connected to a targeting group comprising a targeting ligand or consisting of a targeting ligand, and the targeting ligand comprises one or more parts of a targeting asialoglycoprotein receptor. In some embodiments, two or more different FXII RNAi materials are each connected to a targeting group comprising a targeting ligand or consisting of a targeting ligand, and the targeting ligand comprises one or more galactose derivatives. In some embodiments, two or more different FXII RNAi materials are each connected to a targeting group comprising a targeting ligand or consisting of a targeting ligand, and the targeting ligand comprises one or more N-acetyl-galactosamine. In some embodiments, when two or more RNAi materials are included in the composition, each RNAi material is independently connected to the same targeting group. In some embodiments, when two or more RNAi materials are included in the composition, each RNAi material is independently connected to different targeting groups, such as targeting groups with different chemical structures.

[0024] In some embodiments, the targeting group is connected with the FXII RNAi material without using an additional joint. In some embodiments, the design targeting group is to have such a joint, and the existence of this joint is easy to promote to be connected with the FXII RNAi material. In some embodiments, when comprising two or more RNAi materials in the composition, two or more RNAi materials can use the same joint to be connected with their corresponding targeting groups. In some embodiments, when comprising two or more RNAi materials in the composition, two or more RNAi materials use different joints to be connected with their corresponding targeting groups.

[0025] In another aspect, the disclosure features a method for inhibiting FXII gene expression in a subject, the method comprising administering to the subject an amount of a FXII RNAi agent capable of inhibiting FXII gene expression, wherein the FXII RNAi agent comprises a sense strand and an antisense strand.

[0026] In some embodiments, a composition for delivering a FXII RNAi agent to hepatocytes in vivo is described, comprising: a FXII RNAi agent coupled to a targeting group. In some embodiments, the targeting group is an asialoglycoprotein ligand.

[0027] In some embodiments, a pharmaceutical composition comprising one or more FXII RNAi substances is described. In some embodiments, the FXII RNAi substance is optionally combined with one or more other (i.e., second, third, etc.) therapeutic agents. Other therapeutic agents can be another FXII RNAi substance (e.g., FXII RNAi substances of different sequences in the targeting FXII target). Other therapeutic agents can also be small molecule drugs, antibodies, antibody fragments, aptamers and / or vaccines. FXII RNAi substances with or without one or more other therapeutic agents can be combined with one or more excipients to form a pharmaceutical composition.

[0028] Also described are methods for treating a human subject having a pathological state (e.g., a disorder or disease) or a risk of developing a pathological state, the pathological state being mediated at least in part by FXII expression, the method comprising administering to the subject a therapeutically effective amount of a FXII RNAi substance and / or a composition containing the FXII RNAi substance. The method of treating a subject with a FXII RNAi substance and / or a composition containing the FXII RNAi substance may optionally be combined with one or more steps of administering one or more other (i.e., second) therapeutic agents or treatments. The FXII RNAi substance and other therapeutic agents may be administered in a single composition, or they may be administered separately.

[0029] In some embodiments, disclosed herein are methods for treating (including prophylactic treatment) a pathological state mediated at least in part by FXII expression, wherein the method comprises administering to a subject a therapeutically effective amount of an RNAi agent comprising an antisense strand, wherein the antisense strand comprises a sequence of any sequence in Table 2 or Table 3.

[0030] In some embodiments, disclosed herein is a method for inhibiting FXII gene expression, the method comprising administering to a cell an RNAi substance, wherein the RNAi substance comprises an antisense strand, wherein the antisense strand comprises a sequence shown in any one of Tables 2 or 3.

[0031] In some embodiments, disclosed herein are methods for treating (including prophylactic treatment) a pathological state (e.g., a disease or condition) mediated at least in part by FXII expression, wherein the method comprises administering to a subject a therapeutically effective amount of an RNAi agent comprising a sense strand, wherein the sense strand comprises a sequence of any sequence in Table 2 or Table 4.

[0032] In some embodiments, disclosed herein is a method for inhibiting FXII gene expression, the method comprising administering to a cell an RNAi substance, wherein the RNAi substance comprises a sense strand, wherein the sense strand comprises a sequence shown in any one of Table 2 or Table 4.

[0033] In some embodiments, disclosed herein is a method for treating (including prophylactic treatment) a pathological state mediated at least in part by FXII expression, wherein the method comprises administering to a subject a therapeutically effective amount of an RNAi agent comprising a sense strand and an antisense strand, wherein the sense strand comprises a sequence of any sequence in Table 4 and the antisense strand comprises a sequence of any sequence in Table 3.

[0034] In some embodiments, disclosed herein is a method for inhibiting FXII gene expression, wherein the method comprises administering to a cell an RNAi substance, wherein the RNAi substance comprises a sense strand and an antisense strand, wherein the sense strand comprises a sequence of any one of the sequences shown in Table 4, and the antisense strand comprises a sequence of any one of the sequences shown in Table 3.

[0035] In some embodiments, disclosed herein is a method of inhibiting FXII gene expression, wherein the method comprises administering to a subject a FXII RNAi substance, wherein the FXII RNAi substance comprises a sense strand and an antisense strand, wherein the sense strand consists of a nucleobase sequence of any one of the sequences shown in Table 4, and the antisense strand consists of a nucleobase sequence of any one of the sequences shown in Table 3. In other embodiments, disclosed herein is a method of inhibiting FXII gene expression, wherein the method comprises administering to a subject a FXII RNAi substance, wherein the FXII RNAi substance comprises a sense strand and an antisense strand, wherein the sense strand consists of a modified sequence of any one of the modified sequences shown in Table 4, and the antisense strand consists of a modified sequence of any one of the modified sequences shown in Table 3.

[0036] In some embodiments, disclosed herein are methods for inhibiting FXII gene expression in a cell, wherein the method comprises administering one or more FXII RNAi agents having a duplex structure as shown in Table 5.

[0037] In some embodiments, disclosed herein are methods for inhibiting FXII gene expression in a cell, wherein the method comprises administering one or more FXII RNAi agents having a duplex structure as shown in Table 6.

[0038] The FXII RNAi substances disclosed herein are designed to target a specific position on the FXII gene (SEQ ID NO: 1). As defined herein, the antisense strand sequence is designed to target the gene at a given position on the FXII gene, and when base-paired with the gene, the 5' terminal nucleobase of the antisense strand will be aligned with the position 19 nucleotides downstream (towards the 3' end) of the position on the gene. For example, as shown in Tables 1 and 2 herein, the antisense strand sequence designed to target the FXII gene at position 127 requires that when base-paired with the gene, the 5' terminal nucleobase of the antisense strand is aligned with position 145 of the FXII gene. As shown herein, the FXII RNAi agent does not require the nucleobase at position 1 of the antisense strand (5′→3′) to be complementary to the gene, provided that the antisense strand is at least 85% complementary to the gene over a core stretch of at least 16 consecutive nucleotides (e.g., at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementary). For example, for the FXII RNAi agent disclosed herein that is intended to target position 127 of the FXII gene, the 5′ terminal nucleobase of the antisense strand of the FXII RNAi agent must be aligned with position 145 of the gene; however, the 5′ terminal nucleobase of the antisense strand can, but is not required to be complementary to position 145 of the FXII gene, provided that the antisense strand is at least 85% complementary to the gene over a core stretch of at least 16 consecutive nucleotides (e.g., at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementary). Among them, as shown in the various examples disclosed herein, the specific site at which the antisense strand of the FXII RNAi agent binds to the gene (e.g., whether the FXII RNAi agent is designed to target the FXII gene at position 127, position 91, position 321, or other position) is very important for the level of inhibition achieved by the FXII RNAi agent.

[0039] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUUGUACUUAUGCUCCUUGGC (SEQ ID NO: 804), wherein at least one or more nucleotides are modified nucleotides. In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUUGUACUUAUGCUCCUUGGC (SEQ ID NO: 804), wherein all or substantially all nucleotides are modified nucleotides.

[0040] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UGGUCUUUCACUUUCUUGGUU (SEQ ID NO: 751), wherein at least one or more nucleotides are modified nucleotides. In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UGGUCUUUCACUUUCUUGGUU (SEQ ID NO: 751), wherein all or substantially all nucleotides are modified nucleotides.

[0041] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UAAGCACUUUAUUGAGUUCCU (SEQ ID NO: 673), wherein at least one or more nucleotides are modified nucleotides. In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UAAGCACUUUAUUGAGUUCCU (SEQ ID NO: 673), wherein all or substantially all nucleotides are modified nucleotides.

[0042] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUUCAAAGCACUUUAUUGAGU (SEQ ID NO: 793), wherein at least one or more nucleotides are modified nucleotides. In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUUCAAAGCACUUUAUUGAGU (SEQ ID NO: 793), wherein all or substantially all nucleotides are modified nucleotides.

[0043] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUCAAAGCACUUUAUUGAGUU (SEQ ID NO: 767), wherein one or more nucleotides are modified nucleotides. In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUCAAAGCACUUUAUUGAGUU (SEQ ID NO: 767), wherein all or substantially all nucleotides are modified nucleotides.

[0044] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUUGUACUUAUGCUCCUUGGG (SEQ ID NO: 805), wherein one or more nucleotides are modified nucleotides. In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUUGUACUUAUGCUCCUUGGG (SEQ ID NO: 805), wherein all or substantially all nucleotides are modified nucleotides.

[0045] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUGUACUUAUGCUCCUUGGUU (SEQ ID NO: 787), wherein one or more nucleotides are modified nucleotides. In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUGUACUUAUGCUCCUUGGUU (SEQ ID NO: 787), wherein all or substantially all nucleotides are modified nucleotides.

[0046] In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence GCCAAGGAGCAUAAGUACAAA (SEQ ID NO: 896), wherein one or more nucleotides are modified nucleotides. In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence GCCAAGGAGCAUAAGUACAAA (SEQ ID NO: 896), wherein all or substantially all nucleotides are modified nucleotides.

[0047] In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence AACCAAGAAAGUGAAAGACCA (SEQ ID NO: 827), wherein one or more nucleotides are modified nucleotides. In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence AACCAAGAAAGUGAAAGACCA (SEQ ID NO: 827), wherein all or substantially all nucleotides are modified nucleotides.

[0048] In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence AGGAACUCAAUAAAGUGCUUA (SEQ ID NO: 855), wherein one or more nucleotides are modified nucleotides. In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence AGGAACUCAAUAAAGUGCUUA (SEQ ID NO: 855), wherein all or substantially all nucleotides are modified nucleotides.

[0049] In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence ACUCAAUAAAGUGCUUUGAAA (SEQ ID NO: 846), wherein one or more nucleotides are modified nucleotides. In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence ACUCAAUAAAGUGCUUUGAAA (SEQ ID NO: 846), wherein all or substantially all nucleotides are modified nucleotides.

[0050] In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence AACUCAAUAAAGUGCUUUGAA (SEQ ID NO: 829), wherein one or more nucleotides are modified nucleotides. In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence AACUCAAUAAAGUGCUUUGAA (SEQ ID NO: 829), wherein all or substantially all nucleotides are modified nucleotides.

[0051] In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence CCCAAGGAGCAUAAGUACAAA (SEQ ID NO: 868), wherein one or more nucleotides are modified nucleotides. In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence CCCAAGGAGCAUAAGUACAAA (SEQ ID NO: 868), wherein all or substantially all nucleotides are modified nucleotides.

[0052] In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence CCAAGGAGCAUAAGUACAAUU (SEQ ID NO: 866), wherein one or more nucleotides are modified nucleotides. In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence CCAAGGAGCAUAAGUACAAUU (SEQ ID NO: 866), wherein all or substantially all nucleotides are modified nucleotides.

[0053] In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence GCCAAGGAGCAUAAGUACAAA (SEQ ID NO: 896), wherein one or more nucleotides are modified nucleotides, and the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUUGUACUUAUGCUCCUUGGC (SEQ ID NO: 804), wherein one or more nucleotides are modified nucleotides.

[0054] In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence AACCAAGAAAGUGAAAGACCA (SEQ ID NO: 827), wherein one or more nucleotides are modified nucleotides, and the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UGGUCUUUCACUUUCUUGGUU (SEQ ID NO: 751), wherein one or more nucleotides are modified nucleotides.

[0055] In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence AGGAACUCAAUAAAGUGCUUA (SEQ ID NO: 855), wherein one or more nucleotides are modified nucleotides, and the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UAAGCACUUUAUUGAGUUCCU (SEQ ID NO: 673), wherein one or more nucleotides are modified nucleotides.

[0056] In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence ACUCAAUAAAGUGCUUUGAAA (SEQ ID NO: 846), wherein one or more nucleotides are modified nucleotides, and the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUUCAAAGCACUUUAUUGAGU (SEQ ID NO: 793), wherein one or more nucleotides are modified nucleotides.

[0057] In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence AACUCAAUAAAGUGCUUUGAA (SEQ ID NO: 829), wherein one or more nucleotides are modified nucleotides, and the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUCAAAGCACUUUAUUGAGUU (SEQ ID NO: 767), wherein one or more nucleotides are modified nucleotides.

[0058] In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence CCCAAGGAGCAUAAGUACAAA (SEQ ID NO: 868), wherein one or more nucleotides are modified nucleotides, and the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUUGUACUUAUGCUCCUUGGG (SEQ ID NO: 805), wherein one or more nucleotides are modified nucleotides.

[0059] In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence CCAAGGAGCAUAAGUACAAUU (SEQ ID NO: 866), wherein one or more nucleotides are modified nucleotides, and the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUGUACUUAUGCUCCUUGGUU (SEQ ID NO: 787), wherein one or more nucleotides are modified nucleotides.

[0060] In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence GCCAAGGAGCAUAAGUACAAA (SEQ ID NO: 896), wherein all or substantially all nucleotides are modified nucleotides, and the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUUGUACUUAUGCUCCUUGGC (SEQ ID NO: 804), wherein all or substantially all nucleotides are modified nucleotides.

[0061] In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence AACCAAGAAAGUGAAAGACCA (SEQ ID NO: 827), wherein all or substantially all nucleotides are modified nucleotides, and the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UGGUCUUUCACUUUCUUGGUU (SEQ ID NO: 751), wherein all or substantially all nucleotides are modified nucleotides.

[0062] In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence AGGAACUCAAUAAAGUGCUUA (SEQ ID NO: 855), wherein all or substantially all nucleotides are modified nucleotides, and the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UAAGCACUUUAUUGAGUUCCU (SEQ ID NO: 673), wherein all or substantially all nucleotides are modified nucleotides.

[0063] In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence ACUCAAUAAAGUGCUUUGAAA (SEQ ID NO: 846), all or substantially all nucleotides are modified nucleotides, and the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUUCAAAGCACUUUAUUGAGU (SEQ ID NO: 793), all or substantially all nucleotides are modified nucleotides.

[0064] In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence AACUCAAUAAAGUGCUUUGAA (SEQ ID NO: 829), wherein all or substantially all nucleotides are modified nucleotides, and the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUCAAAGCACUUUAUUGAGUU (SEQ ID NO: 767), wherein all or substantially all nucleotides are modified nucleotides.

[0065] In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence CCCAAGGAGCAUAAGUACAAA (SEQ ID NO: 868), wherein all or substantially all nucleotides are modified nucleotides, and the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUUGUACUUAUGCUCCUUGGG (SEQ ID NO: 805), wherein all or substantially all nucleotides are modified nucleotides.

[0066] In some embodiments, the sense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence CCAAGGAGCAUAAGUACAAUU (SEQ ID NO: 866), wherein all or substantially all nucleotides are modified nucleotides, and the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUGUACUUAUGCUCCUUGGUU (SEQ ID NO: 787), wherein all or substantially all nucleotides are modified nucleotides.

[0067] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of a nucleobase sequence that differs from UUUGUACUUAUGCUCCUUGGC (SEQ ID NO: 804) by 0, 1, 2, or 3 nucleotides, wherein at least one or more nucleotides are modified nucleotides, and the sense strand of the FXII RNAi agent comprises or consists of a nucleobase sequence that differs from GCCAAGGAGCAUAAGUACAAA (SEQ ID NO: 896) by 0, 1, 2, or 3 nucleotides.

[0068] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of a nucleobase sequence that differs from UGGUCUUUCACUUUCUUGGUU (SEQ ID NO: 751) by 0, 1, 2, or 3 nucleotides, wherein at least one or more nucleotides are modified nucleotides, and the sense strand of the FXII RNAi agent comprises or consists of a nucleobase sequence that differs from AACCAAGAAAGUGAAAGACCA (SEQ ID NO: 827) by 0, 1, 2, or 3 nucleotides.

[0069] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of a nucleobase sequence that differs from UAAGCACUUUAUUGAGUUCCU (SEQ ID NO: 673) by 0, 1, 2, or 3 nucleotides, wherein at least one or more nucleotides are modified nucleotides, and the sense strand of the FXII RNAi agent comprises or consists of a nucleobase sequence that differs from AGGAACUCAAUAAAGUGCUUA (SEQ ID NO: 855) by 0, 1, 2, or 3 nucleotides.

[0070] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of a nucleobase sequence that differs from UUUCAAAGCACUUUAUUGAGU (SEQ ID NO: 793) by 0, 1, 2, or 3 nucleotides, wherein at least one or more nucleotides are modified nucleotides, and the sense strand of the FXII RNAi agent comprises or consists of a nucleobase sequence that differs from ACUCAAUAAAGUGCUUUGAAA (SEQ ID NO: 846) by 0, 1, 2, or 3 nucleotides.

[0071] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of a nucleobase sequence that differs from UUCAAAGCACUUUAUUGAGUU (SEQ ID NO: 767) by 0, 1, 2, or 3 nucleotides, wherein at least one or more nucleotides are modified nucleotides, and the sense strand of the FXII RNAi agent comprises or consists of a nucleobase sequence that differs from AACUCAAUAAAGUGCUUUGAA (SEQ ID NO: 829) by 0, 1, 2, or 3 nucleotides.

[0072] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of a nucleobase sequence that differs from UUUGUACUUAUGCUCCUUGGG (SEQ ID NO: 805) by 0, 1, 2, or 3 nucleotides, wherein at least one or more nucleotides are modified nucleotides, and the sense strand of the FXII RNAi agent comprises or consists of a nucleobase sequence that differs from CCCAAGGAGCAUAAGUACAAA (SEQ ID NO: 868) by 0, 1, 2, or 3 nucleotides.

[0073] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of a nucleobase sequence that differs from UUGUACUUAUGCUCCUUGGUU (SEQ ID NO: 787) by 0, 1, 2, or 3 nucleotides, wherein at least one or more nucleotides are modified nucleotides, and the sense strand of the FXII RNAi agent comprises or consists of a nucleobase sequence that differs from CCAAGGAGCAUAAGUACAAUU (SEQ ID NO: 866) by 0, 1, 2, or 3 nucleotides.

[0074] In some embodiments, the FXII RNAi agent comprises, consists of, or consists essentially of the duplex structure of AD05333.

[0075] In some embodiments, the FXII RNAi agent comprises, consists of, or consists essentially of the duplex structure of AD04131.

[0076] In some embodiments, the FXII RNAi agent comprises, consists of, or consists essentially of the duplex structure of AD04157.

[0077] In some embodiments, the FXII RNAi agent comprises, consists of, or consists essentially of the duplex structure of AD04254.

[0078] In some embodiments, the FXII RNAi agent comprises, consists of, or consists essentially of the duplex structure of AD04623.

[0079] In some embodiments, the FXII RNAi agent comprises, consists of, or consists essentially of the duplex structure of AD04625.

[0080] In some embodiments, the FXII RNAi agent comprises, consists of, or consists essentially of the duplex structure of AD04627.

[0081] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUUGUACUUAUGCUCCUUG (SEQ ID NO: 23), wherein one or more nucleotides are modified nucleotides, and wherein SEQ ID NO: 23 is located at positions 1-19 (5′→3′) of the antisense strand. In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUUGUACUUAUGCUCCUUG (SEQ ID NO: 23), wherein all or substantially all nucleotides are modified nucleotides, and wherein SEQ ID NO: 23 is located at positions 1-19 (5′→3′) of the antisense strand.

[0082] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UGGUCUUUCACUUUCUUGG (SEQ ID NO: 51), wherein one or more nucleotides are modified nucleotides, and wherein SEQ ID NO: 51 is located at positions 1-19 (5′→3′) of the antisense strand. In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UGGUCUUUCACUUUCUUGG (SEQ ID NO: 51), wherein all or substantially all nucleotides are modified nucleotides, and wherein SEQ ID NO: 51 is located at positions 1-19 (5′→3′) of the antisense strand.

[0083] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UAAGCACUUUAUUGAGUUC (SEQ ID NO: 87), wherein one or more nucleotides are modified nucleotides, and wherein SEQ ID NO: 87 is located at positions 1-19 (5′→3′) of the antisense strand. In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UAAGCACUUUAUUGAGUUC (SEQ ID NO: 87), wherein all or substantially all nucleotides are modified nucleotides, and wherein SEQ ID NO: 87 is located at positions 1-19 (5′→3′) of the antisense strand.

[0084] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUCAAAGCACUUUAUUGAG (SEQ ID NO: 90), wherein one or more nucleotides are modified nucleotides, and wherein SEQ ID NO: 90 is located at positions 1-19 (5′→3′) of the antisense strand. In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUCAAAGCACUUUAUUGAG (SEQ ID NO: 90), wherein all or substantially all nucleotides are modified nucleotides, and wherein SEQ ID NO: 90 is located at positions 1-19 (5′→3′) of the antisense strand.

[0085] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUUCAAAGCACUUUAUUGA (SEQ ID NO: 93), wherein one or more nucleotides are modified nucleotides, and wherein SEQ ID NO: 93 is located at positions 1-19 (5′→3′) of the antisense strand. In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUUCAAAGCACUUUAUUGA (SEQ ID NO: 93), wherein all or substantially all nucleotides are modified nucleotides, and wherein SEQ ID NO: 93 is located at positions 1-19 (5′→3′) of the antisense strand.

[0086] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUGUACUUAUGCUCCUUGG (SEQ ID NO: 37), wherein one or more nucleotides are modified nucleotides, and wherein SEQ ID NO: 37 is located at positions 1-19 (5′→3′) of the antisense strand. In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUGUACUUAUGCUCCUUGG (SEQ ID NO: 37), wherein all or substantially all nucleotides are modified nucleotides, and wherein SEQ ID NO: 37 is located at positions 1-19 (5′→3′) of the antisense strand.

[0087] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUUGUACUUAUGCUCCUUGGC (SEQ ID NO: 804), wherein at least one or more nucleotides are modified nucleotides, and wherein SEQ ID NO: 804 is located at positions 1-21 (5′→3′) of the antisense strand. In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUUGUACUUAUGCUCCUUGGC (SEQ ID NO: 804), wherein all or substantially all nucleotides are modified nucleotides, and wherein SEQ ID NO: 804 is located at positions 1-21 (5′→3′) of the antisense strand.

[0088] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UGGUCUUUCACUUUCUUGGUU (SEQ ID NO: 751), wherein at least one or more nucleotides are modified nucleotides, and wherein SEQ ID NO: 751 is located at positions 1-21 (5′→3′) of the antisense strand. In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UGGUCUUUCACUUUCUUGGUU (SEQ ID NO: 751), wherein all or substantially all nucleotides are modified nucleotides, and wherein SEQ ID NO: 751 is located at positions 1-21 (5′→3′) of the antisense strand.

[0089] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UAAGCACUUUAUUGAGUUCCU (SEQ ID NO: 673), wherein at least one or more nucleotides are modified nucleotides, and wherein SEQ ID NO: 673 is located at positions 1-21 (5′→3′) of the antisense strand. In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UAAGCACUUUAUUGAGUUCCU (SEQ ID NO: 673), wherein all or substantially all nucleotides are modified nucleotides, and wherein SEQ ID NO: 673 is located at positions 1-21 (5′→3′) of the antisense strand.

[0090] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUUCAAAGCACUUUAUUGAGU (SEQ ID NO: 793), wherein at least one or more nucleotides are modified nucleotides, and wherein SEQ ID NO: 793 is located at positions 1-21 (5′→3′) of the antisense strand. In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUUCAAAGCACUUUAUUGAGU (SEQ ID NO: 793), wherein all or substantially all nucleotides are modified nucleotides, and wherein SEQ ID NO: 793 is located at positions 1-21 (5′→3′) of the antisense strand.

[0091] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUCAAAGCACUUUAUUGAGUU (SEQ ID NO: 767), wherein at least one or more nucleotides are modified nucleotides, and wherein SEQ ID NO: 767 is located at positions 1-21 (5′→3′) of the antisense strand. In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUCAAAGCACUUUAUUGAGUU (SEQ ID NO: 767), wherein all or substantially all nucleotides are modified nucleotides, and wherein SEQ ID NO: 767 is located at positions 1-21 (5′→3′) of the antisense strand.

[0092] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUUGUACUUAUGCUCCUUGGG (SEQ ID NO: 805), wherein at least one or more nucleotides are modified nucleotides, and wherein SEQ ID NO: 805 is located at positions 1-21 (5′→3′) of the antisense strand. In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUUGUACUUAUGCUCCUUGGG (SEQ ID NO: 805), wherein all or substantially all nucleotides are modified nucleotides, and wherein SEQ ID NO: 805 is located at positions 1-21 (5′→3′) of the antisense strand.

[0093] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUGUACUUAUGCUCCUUGGUU (SEQ ID NO: 787), wherein at least one or more nucleotides are modified nucleotides, and wherein SEQ ID NO: 787 is located at positions 1-21 (5′→3′) of the antisense strand. In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the nucleobase sequence UUGUACUUAUGCUCCUUGGUU (SEQ ID NO: 787), wherein all or substantially all nucleotides are modified nucleotides, and wherein SEQ ID NO: 787 is located at positions 1-21 (5′→3′) of the antisense strand.

[0094] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of a nucleobase sequence having 0, 1, 2 or 3 nucleotide differences from UUUGUACUUAUGCUCCUUGGC (SEQ ID NO: 804), wherein at least one or more nucleotides are modified nucleotides, and wherein SEQ ID NO: 804 is located at the 5′ end of the antisense strand, and wherein the sense strand of the FXII RNAi agent comprises or consists of a nucleobase sequence of GCCAAGGAGCAUAAGUACAAA (SEQ ID NO: 896).

[0095] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of a nucleobase sequence having 0, 1, 2 or 3 nucleotide differences from UGGUCUUUCACUUUCUUGGUU (SEQ ID NO: 751), wherein at least one or more nucleotides are modified nucleotides, and wherein SEQ ID NO: 751 is located at the 5′ end of the antisense strand, and wherein the sense strand of the FXII RNAi agent comprises or consists of a nucleobase sequence of AACCAAGAAAGUGAAAGACCA (SEQ ID NO: 827).

[0096] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of a nucleobase sequence having 0, 1, 2, or 3 nucleotide differences from UAAGCACUUUAUUGAGUUCCU (SEQ ID NO: 673), wherein at least one or more nucleotides are modified nucleotides, and wherein SEQ ID NO: 673 is located at the 5′ end of the antisense strand, and wherein the sense strand of the FXII RNAi agent comprises or consists of a nucleobase sequence of AGGAACUCAAUAAAGUGCUUA (SEQ ID NO: 855).

[0097] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of a nucleobase sequence having 0, 1, 2, or 3 nucleotide differences from UUUCAAAGCACUUUAUUGAGU (SEQ ID NO: 793), wherein at least one or more nucleotides are modified nucleotides, and wherein SEQ ID NO: 793 is located at the 5′ end of the antisense strand, and wherein the sense strand of the FXII RNAi agent comprises or consists of a nucleobase sequence of ACUCAAUAAAGUGCUUUGAAA (SEQ ID NO: 846).

[0098] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of a nucleobase sequence having 0, 1, 2, or 3 nucleotide differences from UUCAAAGCACUUUAUUGAGUU (SEQ ID NO: 767), wherein at least one or more nucleotides are modified nucleotides, and wherein SEQ ID NO: 767 is located at the 5′ end of the antisense strand, and the sense strand of the FXII RNAi agent comprises or consists of a nucleobase sequence having 0, 1, 2, or 3 nucleotide differences from AACUCAAUAAAGUGCUUUGAA (SEQ ID NO: 829).

[0099] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of a nucleobase sequence having 0, 1, 2, or 3 nucleotide differences from UUUGUACUUAUGCUCCUUGGG (SEQ ID NO: 805), wherein at least one or more nucleotides are modified nucleotides, and wherein SEQ ID NO: 805 is located at the 5′ end of the antisense strand, and the sense strand of the FXII RNAi agent comprises or consists of a nucleobase sequence having 0, 1, 2, or 3 nucleotide differences from CCCAAGGAGCAUAAGUACAAA (SEQ ID NO: 868).

[0100] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of a nucleobase sequence having 0, 1, 2, or 3 nucleotide differences from UUGUACUUAUGCUCCUUGGUU (SEQ ID NO: 787), wherein at least one or more nucleotides are modified nucleotides, and wherein SEQ ID NO: 787 is located at the 5′ end of the antisense strand, and the sense strand of the FXII RNAi agent comprises or consists of a nucleobase sequence having 0, 1, 2, or 3 nucleotide differences from CCAAGGAGCAUAAGUACAAUU (SEQ ID NO: 866).

[0101] The FXII RNAi agents described herein may comprise one or more modified nucleotides. The FXII RNAi agents described herein may further comprise one or more phosphorothioate internucleoside linkages.

[0102] The FXII RNAi material described herein may further comprise one or more targeting groups or linking groups. In some embodiments, the FXII RNAi material disclosed herein comprises one or more targeting groups. In some embodiments, the targeting group comprises an asialoglycoprotein receptor ligand. In some embodiments, the asialoglycoprotein receptor ligand comprises a galactose or galactose derivative cluster. In some embodiments, the galactose derivative cluster comprises N-acetyl-galactosamine. In some embodiments, the targeting ligand comprises N-acetyl-galactosamine. In some embodiments, the targeting group is coupled to the sense strand of the FXII RNAi material disclosed herein.

[0103] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the sequence (5′→3′)usUfsusGfuAfcUfuAfuGfcUfcCfuUfgGfsc (SEQ ID NO: 404), wherein a, c, g and u are 2′-O-methyladenosine, cytidine, guanosine or uridine, respectively; Af, Cf, Gf and Uf are 2′-fluoroadenosine, cytidine, guanosine or uridine, respectively; and s is a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand.

[0104] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the sequence (5′→3′)usGfsgucuuUfcAfcUfuUfcuuggsusu (SEQ ID NO: 289), wherein a, c, g and u are 2′-O-methyladenosine, cytidine, guanosine or uridine, respectively; Af, Cf, Gf and Uf are 2′-fluoroadenosine, cytidine, guanosine or uridine, respectively; and s is a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand.

[0105] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the sequence (5′→3′)usAfsasGfcAfcUfuUfaUfuGfaGfuUfcCfsu (SEQ ID NO: 300), wherein a, c, g and u are 2′-O-methyladenosine, cytidine, guanosine or uridine, respectively; Af, Cf, Gf and Uf are 2′-fluoroadenosine, cytidine, guanosine or uridine, respectively; and s is a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand.

[0106] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the sequence (5′→3′)usUfsusCfaAfaGfcAfcUfuUfaUfuGfaGfsu (SEQ ID NO: 319), wherein a, c, g and u are 2′-O-methyladenosine, cytidine, guanosine or uridine, respectively; Af, Cf, Gf and Uf are 2′-fluoroadenosine, cytidine, guanosine or uridine, respectively; and s is a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand.

[0107] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the sequence (5′→3′)usUfscsAfaAfgCfaCfuUfuAfuUfgAfgUfsu (SEQ ID NO: 304), wherein a, c, g and u are 2′-O-methyladenosine, cytidine, guanosine or uridine, respectively; Af, Cf, Gf and Uf are 2′-fluoroadenosine, cytidine, guanosine or uridine, respectively; and s is a thiophosphate linkage, and the sense strand is at least substantially complementary to the antisense strand.

[0108] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the sequence (5′→3′)usUfsusGfuAfcUfuAfuGfcUfcCfuUfgGfsg (SEQ ID NO: 375), wherein a, c, g and u are 2′-O-methyladenosine, cytidine, guanosine or uridine, respectively; Af, Cf, Gf and Uf are 2′-fluoroadenosine, cytidine, guanosine or uridine, respectively; and s is a phosphorothioate linkage, and the sense strand is at least substantially complementary to the antisense strand.

[0109] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the sequence (5′→3′)usUfsgsUfaCfuUfaUfgCfuCfcUfuGfgusu (SEQ ID NO: 377), wherein a, c, g and u are 2′-O-methyladenosine, cytidine, guanosine or uridine, respectively; Af, Cf, Gf and Uf are 2′-fluoroadenosine, cytidine, guanosine or uridine, respectively; and s is a thiophosphate linkage, and the sense strand is at least substantially complementary to the antisense strand.

[0110] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the sequence (5′→3′)usUfsusGfuAfcUfuAfuGfcUfcCfuUfgGfsc (SEQ ID NO: 404), and the positive strand of the FXII RNAi agent comprises or consists of the sequence (5′→3′)(NAG37)gsccaaggaGfCfAfuaaguacaaas(invAb) (SEQ ID NO: 643), wherein a, c, g and u are 2′-O-methyladenosine, cytidine, guanosine or uridine, respectively; Af, Cf, Gf and Uf are 2′-fluoroadenosine, cytidine, guanosine or uridine, respectively; s is a thiophosphate linkage; (invAb) is an inverted abasic deoxyribose (invAb); and (NAG37) is a targeting ligand comprising N-acetyl-galactosamine having a structure shown in Table 7 herein.

[0111] In some embodiments, the antisense strand of the FXII RNAi substance comprises or consists of the sequence (5′→3′)usGfsgucuuUfcAfcUfuUfcuuggsusu (SEQ ID NO: 289), and the positive strand of the FXII RNAi substance comprises or consists of the sequence (5′→3′)(NAG25)sasaccaagaAfAfGfugaaagacc(invdA) (SEQ ID NO: 1277), wherein a, c, g and u are 2′-O-methyladenosine, cytidine, guanosine or uridine, respectively; Af, Cf, Gf and Uf are 2′-fluoroadenosine, cytidine, guanosine or uridine, respectively; s is a thiophosphate linkage; (invdA) is an inverted abasic deoxyribose (invdA); and (NAG25) is a targeting ligand comprising N-acetyl-galactosamine having a structure shown in Table 7 herein.

[0112] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the sequence (5′→3′)usAfsasGfcAfcUfuUfaUfuGfaGfuUfcCfsu (SEQ ID NO: 300), and the positive strand of the FXII RNAi agent comprises or consists of the sequence (5′→3′)(NAG25)sasggaacucAfAfUfaaagugcuuas(invAb) (SEQ ID NO: 519), wherein a, c, g and u are 2′-O-methyladenosine, cytidine, guanosine or uridine, respectively; Af, Cf, Gf and Uf are 2′-fluoroadenosine, cytidine, guanosine or uridine, respectively; s is a thiophosphate linkage; (invAb) is an inverted abasic deoxyribose (invAb); and (NAG25) is a targeting ligand comprising N-acetyl-galactosamine having a structure shown in Table 7 herein.

[0113] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the sequence (5′→3′)usUfsusCfaAfaGfcAfcUfuUfaUfuGfaGfsu (SEQ ID NO: 319), and the positive strand of the FXII RNAi agent comprises or consists of the sequence (5′→3′)(NAG25)sascucaauaAfAfGfugcuuugaaas(invAb) (SEQ ID NO: 526), ​​wherein a, c, g and u are 2′-O-methyladenosine, cytidine, guanosine or uridine, respectively; Af, Cf, Gf and Uf are 2′-fluoroadenosine, cytidine, guanosine or uridine, respectively; s is a thiophosphate linkage; (invAb) is an inverted abasic deoxyribose (invAb); and (NAG25) is a targeting ligand comprising N-acetyl-galactosamine having a structure shown in Table 7 herein.

[0114] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the sequence (5′→3′)usUfscsAfaAfgCfaCfuUfuAfuUfgAfgUfsu (SEQ ID NO: 304), and the positive strand of the FXII RNAi agent comprises or consists of (5′→3′)(NAG37)sasacucaauAfAfAfgugcuuugaas(invAb) (SEQ ID NO: 610), wherein a, c, g and u are 2′-O-methyladenosine, cytidine, guanosine or uridine, respectively; Af, Cf, Gf and Uf are 2′-fluoroadenosine, cytidine, guanosine or uridine, respectively; s is a thiophosphate linkage; (invAb) is an inverted abasic deoxyribose (invAb); and (NAG37) is a targeting ligand comprising N-acetyl-galactosamine having a structure shown in Table 7 herein.

[0115] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the sequence (5′→3′)usUfsusGfuAfcUfuAfuGfcUfcCfuUfgGfsg (SEQ ID NO: 375), and the positive strand of the FXII RNAi agent comprises or consists of the sequence (5′→3′)(NAG37)scsccaaggaGfCfAfuaaguacaaas(invAb) (SEQ ID NO: 611), wherein a, c, g and u are 2′-O-methyladenosine, cytidine, guanosine or uridine, respectively; Af, Cf, Gf and Uf are 2′-fluoroadenosine, cytidine, guanosine or uridine, respectively; s is a thiophosphate linkage; (invAb) is an inverted abasic deoxyribose (invAb); and (NAG37) is a targeting ligand comprising N-acetyl-galactosamine having a structure shown in Table 7 herein.

[0116] In some embodiments, the antisense strand of the FXII RNAi agent comprises or consists of the sequence (5′→3′)usUfsgsUfaCfuUfaUfgCfuCfcUfuGfgusu (SEQ ID NO: 377), and the sense strand of the FXII RNAi agent comprises or consists of the sequence (5′→3′)(NAG37)s(invAb)sccaaggAfGfCfauaaguacaauus(invAb) (SEQ ID NO: NO:613), wherein a, c, g and u are 2′-O-methyladenosine, cytidine, guanosine or uridine, respectively; Af, Cf, Gf and Uf are 2′-fluoroadenosine, cytidine, guanosine or uridine, respectively; s is a phosphorothioate linkage; (invAb) is an inverted abasic deoxyribose (invAb); and (NAG37) is a targeting ligand comprising N-acetyl-galactosamine having the structure shown in Table 7 herein.

[0117] In some embodiments, the FXII RNAi agents described herein may comprise one or more targeting groups having the structure: (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31) s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s, as defined in Table 7 herein.

[0118] In some embodiments, the FXII RNAi agent described herein comprises a targeting group at the 5′ end of the sense strand, wherein the targeting group has the structure: (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31 )s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s, as defined in Table 7 herein.

[0119] The FXII RNAi agents disclosed herein can be incorporated into a composition comprising one or more disclosed FXII RNAi agents and at least one pharmaceutically acceptable excipient. In some embodiments, the composition comprising one or more disclosed FXII RNAi agents and at least one pharmaceutically acceptable excipient disclosed herein is a pharmaceutical composition.

[0120] The pharmaceutical composition comprising one or more FXII RNAi substances can be administered in many ways, depending on whether local or systemic treatment is desired. Administration can be performed by any means known in the art, such as, but not limited to, intravenous, intraarterial, subcutaneous, intraperitoneal, subdermal (e.g., by implanted device) and intraparenchymal administration. In some embodiments, the pharmaceutical composition described herein is administered by subcutaneous injection.

[0121] In some embodiments, the composition comprising one or more disclosed FXII RNAi agents and at least one pharmaceutically acceptable excipient may further comprise one or more other therapeutics or treatments.

[0122] In some embodiments, the compositions described herein comprising one or more FXII RNAi agents are packaged in a kit, container, bag, dispenser, prefilled syringe, or vial. In some embodiments, the compositions described herein are administered parenterally.

[0123] FXII RNAi substances and compositions disclosed herein containing the same can be administered to a subject for treatment (including prophylactic treatment) of a pathological state (e.g., a condition or disease) mediated at least in part by FXII expression. Conditions or diseases that can be treated, prevented and / or controlled by administering FXII RNAi substances disclosed herein and compositions containing the same include HAE, AAE, ACE inhibitor-associated angioedema, allergic angioedema, INAE, idiopathic angioedema, thrombosis, VTE, thrombotic occlusive disease, and prevention of perioperative veno-occlusive disease.

[0124] As used herein, the terms "oligonucleotide" and "polynucleotide" refer to a polymer of linked nucleosides, each of which may be independently modified or unmodified.

[0125] As used herein, "RNAi material" (also referred to as "RNAi initiator") refers to a composition containing RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecules that can degrade or inhibit the translation of messenger RNA (mRNA) transcripts of target mRNA in a sequence-specific manner. The RNAi material used herein can be manipulated by an RNA interference mechanism (i.e., by inducing RNA interference by interacting with components of the RNA interference pathway of mammalian cells (RNA-induced silencing complex or RISC)), or by any other mechanism or pathway. Although it is believed that the term RNAi material as used herein is mainly manipulated by an RNA interference mechanism, the disclosed RNAi material is not limited to or constrained by any specific pathway or mechanism of action. The RNAi material disclosed herein comprises a sense strand and an antisense strand, and includes, but is not limited to, short interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), and a Dicer enzyme substrate. The antisense strand of the RNAi material disclosed herein is at least partially complementary to the targeted mRNA (e.g., FXII mRNA). The RNAi material may include one or more modified nucleotides and / or one or more non-phosphodiester linkages.

[0126] As used herein, the terms "silencing," "reducing," "inhibiting," "downregulating," or "knockdown," when referring to the expression of a given gene, mean that the expression of the gene is reduced when the cell, cell population, or tissue is treated with an RNAi agent as described herein, as measured by the level of RNA transcribed from the gene or the level of a polypeptide, protein, or protein subunit translated from mRNA in a cell, cell population, tissue, or subject in which the gene is transcribed, compared to a second cell, cell population, or tissue that has not been so treated.

[0127] The terms "sequence" and "nucleotide sequence" as used herein refer to the order or sequence of nucleobases or nucleotides described by a sequence of letters using standard nomenclature.

[0128] As used herein, "base", "nucleotide base" or "nucleobase" is a heterocyclic pyrimidine or purine compound that is a standard component of all nucleic acids and includes bases that form adenosine (A), guanosine (G), cytidine (C), thymidine (T) and uracil (U). Nucleobases can be further modified to include, but are not limited to, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases and fluorobases. The term "nucleotide" as used herein may include modified nucleotides (e.g., nucleotide mimetics, abasic residues (Ab) or alternative substitution moieties.

[0129] As used herein and unless otherwise indicated, the term "complementary" is used to describe a first nuclear base or nucleotide sequence (e.g., RNAi material positive strand or targeting mRNA) relative to a second nuclear base or nucleotide sequence (e.g., RNAi material antisense strand or single-stranded antisense oligonucleotide), indicating that an oligonucleotide or polynucleotide comprising a first nucleotide sequence hybridizes (forms base pair hydrogen bonds under mammalian physiological conditions (or similar in vitro environments)) and forms a duplex or double helix structure under specific conditions with an oligonucleotide or polynucleotide comprising a second nucleotide sequence. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs, and include natural or modified nucleotides or nucleotide mimetics, at least to the extent that the above hybridization requirements are met. Sequence identity or complementarity is independent of modification. For example, for the purpose of identifying identity or complementarity, a and Af defined herein are complementary to U (or T) and identical to A.

[0130] As used herein, "perfect complementarity" or "complete complementarity" means that all (100%) of the nucleobases or nucleotides in the contiguous sequence of the first polynucleotide will hybridize to the same number of nucleobases or nucleotides in the contiguous sequence of the second polynucleotide. The contiguous sequence may include all or part of the first or second polynucleotide sequence.

[0131] As used herein, "partial complementarity" means that in a hybridizing pair of nucleobase sequences, at least 70% (but not all) of the bases in a contiguous sequence of a first polynucleotide will hybridize to the same number of bases in a contiguous sequence of a second polynucleotide.

[0132] As used herein, "substantially complementary" means that in a hybridization pair of nucleobase sequences, at least 85% (but not all) of the bases in the contiguous sequence of the first polynucleotide will hybridize to the same number of bases in the contiguous sequence of the second polynucleotide. The terms "complementary", "fully complementary", "partially complementary" and "substantially complementary" as used herein are used with respect to the nucleobases or nucleotides that match between the sense and antisense strands of an RNAi agent or between the antisense strand of an RNAi agent and the sequence of FXII mRNA.

[0133] As used herein, the term "substantially identical" or "substantially identical" for nucleic acid sequences means comprising nucleic acid sequences having at least about 85% sequence identity or more (e.g., at least 90%, at least 95%, or at least 99%) compared to a reference sequence. The percentage of sequence identity is determined by comparing the two optimally aligned sequences in the comparison window. The percentage is calculated as follows: the number of matching positions is generated by determining the number of positions where the same nucleic acid base appears in the two sequences, the number of matching positions is divided by the total number of positions in the comparison window, and the result is multiplied by 100 to generate the percentage of sequence identity. The invention disclosed herein encompasses nucleotide sequences that are substantially identical to those disclosed herein.

[0134] As used herein, the terms "treat," "treatment," and the like refer to methods or steps taken to provide relief or lessen the amount, severity, and / or frequency of symptoms of one or more diseases in a subject. As used herein, "treat" and "treatment" may include preventing, controlling, prophylactic treatment, and / or inhibiting the amount, severity, and / or frequency of symptoms of one or more diseases in a subject.

[0135] As used herein, when referring to RNAi substances, the phrase "introducing into cells" means functional delivery of RNAi substances into cells. The phrase "functional delivery" means delivering RNAi substances to cells in such a manner that the RNAi substances have the desired biological activity, for example, sequence-specific inhibition of gene expression.

[0136] Unless otherwise specified, the symbols used in this article are It means that it can be linked to one or more any groups according to the scope of the invention described herein.

[0137] As used herein, the term "isomer" refers to compounds that have the same molecular formula but differ in the nature or sequence of bonding of their atoms or in the spatial arrangement of their atoms. Isomers that differ in the spatial arrangement of their atoms are called "stereoisomers". Stereoisomers that are not mirror images of each other are called "diastereomers", and isomers that are non-superimposable mirror images are called "enantiomers" or sometimes optical isomers. A carbon atom to which four non-identical substituents are attached is called a "chiral center".

[0138] As used herein, unless a certain configuration is specifically indicated in the structure, for each structure where an asymmetric center exists and thus produces enantiomers, diastereomers or other stereoisomeric configurations, each structure disclosed herein is intended to represent all such possible isomers, including optically pure and racemic forms thereof. For example, the structures disclosed herein are intended to include mixtures of diastereomers as well as single stereoisomers.

[0139] The phrase "consisting of" as used in the claims herein excludes any elements, steps or ingredients not specified in the claim. When used in the claims herein, the phrase "consisting essentially of" limits the scope of the claim to the specified materials or steps and those that do not materially affect the basic and novel characteristics of the claimed invention.

[0140] Depending on the environment in which the compound or composition is located, one of ordinary skill in the art will readily understand and appreciate that the compounds and compositions disclosed herein may have certain atoms (e.g., N, O, or S atoms) in a protonated or deprotonated state. Thus, as used herein, it is contemplated that certain functional groups, such as OH, SH, or NH, of the structures disclosed herein may be protonated or deprotonated. As one of ordinary skill in the art will readily appreciate, the disclosure herein is intended to encompass the disclosed compounds and compositions, regardless of their protonation state based on the environment (e.g., pH).

[0141] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those generally understood by those of ordinary skill in the art. Although methods and materials similar to or equivalent to those described herein may be used in the implementation or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents and other references mentioned herein are incorporated herein by reference in their entirety. In the event of a conflict, this specification (including definitions) shall prevail. In addition, materials, methods and embodiments are illustrative only and are not intended to be limiting.

[0142] Other objects, features, aspects and advantages of the present invention will become apparent from the following detailed description, the accompanying drawings and from the claims. BRIEF DESCRIPTION OF THE DRAWINGS

[0143] Figure 1 . Shows knockdown in mice treated with a single subcutaneous dose of 3 mg / kg FXII RNAi agent AD03632 on day 1 compared to mice treated with saline. Standard error of the mean is shown as error bars plotted on the mean.

[0144] Figure 2. Shows knockdown in mice treated with (i) a single subcutaneous dose of 0.6 mg / kg FXII RNAi agent AD03632 (dashed line with triangles); (ii) a single subcutaneous dose of 2 mg / kg FXII RNAi agent AD03632 (solid line with triangles); and (iii) saline (solid line with circles). Standard deviations are shown as error bars on the mean.

[0145] Figure 3 . Shows a graph of knockdown in mice treated with (i) 0.6 mg / kg FXII RNAi agent AD03632 subcutaneously once a week starting from day 1 for 6 consecutive weeks (dashed line with squares); (ii) 2 mg / kg FXII RNAi agent AD03632 subcutaneously once a week starting from day 1 for 6 consecutive weeks (solid line with squares); and (iii) saline (solid line with circles). The standard error of the mean is shown as error bars drawn on the mean.

[0146] Figure 4 Graph showing FXII serum levels in rats treated on day 1 with a single subcutaneous dose of (i) saline; (ii) heparin (1000 U / kg, administered at the time of intubation); (iii) 1 mg / kg FXII RNAi agent AD03224; or (iv) 3 mg / kg FXII RNAi agent AD03224.

[0147] Figure 5 . Shown is the clot weight (in mg) from the arteriovenous shunt model in rats on day 14 following administration of a single subcutaneous dose of (i) saline; (ii) heparin; (iii) 1 mg / kg FXII RNAi agent AD03224; or (iv) 3 mg / kg FXII RNAi agent AD03224 on day 1. DETAILED DESCRIPTION

[0148] RNAi substances

[0149] RNAi materials (referred to herein as FXII RNAi materials or FXII RNAi initiators) for suppressing factor FXII gene expression are described herein. Each FXII RNAi material comprises a sense strand and an antisense strand. The length of the sense and antisense strands can be 16-30 nucleotides respectively. In some embodiments, the length of the sense and antisense strands can be 17-26 nucleotides respectively. The length of the sense and antisense strands can be the same or they can be different. In some embodiments, the length of the sense and antisense strands is 17-21 nucleotides each independently. In some embodiments, the length of the sense and antisense strands is 21-26 nucleotides each. In some embodiments, the length of the sense and antisense strands is 21-24 nucleotides each. In some embodiments, the length of the sense strand is about 19 nucleotides, and the length of the antisense strand is about 21 nucleotides. In some embodiments, the length of the sense strand is about 21 nucleotides, and the length of the antisense strand is about 23 nucleotides. In some embodiments, the length of the sense strand is 23 nucleotides, and the length of the antisense strand is 21 nucleotides. In some embodiments, the length of sense and antisense strands is 21 nucleotides each. In some embodiments, the length of sense strand is 22 nucleotides, and the length of antisense strand is 21 nucleotides. In some embodiments, the length of sense strand is 19 nucleotides, and the length of antisense strand is 21 nucleotides. In some embodiments, the length of RNAi material sense and antisense strand is 17, 18, 19, 20, 21, 22, 23, 24, 25 or 26 nucleotides each independently. In some embodiments, double-stranded RNAi material has a duplex having a length of about 16, 17, 18, 19, 20, 21, 22, 23 or 24 nucleotides.

[0150] In some embodiments, the region of perfect or substantial complementarity between the sense and antisense strands is typically 16-26 (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26) nucleotides in length and occurs at or near the 5′ end of the antisense strand (e.g., the region may be separated from the 5′ end of the antisense strand by 0, 1, 2, 3, or 4 nucleotides that are not perfectly or substantially complementary).

[0151] The sense strand and the antisense strand each comprise a core segment sequence of 16-23 nucleobases in length. The antisense strand core segment sequence is 100% (perfect) complementary or at least about 85% (substantially) complementary to a nucleotide sequence present in the FXII mRNA target (sometimes referred to as, for example, a target sequence). The sense strand core segment sequence is 100% (perfect) complementary or has at least about 85% (substantially) complementarity with the core segment sequence in the antisense strand, so that the sense strand core segment sequence is perfectly identical or at least about 85% identical to the nucleotide sequence (target sequence) present in the FXII mRNA target. The sense strand core segment sequence can be the same length as the corresponding antisense core segment sequence or it can be a different length. In some embodiments, the length of the antisense strand core segment sequence is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides. In some embodiments, the length of the sense strand core segment sequence is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides.

[0152] Examples of nucleotide sequences for forming FXII RNAi agents are provided in Tables 2, 3, 4, and 6. Table 5 shows examples of FXII RNAi agent duplexes comprising the sense and antisense strand sequences in Tables 2, 3, 4, and 5.

[0153] The sense and antisense strands of the FXII RNAi substance are usually annealed to form a duplex. The sense and antisense strands of the FXII RNAi substance can be partially, substantially or completely complementary to each other. In the complementary duplex region, the sense strand core segment sequence has at least 85% complementarity or 100% complementarity with the antisense strand core segment sequence. In some embodiments, the sense strand core segment sequence comprises a sequence of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22 or at least 23 nucleotides corresponding to the antisense strand core sequence (i.e., the sense and antisense core sequences of the FXII RNAi substance have a region of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22 or at least 23 nucleotides with at least 85% base pairing or 100% base pairing).

[0154] In some embodiments, the antisense strand of the FXII RNAi agent disclosed herein differs from any antisense strand sequence in Table 2 or Table 3 by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of the FXII RNAi agent disclosed herein differs from any sense strand sequence in Table 2 or Table 4 by 0, 1, 2, or 3 nucleotides.

[0155] In some embodiments, the antisense strand of the FXII RNAi agent disclosed herein differs from any antisense strand sequence in Table 6 by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of the FXII RNAi agent disclosed herein differs from any sense strand sequence in Table 6 by 0, 1, 2, or 3 nucleotides.

[0156] The sense strand and / or antisense strand may optionally and independently contain an additional 1, 2, 3, 4, 5 or 6 nucleotides (extensions) at the 3' end, 5' end, or both the 3' and 5' ends of the core segment sequence. The other nucleotides of the antisense strand, if present, may or may not be complementary to the corresponding sequence in the FXII mRNA. The other nucleotides of the sense strand, if present, may or may not be identical to the corresponding sequence in the FXII mRNA. The other nucleotides of the antisense strand, if present, may or may not be complementary to the other nucleotides of the corresponding sense strand (if present).

[0157] As used herein, extension is included in 1,2,3,4,5 or 6 nucleotides at the 5' and / or 3' ends of the sense strand core segment sequence and / or the antisense strand core segment sequence. The extended nucleotides on the sense strand may or may not be complementary to the nucleotides in the corresponding antisense strand (whether it is a core segment sequence nucleotide or an extended nucleotide). On the contrary, the extended nucleotides on the antisense strand may or may not be complementary to the nucleotides in the corresponding sense strand (whether it is a core segment sequence nucleotide or an extended nucleotide). In some embodiments, the sense strand and antisense strand of RNAi material include 3' and 5' extensions. In some embodiments, one or more 3' extension nucleotides of a chain are paired with one or more 5' extension nucleotides of another chain. In other embodiments, one or more 3' extension nucleotides of a chain are not paired with one or more 5' extension nucleotides of another chain. In some embodiments, the antisense strand of FXII RNAi material has a 3' extension and its sense strand has a 5' extension.

[0158] In some embodiments, the FXII RNAi agent comprises an antisense strand having a 3′ extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In other embodiments, the FXII RNAi agent comprises an antisense strand having a 3′ extension of 1, 2, or 3 nucleotides in length. In some embodiments, one or more antisense strand extension nucleotides comprise uracil or thymine nucleotides or nucleotides complementary to the corresponding FXII mRNA sequence. In some embodiments, the 3′ antisense strand extension comprises or consists of any of the following sequences, but is not limited to: AUA, UGCUU, CUG, UG, UGCC, CUGCC, CGU, CUU, UGCCUA, CUGCCU, UGCCU, UGAUU, GCCUAU, T, TT, U, UU (each shown as 5′→3′).

[0159] In some embodiments, the 3' end of the antisense strand may contain other abasic residues (Ab). "Abasic residues" or "abasic sites" are nucleotides or nucleosides that lack a nucleobase at the 1' position of the sugar. In some embodiments, Ab or AbAb may be added to the 3' end of the antisense strand. In some embodiments, one or more abasic residues may be added to the reverse abasic deoxyribose residues (invAb) (see Table 7), (see, e.g., F. Czauderna, Nucleic Acids Res., 2003, 31 (11), 2705-16).

[0160] In some embodiments, the FXII RNAi agent comprises a 3' extended sense strand having a length of 1, 2, 3, 4 or 5 nucleotides. In some embodiments, one or more sense strand extension nucleotides comprise adenosine, uracil or thymine nucleotides, AT dinucleotides, or nucleotides corresponding to nucleotides in the FXII mRNA sequence. In some embodiments, the 3' sense strand extension comprises or consists of any of the following sequences, but is not limited to: T, UT, TT, UU, UUT, TTT or TTTT (each shown as 5'-3').

[0161] In some embodiments, the 3' end of the sense strand may include other abasic residues (Ab). In some embodiments, UUAb, UAb or Ab are added to the 3' end of the sense strand. In some embodiments, one or more abasic residues added to the 3' end of the sense strand are reverse (invAb). In some embodiments, one or more reverse abasic residues or abasic sites can be inserted between the core base sequence of the targeting ligand and the sense strand of the RNAi substance. In some embodiments, one or more reverse abasic residues or abasic sites at or near one or more ends of the sense strand of the RNAi substance can enhance the activity or other desired characteristics of the RNAi substance.

[0162] In some embodiments, the FXII RNAi agent comprises a sense strand having a 5' extension of 1, 2, 3, 4, 5 or 6 nucleotides in length. In some embodiments, one or more sense strand extension nucleotides comprise uracil or adenosine nucleotides or nucleotides corresponding to nucleotides in the FXII mRNA sequence. In some embodiments, the sense strand 5' extension comprises or consists of any of the following sequences, but is not limited to: CA, AUAGGC, AUAGG, AUAG, AUA, A, AA, AC, GCA, GGCA, GGC, UAUCA, UAUC, UCA, UAU, U, UU (each shown as 5'-3'). The sense strand may have a 3' extension and / or a 5' extension.

[0163] In some embodiments, the 5' end of the sense strand may include one or more other abasic residues (e.g., (Ab) or (AbAb)). In some embodiments, the one or more abasic residues added to the 5' end of the sense strand may be reversed (e.g., invAb). In some embodiments, one or more reverse abasic residues may be inserted between the targeting ligand and the nucleobase sequence of the sense strand of the RNAi substance. In some embodiments, the inclusion of one or more reverse abasic residues at or near one or more ends of the sense strand of the RNAi substance can enhance the activity or other desired properties of the RNAi substance. In some embodiments, abasic (deoxyribose) residues may be substituted with ribitol (abasic ribose) residues.

[0164] In some embodiments, the 3′ end of the antisense strand core sequence or the 3′ end of the antisense strand sequence may contain an inverted abasic residue (invAb (see Table 7)).

[0165] Examples of sequences for forming FXII RNAi substances are provided in Tables 2, 3, 4, and 6. In some embodiments, the FXII RNAi substance antisense strand comprises a sequence shown in any of the sequences in Tables 2, 3, or 6. In some embodiments, the FXII RNAi substance antisense strand comprises a sequence shown in nucleotides (from 5' end → 3' end) 1-17, 2-15, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, 2-24, 1-25, 2-25, 1-26, or 2-26 of any of the sequences in Tables 2, 3, or 4. In certain embodiments, the FXII RNAi substance antisense strand comprises or consists of a modified sequence shown in any of the modified sequences in Table 4. In some embodiments, the FXII RNAi substance positive strand comprises a sequence shown in any of the sequences in Tables 2, 3, or 5. In some embodiments, the sense strand of the FXII RNAi agent comprises nucleotides (from 5' end → 3' end) 1-18, 1-19, 1-20, 1-21, 1-22, 1-23, 1-24, 1-25, 1-26, 2-19, 2-20, 2-21, 2-22, 2-23, 2-24, 2-25, 2-26, 3-20, 3-21, 3-22, 3-23, 3-24, 3-25, 3-26, 4-21, 4-22, 4-23, 4-24, 4-25, 4-26, 5-22, 5-23, 5-24, 5-25, 5-26, 6-23, 6-24, 6-25, 2-26, 7-24, 7-25, or 7-26 of any one of the sequences in Tables 2, 4 or 6. In certain embodiments, the sense strand of the FXII RNAi agent comprises or consists of a modified sequence as shown in any one of the modified sequences in Table 5.

[0166] In some embodiments, the sense and antisense strands of the RNAi material described herein contain the same number of nucleotides. In some embodiments, the sense and antisense strands of the RNAi material described herein contain different numbers of nucleotides. In some embodiments, the sense strand 5' end and the antisense strand 3' end of the RNAi material form a blunt end. In some embodiments, the sense strand 3' end and the antisense strand 5' end of the RNAi material form a blunt end. In some embodiments, both ends of the RNAi material form a blunt end. In some embodiments, neither end of the RNAi material is a blunt end. Blunt ends used herein refer to such ends of double-stranded RNAi materials, in which the terminal nucleotides of the two annealed chains are complementary (forming complementary base pairs).

[0167] In some embodiments, the 5′ end of the sense strand of the RNAi agent and the 3′ end of the antisense strand form a frayed end. In some embodiments, the 3′ end of the sense strand of the RNAi agent and the 5′ end of the antisense strand form a frayed end. In some embodiments, both ends of the RNAi agent form frayed ends. In some embodiments, neither end of the RNAi agent is a frayed end. As used herein, a frayed end refers to an end of a double-stranded RNAi agent in which the terminal nucleotides of the two annealed chains form a pair (i.e., do not form an overhang) but are not complementary (i.e., form a non-complementary pair). As used herein, an overhang is an extension of one or more unpaired nucleotides located at the end of one strand of a double-stranded RNAi agent. The unpaired nucleotides can be located at the sense strand or the antisense strand, producing a 3′ or 5′ overhang. In some embodiments, the RNAi agent comprises: a blunt end and a frayed end, a blunt end and a 5' overhang, a blunt end and a 3' overhang, a frayed end and a 5' overhang, a frayed end and a 3' overhang, two 5' overhangs, two 3' overhangs, a 5' overhang and a 3' overhang, two frayed ends, or two blunt ends.

[0168] When modified nucleotides are used in various polynucleotides or oligonucleotide constructs, they can maintain the activity of the compounds in cells while increasing the serum stability of these compounds, and can also minimize the possibility of activating interferon activity in humans after administration of the polynucleotides or oligonucleotide constructs.

[0169] In some embodiments, the FXII RNAi substance is prepared or provided in the form of a salt, a mixed salt or a free acid. In some embodiments, the FXII RNAi substance is prepared as a sodium salt. Such forms are within the scope of the invention disclosed herein.

[0170] Modified nucleotides

[0171] In some embodiments, the FXII RNAi substance comprises one or more modified nucleotides. As used herein, "modified nucleotides" are nucleotides other than ribonucleotides (2'-hydroxy nucleotides). In some embodiments, at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99% or 100%) of the nucleotides are modified nucleotides. As used herein, modified nucleotides include, but are not limited to, deoxyribonucleotides, nucleotide mimics, abasic nucleotides (represented herein as Ab), 2'-modified nucleotides, 3' to 3' connection (reverse) nucleotides (represented herein as invdN, invN, invn), nucleotides containing modified nucleobases, bridged nucleotides, peptide nucleic acids (PNA), 2', 3'-open ring nucleotide mimics (2', 3'-seco nucleotide mimics) (unlocked nucleobase analogs, represented herein as N UNA or NUNA), locked nucleotides (herein referred to as N LNA or NLNA), 3′-O-methoxy (2′ internucleoside linked) nucleotides (represented herein as 3′-OMen), 2′-F-arabinonucleotides (represented herein as NfANA or NfA NA 2′-modified nucleotides (i.e., nucleotides having a group other than a hydroxyl group at the 2′ position of the five-membered sugar ring) include, but are not limited to, 2′-O-methyl nucleotides (represented herein by the lowercase letter “n” in the nucleotide sequence), 2′-deoxy-2′-fluoro nucleotides (represented herein by Nf, also represented herein by 2′-fluoro nucleotides), 2′-deoxy nucleotides (represented herein by dN), 2′-methoxyethyl (2′-O-2-methoxyethyl) nucleotides (represented herein by NM or 2′-MOE), 2′-amino nucleotides and 2′-alkyl nucleotides. It is not necessary to uniformly modify all positions in a given compound. Instead, more than one modification may be incorporated into a single FXII RNAi substance or even a single nucleotide thereof. The sense strand and antisense strand of the FXII RNAi agent can be synthesized and / or modified by methods known in the art. The modification on one nucleotide is independent of the modification on another nucleotide.

[0172] Modified nucleobases include synthetic and natural nucleobases, such as: 5-substituted pyrimidines, 6-azapyrimidines, N-2, N-6 and O-6 substituted purines (e.g., 2-aminopropyladenine, 5-propynyluracil or 5-propynylcytosine), 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, inosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl (e.g., 6-methyl, 6-ethyl, 6-isopropyl, or 6-n-butyl) derivatives of adenine and guanine, 2-propyl (e.g., 2-methyl, 2-ethyl, 2-isopropyl, or 2-n-butyl) and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine, 2-thiocytosine, 5-halogenated Uracil, cytosine, 5-propynyluracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thio, 8-thioalkyl, 8-hydroxy and other 8-substituted adenines and guanines, 5-halo (e.g., 5-bromo), 5-trifluoromethyl, and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, and 3-deazaadenine.

[0173] In some embodiments, the nucleotides of all or substantially all RNAi materials are modified nucleotides. As used herein, the RNAi materials wherein substantially all nucleotides present are modified nucleotides are RNAi materials having 4 or less (i.e., 0, 1, 2, 3 or 4) nucleotides in the (i.e., unmodified) sense strand and antisense strand as ribonucleotides. As used herein, the sense strand wherein substantially all nucleotides present are modified nucleotides are sense strands having 2 or less (i.e., 0, 1 or 2) nucleotides in the sense strand as ribonucleotides. As used herein, the antisense strand wherein substantially all nucleotides present are modified nucleotides are antisense strands having 2 or less (i.e., 0, 1 or 2) nucleotides in the sense strand as ribonucleotides. In some embodiments, one or more nucleotides of RNAi materials are ribonucleotides.

[0174] Modified internucleoside linkages

[0175] In some embodiments, one or more nucleotides of the FXII RNAi agent are linked by a non-standard linkage or backbone (i.e., a modified internucleoside linkage or modified backbone). Modified internucleoside linkages or backbones include, but are not limited to, 5'-phosphorothioate groups (represented herein by lowercase "s"), chiral phosphorothioates, phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, alkylphosphonates (e.g., methylphosphonates or 3'-alkenylphosphonates), chiral phosphonates, phosphinates, phosphoramidates (e.g., 3'-aminophosphoramidates, aminoalkylphosphoramidates, thiophosphoramidates), thioalkylphosphonates, thioalkylphosphotriesters, morpholino linkages, borophosphates with normal 3'-5' linkages, analogs of borophosphates 2'-5' linkages, or borophosphates with inverted polarity, wherein adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. In some embodiments, the internucleoside of modification is connected or the main chain lacks phosphorus atom.The internucleoside of modification lacking phosphorus atom is connected or the main chain includes but is not limited to: short chain alkyl or cycloalkyl sugar is connected, mixed heteroatoms and alkyl or cycloalkyl sugar are connected or one or more short chain heteroatoms or heterocyclic sugar are connected.In some embodiments, the internucleoside main chain of modification includes but is not limited to: siloxane main chain, sulfide main chain, sulfoxide main chain, sulfone main chain, formacetyl (formacetyl) and thioformyl main chain, methylene formacetyl and thioformyl acetyl main chain, containing alkene main chain, aminosulfonate main chain, methylene imino and methylene hydrazine main chain, sulfonate and sulfonamide main chain, amide main chain and have mixed N, O, S and CH2 other main chains of component.

[0176] In some embodiments, the sense strand of the FXII RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, the antisense strand of the FXII RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, or the sense strand and the antisense strand can independently contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages. In some embodiments, the sense strand of the FXII RNAi agent can contain 1, 2, 3, or 4 phosphorothioate linkages, the antisense strand of the FXII RNAi agent can contain 1, 2, 3, or 4 phosphorothioate linkages, or the sense strand and the antisense strand can independently contain 1, 2, 3, or 4 phosphorothioate linkages.

[0177] In some embodiments, the FXII RNAi material sense strand contains at least 2 phosphorothioate nucleoside linkages. In some embodiments, at least 2 phosphorothioate nucleoside linkages are located between nucleotides at the 3' end position 1-3 of the sense strand. In some embodiments, at least 2 phosphorothioate nucleoside linkages are located between nucleotides at the 5' end position 1-3, 2-4, 3-5, 4-6, 4-5 or 6-8 of the sense strand. In some embodiments, the FXII RNAi material antisense strand contains 4 phosphorothioate nucleoside linkages. In some embodiments, 4 phosphorothioate nucleoside linkages are located between nucleotides at the 5' end position 1-3 of the antisense strand and between nucleotides at the 5' end position 19-21, 20-22, 21-23, 22-24, 23-25 ​​or 24-26. In some embodiments, the FXII RNAi material contains at least 2 phosphorothioate nucleoside linkages in the sense strand and 3 or 4 phosphorothioate nucleoside linkages in the antisense strand.

[0178] In some embodiments, the FXII RNAi agent comprises one or more modified nucleotides and one or more modified phosphorothioate internucleoside linkages. In some embodiments, 2' modified nucleotides are combined with modified internucleoside linkages.

[0179] FXII RNAi Substances

[0180] In some embodiments, the FXII RNAi agents disclosed herein target the FXII gene at or near the FXII sequence position shown in Table 1. In some embodiments, the antisense strand of the FXII RNAi agents disclosed herein comprises a core segment sequence that is completely, substantially, or at least partially complementary to the target FXII 19-mer sequence disclosed in Table 1.

[0181] Table 1. FXII 19-mer mRNA target sequence (derived from human coagulation factor XII (F12) cDNA, GenBank NM_000505.3 (SEQ ID NO: 1))

[0182]

[0183]

[0184] In some embodiments, the FXII RNAi agent comprises an antisense strand, wherein position 19 (5′→3′) of the antisense strand is capable of forming a base pair with position 1 of a 19-mer target sequence disclosed in Table 1. In some embodiments, the FXII RNAi agent comprises an antisense strand, wherein position 1 (5′→3′) of the antisense strand is capable of forming a base pair with position 19 of a 19-mer target sequence disclosed in Table 1.

[0185] In some embodiments, the FXII RNAi agent comprises an antisense strand, wherein position 2 (5′→3′) of the antisense strand is capable of forming a base pair with position 18 of the 19-mer target sequence disclosed in Table 1. In some embodiments, the FXII RNAi agent comprises an antisense strand, wherein positions 2 to 18 (5′→3′) of the antisense strand are capable of forming a base pair with each corresponding complementary base located at positions 18 to 2 of the 19-mer target sequence disclosed in Table 1.

[0186] For the RNAi substances disclosed herein, the nucleotide at position 1 of the antisense strand (from 5' end → 3' end) may be perfectly complementary to the FXII gene, or may not be complementary to the FXII gene. In some embodiments, the nucleotide at position 1 of the antisense strand (from 5' end → 3' end) is U, A or dT. In some embodiments, the nucleotide at position 1 of the antisense strand (from 5' end → 3' end) forms an A:U or U:A base pair with the sense strand.

[0187] In some embodiments, the antisense strand of the FXII RNAi agent comprises a sequence of nucleotides 2-18 or 2-19 (from 5' end → 3' end) of any antisense strand sequence in Table 2, Table 3 or Table 6. In some embodiments, the positive strand of the FXII RNAi agent comprises a sequence of nucleotides 1-17, 1-18 or 2-18 (from 5' end → 3' end) of any positive strand sequence in Table 2, Table 4 or Table 6.

[0188] In some embodiments, the FXII RNAi substance comprises: (i) an antisense strand comprising a sequence of nucleotides 2-18 or 2-19 (from 5′ end → 3′ end) of any antisense strand sequence in Table 2, Table 3 or Table 6, and (ii) a sense strand comprising a sequence of nucleotides 1-17 or 1-18 (from 5′ end → 3′ end) of any sense strand sequence in Table 2, Table 4 or Table 6.

[0189] In some embodiments, the FXII RNAi agent comprises the core 19-mer nucleotide sequence shown in Table 2 below.

[0190] Table 2. Example F12 RNAi material antisense strand and sense strand core segment base sequence (N = any nucleobase)

[0191]

[0192]

[0193]

[0194] The sense and antisense strands of the FXII RNAi agent comprising or consisting of the nucleotide sequence in Table 2 may be modified nucleotides or unmodified nucleotides. In some embodiments, the sense and antisense strands of the FXII RNAi agent comprising or consisting of the nucleotide sequence in Table 2 are all or substantially all modified nucleotides.

[0195] In some embodiments, the antisense strand of the FXII RNAi agent disclosed herein differs from any antisense strand sequence in Table 2 by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of the FXII RNAi agent disclosed herein differs from any sense strand sequence in Table 2 by 0, 1, 2, or 3 nucleotides.

[0196] As used herein, each N in the disclosed sequences listed in Table 2 can be selected independently. In some embodiments, the N nucleotides in the disclosed sequences listed in Table 2 have such a core base that is complementary to the N nucleotides in the corresponding position on the other chain. In some embodiments, the N nucleotides in the disclosed sequences listed in Table 2 have such a core base that is not complementary to the N nucleotides in the corresponding position on the other chain. In some embodiments, the N nucleotides in the disclosed sequences listed in Table 2 have such a core base that is identical to the N nucleotides in the corresponding position on the other chain. In some embodiments, the N nucleotides in the disclosed sequences listed in Table 2 have such a core base that is different from the N nucleotides in the corresponding position on the other chain.

[0197] Tables 3 and 4 provide certain modified FXII RNAi material sense strands and antisense strands. The modified FXII RNAi material antisense strands and their potential unmodified nucleobase sequences are provided in Table 3. The modified FXII RNAi material sense strands and their potential unmodified sequences are provided in Table 4. In forming the FXII RNAi material, each nucleotide in each potential base sequence listed in Tables 3 and 4 and Table 2 above can be a modified nucleotide.

[0198] The FXII RNAi agent described herein is formed by annealing the antisense strand to the sense strand. A sense strand containing a sequence listed in Table 2, Table 3 or Table 6 can hybridize with any antisense strand containing a sequence listed in Table 2, Table 4 or Table 6, provided that the two sequences have a region of at least 85% complementarity over a continuous 16, 17, 18, 19, 20 or 21 nucleotide sequence.

[0199] In some embodiments, the antisense strand of the FXII RNAi agent comprises a nucleotide sequence shown in any one of Table 2, Table 3 or Table 6.

[0200] In some embodiments, the FXII RNAi agent comprises or consists of a duplex having a nucleobase sequence of a sense strand and an antisense strand of any sequence in Table 2, Table 3, Table 4 or Table 6.

[0201] Examples of antisense strands containing modified nucleotides are provided in Table 3. Examples of sense strands containing modified nucleotides are provided in Table 4.

[0202] As used in Tables 3 and 4, the following notations are used to indicate modified nucleotides, targeting groups, and linking groups. It is readily understood by one of ordinary skill in the art that, unless otherwise indicated by sequence, when present in an oligonucleotide, the monomers are interconnected by 5'-3'-phosphodiester bonds.

[0203] A = adenosine-3'-phosphate;

[0204] C = cytidine-3′-phosphate;

[0205] G = guanosine-3'-phosphate;

[0206] U = Uridine-3'-phosphate

[0207] n = any 2'-OMe modified nucleotide

[0208] a=2'-O-methyladenosine-3'-phosphate

[0209] as=2'-O-methyladenosine-3'-phosphorothioate

[0210] c=2'-O-methylcytidine-3'-phosphate

[0211] cs = 2'-O-methylcytidine-3'-phosphorothioate

[0212] g = 2'-O-methylguanosine-3'-phosphate

[0213] gs = 2'-O-methylguanosine-3'-phosphorothioate

[0214] t=2'-O-methyl-5-methyluridine-3'-phosphate

[0215] ts = 2'-O-methyl-5-methyluridine-3'-phosphorothioate

[0216] u=2'-O-methyluridine-3'-phosphate

[0217] us = 2'-O-methyluridine-3'-phosphorothioate

[0218] Nf = any 2'-fluorine modified nucleotide

[0219] Af = 2'-fluorocytidine-3'-phosphate

[0220] Afs = 2'-fluoroadenosine-3'-phosphorothioate

[0221] Cf = 2'-fluorocytidine-3'-phosphate

[0222] Cfs = 2'-fluorocytidine-3'-phosphorothioate

[0223] Gf = 2'-fluoroguanosine-3'-phosphate

[0224] Gfs = 2'-fluoroguanosine-3'-phosphorothioate

[0225] Tf = 2'-fluoro-5'-methyluridine-3'-phosphate

[0226] Tfs = 2'-fluoro-5'-methyluridine-3'-phosphorothioate

[0227] Uf = 2'-fluorocytidine-3'-phosphate

[0228] Ufs = 2'-fluorocytidine-3'-phosphorothioate

[0229] dN = any 2'-deoxyribonucleotide

[0230] dT = 2'-deoxythymidine-3'-phosphate

[0231] N UNA =2',3'-open ring nucleotide analog (unlocked nucleobase analog)-3'-phosphate

[0232] N UNA s = 2', 3'-open ring nucleotide mimetic (unlocked nucleobase analog) -3'-phosphorothioate

[0233] U UNA =2',3'-open-Uridine-3'-phosphate

[0234] U UNA s = 2',3'-open-uridine-3'-phosphorothioate

[0235] a_2N = See Table 7

[0236] a_2Ns = see Table 7

[0237] pu_2N = See Table 7

[0238] pu_2Ns = see Table 7

[0239] Npu = See Table 7

[0240] Nus = See Table 7

[0241] N LNA = locked nucleotide

[0242] Nf ANA =2′-F-arabinose nucleotide

[0243] NM = 2'-methoxyethyl nucleotide

[0244] AM = 2'-methoxyethyladenosine-3'-phosphate

[0245] AMs = 2'-methoxyethyladenosine-3'-phosphorothioate

[0246] TM = 2'-methoxyethylthymidine-3'-phosphate

[0247] TMs = 2'-methoxyethylthymidine-3'-phosphorothioate

[0248] R = Ribitol

[0249] (invdN) = any inverted deoxyribonucleotide (3'-3' linked nucleotide)

[0250] (invAb) = inverse (3'-3' linked) abasic deoxyribonucleotide, see Table 7

[0251] (invAb)s = inverse (3'-3' linked) abasic deoxyribonucleotide-5'-phosphorothioate, see Table 7

[0252] (invn) = any inverted 2'-OMe nucleotide (3'-3' linked nucleotide)

[0253] s = phosphorothioate linkage

[0254] vpdN = vinylphosphonate deoxyribonucleotide

[0255] (5Me-Nf) = 5′-Me, 2′-fluoronucleotide

[0256] cPrp = cyclopropylphosphonate, see Table 7

[0257] epTcPr = See Table 7

[0258] epTM = see Table 7

[0259] (Chol-TEG) ​​= See Table 7

[0260] (Chol-Biotin) = See Table 7

[0261] (PEG-C3-SS) = See Table 7

[0262] (A1k-SS-C6) = See Table 7

[0263] (C6-SS-A1k) = See Table 7

[0264] (C6-SS-A1k-Me) = See Table 7

[0265] It is readily understood by those of ordinary skill in the art that the terminal nucleotide at the 3' end of a given oligonucleotide sequence will typically have a hydroxyl (-OH) group at the corresponding 3' position of a given monomer (rather than an isolated phosphate moiety). Unless otherwise expressly stated herein, this understanding of those of ordinary skill in the art is used when describing the FXII RNAi agents and compositions of FXII RNAi agents disclosed herein.

[0266] Targeting groups and linking groups include the following, whose chemical structures are provided in Table 7 below: (PAZ), (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s. Each sense strand and / or antisense strand can have any of the targeting groups or linking groups listed above, as well as other targeting or linking groups coupled to the 5' and / or 3' end of the sequence.

[0267] Table 3. FXII RNAi agent antisense strand sequences.

[0268]

[0269]

[0270]

[0271]

[0272]

[0273]

[0274]

[0275]

[0276]

[0277]

[0278]

[0279]

[0280]

[0281]

[0282]

[0283]

[0284]

[0285]

[0286]

[0287] Table 4. FXII RNAi agent sense strand sequences.

[0288]

[0289]

[0290]

[0291]

[0292]

[0293]

[0294]

[0295]

[0296]

[0297]

[0298]

[0299]

[0300]

[0301]

[0302]

[0303]

[0304]

[0305]

[0306] The FXII RNAi agent described herein is formed by annealing the antisense strand to the sense strand. A sense strand containing a sequence listed in Table 2, Table 4, or Table 6 can hybridize with any antisense strand containing a sequence listed in Table 2, Table 3, or Table 6, provided that the two sequences have a region of at least 85% complementarity over a continuous 16, 17, 18, 19, 20, or 21 nucleotide sequence.

[0307] In some embodiments, the antisense strand of the FXII RNAi agent disclosed herein differs from any antisense strand sequence in Table 3 by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of the FXII RNAi agent disclosed herein differs from any sense strand sequence in Table 4 by 0, 1, 2, or 3 nucleotides.

[0308] In some embodiments, the antisense strand of the FXII RNAi agent comprises a nucleotide sequence shown in any sequence in Table 2, Table 3 or Table 6. In some embodiments, the antisense strand of the FXII RNAi agent comprises a sequence shown in nucleotides (from 5' end → 3' end) 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, or 2-24, 1-25, 2-25, 1-16, or 2-16 of any sequence in Table 2, Table 3 or Table 6. In certain embodiments, the antisense strand of the FXII RNAi agent comprises or consists of a modified sequence shown in any modified sequence in Table 3. In certain embodiments, the positive strand of the FXII RNAi agent comprises or consists of a modified sequence shown in any modified sequence in Table 6.

[0309] In some embodiments, the sense strand of the FXII RNAi agent comprises a nucleotide sequence as shown in any one of Table 2, Table 4 or Table 6. In some embodiments, the sense strand of the FXII RNAi agent comprises a sequence shown in nucleotides (from 5' end → 3' end) 1-17, 2-17, 3-17, 4-17, 1-18, 2-18, 3-18, 4-18, 1-19, 2-19, 3-19, 4-19, 1-20, 2-20, 3-20, 4-20, 1-21, 2-21, 3-21, 4-21, 1-22, 2-22, 3-22, 4-22, 1-23, 2-23, 3-23, 4-23, 1-24, 2-24, 3-24, 4-24, 1-25, 2-25, 3-25, 4-25, 1-26, 2-26, 3-26, or 4-26 of any one of the sequences in Table 2, Table 4 or Table 6. In certain embodiments, the sense strand of the FXII RNAi agent comprises or consists of a modified sequence as shown in any modified sequence in Table 5. In certain embodiments, the sense strand of the FXII RNAi agent comprises or consists of a modified sequence as shown in any modified sequence in Table 6.

[0310] For the FXII RNAi substances disclosed herein, the nucleotide at position 1 of the antisense strand (from 5' end → 3' end) may be perfectly complementary to the FXII gene, or may not be complementary to the FXII gene. In some embodiments, the nucleotide at position 1 of the antisense strand (from 5' end → 3' end) is U, A or dT (or a modified form of U, A or dT). In some embodiments, the nucleotide at position 1 of the antisense strand (from 5' end → 3' end) forms an A:U or U:A base pair with the sense strand.

[0311] In some embodiments, the antisense strand of the FXII RNAi agent comprises a sequence of nucleotides 2-18 or 2-19 (from 5' end → 3' end) of any antisense strand sequence in Table 2, Table 3, or Table 6. In some embodiments, the positive strand of the FXII RNAi agent comprises a sequence of nucleotides 1-17 or 1-18 (from 5' end → 3' end) of any positive strand sequence in Table 2, Table 4, or Table 6.

[0312] In some embodiments, the FXII RNAi substance comprises: (i) an antisense strand comprising a sequence of nucleotides 2-18 or 2-19 (from 5′ end → 3′ end) of any antisense strand sequence in Table 2, Table 3 or Table 6, and (ii) a sense strand comprising a sequence of nucleotides 1-17 or 1-18 (from 5′ end → 3′ end) of any sense strand sequence in Table 2, Table 4 or Table 6.

[0313] A sense strand containing a sequence listed in Table 2, Table 4 or Table 6 can hybridize with any antisense strand containing a sequence listed in Table 2, Table 3 or Table 6, provided that the two sequences have a region of at least 85% complementarity over a continuous sequence of 16, 17, 18, 19, 20 or 21 nucleotides. In some embodiments, the FXII RNAi agent has a sense strand and an antisense strand, the sense strand consisting of a modified sequence of any modified sequence in Table 4, and the antisense strand consisting of a modified sequence of any modified sequence in Table 3. Some representative sequence pairs are exemplified by the duplex ID numbers shown in Table 5 or Table 6.

[0314] In some embodiments, the FXII RNAi substance comprises any duplex represented by any duplex ID number shown herein. In some embodiments, the FXII RNAi substance consists of any duplex represented by any duplex ID number shown herein. In some embodiments, the FXII RNAi substance comprises the sense strand and antisense strand nucleotide sequences of any duplex represented by any duplex ID number shown herein. In some embodiments, the FXII RNAi substance comprises the sense strand and antisense strand nucleotide sequences of any duplex represented by any duplex ID number shown herein and a targeting group and / or a linking group, wherein the targeting group and / or the linking group are covalently linked (i.e., coupled) to the sense strand or antisense strand. In some embodiments, the FXII RNAi substance comprises the sense strand and antisense strand modified nucleotide sequences of any duplex represented by any duplex ID number shown herein. In some embodiments, the FXII RNAi agent comprises a modified nucleotide sequence of the sense strand and the antisense strand of any duplex represented by any duplex ID number shown herein and a targeting group and / or a linking group, wherein the targeting group and / or the linking group is covalently linked to the sense strand or the antisense strand.

[0315] In some embodiments, the FXII RNAi agent comprises an antisense strand and a sense strand having any one of the antisense strand / sense strand duplex nucleotide sequences shown in Table 2, Table 5, or Table 6, and comprises an asialoglycoprotein receptor ligand targeting group.

[0316] In some embodiments, the FXII RNAi agent comprises an antisense strand and a sense strand having any antisense strand / sense strand duplex nucleotide sequence shown in Table 2, Table 5 or Table 6, and further comprises the following targeting groups: (PAZ), (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG30)s, (NAG31)s, (NAG32)s, (NAG33)s, (NAG34)s, (NAG35)s, (NAG36)s, (NAG37)s, (NAG38)s, (NAG39)s, (NAG40)s, (NAG41)s, (NAG42)s, (NAG43)s, (NAG44)s, (NAG45)s, (NAG46)s, (NAG47)s, (NAG48)s, (NAG49)s, (NAG50)s, (NAG51)s 37)s, (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s. In some embodiments, the targeting group is (NAG25) or (NAG25)s as defined in Table 7. In other embodiments, the targeting group is (NAG37) or (NAG37)s as defined in Table 7.

[0317] In some embodiments, the FXII RNAi agent comprises an antisense strand and a sense strand having a modified nucleotide sequence of any antisense strand and / or sense strand nucleotide sequence of any duplex in Table 5.

[0318] In some embodiments, the FXII RNAi agent comprises an antisense strand and a sense strand having a modified nucleotide sequence of any antisense strand and / or sense strand nucleotide sequence of any duplex in Table 5, and comprises an asialoglycoprotein receptor ligand targeting group.

[0319] In some embodiments, the FXII RNAi agent comprises, consists of, or consists essentially of a double-stranded structure of any duplex in Table 5.

[0320] Table 5. FXII RNAi species identified by duplex ID number with corresponding sense and antisense strands.

[0321]

[0322]

[0323]

[0324]

[0325]

[0326]

[0327]

[0328]

[0329]

[0330]

[0331]

[0332]

[0333]

[0334]

[0335]

[0336]

[0337]

[0338]

[0339]

[0340]

[0341]

[0342]

[0343]

[0344] Table 6. Other modified FXII RNAi agent duplexes (with corresponding antisense and sense strand sequences).

[0345]

[0346]

[0347]

[0348] In some embodiments, the FXII RNAi agent is prepared or provided in the form of a salt, mixed salts, or free acid.The RNAi agents described herein inhibit or knock down the in vivo expression of one or more FXII genes upon delivery to cells expressing the FXII gene.

[0349] Targeting groups, linkers and delivery vehicles

[0350] In some embodiments, FXII RNAi material is coupled to one or more non-nucleotide groups, including but not limited to, targeting group, linking group, delivery polymer or delivery vehicle.Non-nucleotide groups can enhance the targeting, delivery and connection of RNAi material.Table 7 provides examples of targeting groups and linking groups.Non-nucleotide groups can be covalently attached to 3' and / or 5' ends of sense strand and / or antisense strand.In some embodiments, FXII RNAi material comprises non-nucleotide groups connected to 3' and / or 5' ends of sense strand.In some embodiments, non-nucleotide groups are connected to 5' ends of sense strand of FXII RNAi material.Non-nucleotide groups can be directly or indirectly connected to RNAi material via joint / linking group.In some embodiments, non-nucleotide groups are connected to RNAi material via unstable bond, cleavable bond or reversible bond or joint.

[0351] In some embodiments, the non-nucleotide group can improve the pharmacokinetic or biodistribution properties of the conjugate or RNAi material to which it is attached to improve the cell or tissue-specific distribution and cell-specific uptake of the RNAi material or conjugate. In some embodiments, the non-nucleotide group enhances the endocytosis of the RNAi material.

[0352] Targeting group or targeting moiety can improve the pharmacokinetics or biodistribution characteristics of the conjugate or RNAi material of its engagement to improve the cell-specific distribution and cell-specific uptake of the conjugate or RNAi material. Targeting group can be monovalent, divalent, trivalent, tetravalent or have a higher valence state of the target directed to it. Representative targeting groups include but are not limited to, compounds with affinity to cell surface molecules, cell receptor ligands, half antibodies, antibodies, monoclonal antibodies, antibody fragments, and antibody mimics with affinity to cell surface molecules. In some embodiments, the targeting group uses a joint to connect RNAi material, such as PEG joints or 1,2 or 4 abasic and / or ribitol (absorbic ribose) residues, which can be used as joints in some cases. In some embodiments, the targeting group includes a galactose derivative cluster.

[0353] The FXII RNAi agents described herein can be synthesized with a reactive group, such as an amine group, at the 5' end. The reactive group can be utilized for subsequent attachment of a targeting group using conventional methods in the art.

[0354] In some embodiments, the targeting group includes an asialoglycoprotein receptor ligand. In some embodiments, the asialoglycoprotein receptor ligand includes or is composed of one or more galactose derivatives. As used herein, the term galactose derivative includes galactose and a galactose derivative whose affinity for the asialoglycoprotein receptor is equal to or greater than that of galactose for its affinity. Galactose derivatives include, but are not limited to, galactose, galactosamine, N-formylgalactosamine, N-acetyl-galactosamine, N-propionyl-galactosamine, N-n-butyryl-galactosamine and N-isobutyrylgalactose-amine (see, for example: ST.Iobst and K.Drickamer, JBC, 1996, 271, 6686). Galactose derivatives and clusters of galactose derivatives that can be used to target oligonucleotides and other molecules to the liver in vivo are known in the art (see, e.g., Baenziger and Fiete, 1980, Cell, 22, 611-620; Connolly et al., 1982, J. Biol. Chem., 257, 939-945).

[0355] Galactose derivatives have been used to target molecules of hepatocytes in vivo through their joints with asialoglycoprotein receptors on the surface of hepatocytes. The engagement of asialoglycoprotein receptor ligands with one or more asialoglycoprotein receptors promotes cell-specific targeting of hepatocytes and the entry of endocytic molecules into hepatocytes. Asialoglycoprotein receptor ligands can be monomers (e.g., with a single galactose derivative) or polymers (e.g., with multiple galactose derivatives). Galactose derivatives or galactose derivative clusters can be joined to the 3' or 5' end of the sense or antisense strand of RNAi substances using methods known in the art. The preparation of targeting groups such as galactose derivative clusters is described in, for example, U.S. Patent Application Serial No. 15 / 452,324 and U.S. Patent Publication No. US 2017 / 0253875, the contents of which are incorporated herein by reference in their entirety.

[0356] The galactose derivative cluster used herein comprises a molecule with 2-4 terminal galactose derivatives. The terminal galactose derivative is joined to a molecule by its C-1 carbon. In some embodiments, the galactose derivative cluster is a galactose derivative trimer (also referred to as a triantennary galactose derivative or a trivalent galactose derivative). In some embodiments, the galactose derivative cluster comprises N-acetyl-galactosamine. In some embodiments, the galactose derivative cluster comprises 3 N-acetyl-galactosamines. In some embodiments, the galactose derivative cluster is a galactose derivative tetramer (also referred to as a tetraantennary galactose derivative or a tetravalent galactose derivative). In some embodiments, the galactose derivative cluster comprises 4 N-acetyl-galactosamines.

[0357] As used herein, the galactose derivative trimer contains 3 galactose derivatives, each of which is connected to a central branch point. As used herein, the galactose derivative tetramer contains 4 galactose derivatives, each of which is connected to a central branch point. The galactose derivative can be connected to a central branch point by the C-1 carbon of the carbohydrate. In some embodiments, the galactose derivative is connected to a branch point by a joint or a spacer. In some embodiments, the joint or spacer is a flexible hydrophilic spacer, such as a PEG group (see, for example, U.S. Patent No. 5,885,968; Biessen et al., J.Med.Chem.1995 Volume 39 Pages 1538-1546). In some embodiments, the PEG spacer is a PEG3 spacer. The branch point can be any small molecule that allows the three galactose derivatives to bind, and also allows the branch point to bind RNAi substances. The example of a branch point group is dilysine or diglutamic acid. The engagement of the branch point with the RNAi substance can occur by a joint or a spacer. In some embodiments, the linker or spacer comprises a flexible hydrophilic spacer, such as but not limited to a PEG spacer. In some embodiments, the linker comprises a rigid linker, such as a cyclic group. In some embodiments, the galactose derivative comprises or is composed of N-acetyl-galactosamine. In some embodiments, the galactose derivative cluster comprises a galactose derivative tetramer, which can be, for example, an N-acetyl-galactosamine tetramer.

[0358] Embodiments of the present disclosure include pharmaceutical compositions for delivering FXII RNAi substances to liver cells in vivo. Such pharmaceutical compositions include, for example, FXII RNAi substances coupled to galactose derivative clusters. In some embodiments, the galactose derivative clusters include galactose derivative trimers or tetramers, the galactose derivative trimers may be, for example, N-acetyl-galactosamine trimers, and the galactose derivative tetramers may be, for example, N-acetyl-galactosamine tetramers.

[0359] Targeting groups include, but are not limited to, (PAZ), (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32 ... (NAG39) and (NAG39)s are as defined in Table 7. Other targeting groups are known in the art, including glass melt cluster targeting ligands.

[0360] In some embodiments, the linking group is coupled to the RNAi material. The linking group promotes the covalent connection of the material to the targeting group or the delivery polymer or the delivery vehicle. The linking group can connect the 3' or 5' end of the sense strand or antisense strand of the RNAi material. In some embodiments, the linking group is connected to the sense strand of the RNAi material. In some embodiments, the linking group is coupled to the 5' or 3' end of the sense strand of the RNAi material. In some embodiments, the linking group is coupled to the 5' end of the sense strand of the RNAi material. The example of the linking group includes but is not limited to: reactive groups such as primary amines and alkynes, alkyl groups, abasic nucleotides, ribitol (absorbic ribose) and / or PEG groups.

[0361] A linker or linking group is a connection between two atoms that connects a chemical group (such as an RNAi substance) or a segment of interest to another chemical group (such as a targeting group or a delivery polymer) or a segment of interest through one or more covalent bonds. Unstable connections include unstable bonds. The connection may optionally include a spacer that increases the distance between the two connected atoms. The spacer may also increase the flexibility and / or length of the connection. The spacer may include, but is not limited to, alkyl, alkenyl, alkynyl, aryl, aralkyl, aralkenyl and aralkyne; each of which may contain one or more heteroatoms, heterocycles, amino acids, nucleotides and sugars. Spacer groups are well known in the art, and the foregoing list is not intended to limit the scope of this description.

[0362] Any FXII RNAi agent nucleotide sequence listed in Table 2, 3, 4 or 6, whether modified or unmodified, may include a 3' or 5' targeting group or linking group. Any FXII RNAi agent sequence listed in Table 3 or 4 that contains a 3' or 5' targeting group or linking group may alternatively not contain a 3' or 5' targeting group or linking group, or may contain a different 3' or 5' targeting group or linking group, including, but not limited to, those shown in Table 7. Any FXII RNAi agent duplex listed in Table 2, Table 5 or Table 6, whether modified or unmodified, may further include a targeting group or linking group, including, but not limited to, those shown in Table 7, and the targeting group or linking group may be joined to the 3' or 5' end of the sense strand or antisense strand of the FXII RNAi agent duplex.

[0363] Table 7 provides examples of targeting groups and linking groups. Table 4 provides various embodiments of the sense strand of FXII RNAi agents having a targeting group or linking group attached to the 5' or 3' end.

[0364] Table 7. Structures representing various modified nucleotides, targeting groups, and linking groups

[0365]

[0366]

[0367]

[0368]

[0369]

[0370]

[0371]

[0372]

[0373]

[0374]

[0375]

[0376]

[0377]

[0378]

[0379]

[0380]

[0381]

[0382]

[0383] In each of the above structures shown in Table 7, NAG comprises N-acetyl-galactosamine or another asialoglycoprotein receptor ligand, and the structures to be conjugated are within the scope of understanding of a person of ordinary skill in the art based on the above structures and descriptions provided herein. For example, in some embodiments, NAG in the structure provided in Table 7 is represented by the following structure:

[0384]

[0385] Each (NAGx) can be joined to the FXII RNAi substance via a phosphate group (as in (NAG25), (NAG30) and (NAG31)), or a phosphorothioate group (as in (NAG25)s, (NAG29)s, (NAG30)s, (NAG31)s or (NAG37)s) or other linking groups.

[0386]

[0387] Other linking groups known in the art may be used.

[0388] In some embodiments, a delivery vehicle can be used to deliver RNAi substances to cells or tissues. Delivery vehicles are compounds that improve the delivery of RNAi substances to cells or tissues. Delivery vehicles can include, but are not limited to, or consist of, but are not limited to, polymers, such as amphipathic polymers, membrane active polymers, peptides, melittin, melittin-like peptides (MLPs), lipids, reversibly modified polymers or peptides, or reversibly modified membrane active polyamines. In some embodiments, RNAi substances can be combined with lipids, nanoparticles, polymers, liposomes, micelles, DPCs, or other delivery systems accessible in the art. RNAi agents can also be chemically coupled to targeting groups, lipids (including but not limited to, cholesterol and cholesterol derivatives), nanoparticles, polymers, liposomes, micelles, DPC (see, e.g., 2000 / 053722, WO 2008 / 0022309, WO 2011 / 104169 and WO 2012 / 083185, WO 2013 / 032829, WO 2013 / 158141, each of which is incorporated herein by reference), or other delivery systems available in the art.

[0389] Pharmaceutical compositions and preparations

[0390] The FXII RNAi substances disclosed herein can be prepared as pharmaceutical compositions or pharmaceutical preparations. In some embodiments, the pharmaceutical composition comprises an indication of a FXII RNAi substance. These pharmaceutical compositions can be particularly used to inhibit the expression of target mRNA in target cells, cell groups, tissues or organisms. The pharmaceutical composition can be used to treat an object suffering from a disease or condition that will benefit from a decrease in target mRNA levels or the inhibition of target gene expression. The pharmaceutical composition can be used to treat such an object, which is at risk of developing a disease, condition or condition that will benefit from a decrease in target mRNA levels or the inhibition of target gene expression. In one embodiment, the method includes administering to the object to be treated an FXII RNAi substance connected to a targeting ligand described herein. In some embodiments, one or more pharmaceutically acceptable excipients (including carriers, vehicles, diluents and / or delivery polymers) are added to a pharmaceutical composition comprising an FXII RNAi substance to form a pharmaceutical preparation suitable for in vivo delivery to an object (including a human).

[0391] Pharmaceutical compositions comprising FXII RNAi agents and methods disclosed herein reduce the level of target mRNA in a cell, a group of cells, a cell population, a tissue or a subject, comprising: administering to a subject a therapeutically effective amount of a FXII RNAi agent described herein, thereby inhibiting the expression of FXII mRNA in the subject.

[0392] In some embodiments, the pharmaceutical composition comprising the FXII RNAi substance is used to treat or control clinical manifestations of subjects that benefit from inhibition of FXII gene expression, such as HAE, AAE, ACE inhibitor-related angioedema, allergic angioedema, INAE, idiopathic angioedema, thrombosis, VTE, thrombotic occlusive disease, and perioperative venous occlusive disease. In some embodiments, a therapeutically or prophylactically effective amount of one or more pharmaceutical compositions is administered to a subject in need of such treatment. In some embodiments, administration of the disclosed FXII RNAi substance can be used to reduce the number, severity, and / or frequency of disease symptoms in a subject.

[0393] The pharmaceutical composition comprising the FXII RNAi substance can be used to treat at least one symptom in a subject suffering from a disease or condition that would benefit from reduction or inhibition of FXII mRNA expression. In some embodiments, a therapeutically effective amount of one or more pharmaceutical compositions comprising the FXII RNAi substance is administered to the subject, thereby treating the symptom. In other embodiments, a prophylactic effective amount of one or more FXII RNAi substances is administered to the subject, thereby preventing the at least one symptom.

[0394] The route of administration is the route by which the FXII RNAi substance contacts the body. In general, methods for administering drugs and oligonucleotides and nucleic acids for treating mammals are well known in the art and can be used to administer the compositions described herein. The FXII RNAi substances disclosed herein can be administered via any suitable route in a preparation appropriately adjusted according to a particular route. Thus, the pharmaceutical compositions described herein can be administered by injection, e.g., intravenous, intramuscular, intradermal, subcutaneous, intraduodenal or intraperitoneal injection. In some embodiments, the pharmaceutical compositions described herein are administered by subcutaneous injection.

[0395] The pharmaceutical composition comprising FXII RNAi material described herein can be delivered to cells, cell groups, tissues or objects using oligonucleotide delivery technology that suppresses in the art. Generally speaking, any suitable method for delivering nucleic acid molecules (in vitro or in vivo) recognized in the art can be applicable to compositions described herein. For example, delivery can be by topical administration (for example, direct injection, implantation or local administration), systemic administration, or subcutaneous, intravenous, intraperitoneal, or parenteral route, including intracranial (for example, intraventricular, intraparenchymal and intrathecal), intramuscular, transdermal, airway (aerosol), nose, oral, rectal, or local (including buccal and sublingual) administration. In some embodiments, compositions are administered by subcutaneous or intravenous infusion or injection.

[0396] Thus, in some embodiments, the pharmaceutical compositions described herein include one or more pharmaceutically acceptable excipients.The pharmaceutical compositions described herein can be formulated for administration to a patient.

[0397] As described herein, a pharmaceutical composition or medicament includes a pharmaceutically effective amount of at least one of the FXII RNAi substances and one or more pharmaceutically acceptable excipients. A pharmaceutically acceptable excipient (excipient) is a substance intentionally included in a drug delivery system in addition to an active pharmaceutical ingredient (API, therapeutic product, such as a FXII RNAi substance). The excipient does not promote or is not intended to promote the therapeutic effect at the intended dose. The excipient may play the following roles: a) plays an auxiliary role in the processing of the drug delivery system in manufacturing; b) protects, supports or improves the stability, bioavailability or patient acceptance of the API; c) plays an assisting role in the identification of the product; and / or d) improves the overall safety of the delivery of the API in storage or use, any other characteristics in effectiveness. A pharmaceutically acceptable excipient may or may not be an inert substance.

[0398] Excipients include, but are not limited to, absorption enhancers, anti-adherents, anti-foaming agents, antioxidants, binders, buffers, carriers, coatings, pigments, delivery enhancers, delivery polymers, polysaccharides, glucose, diluents, disintegrants, emulsifiers, expanders, fillers, flavoring agents, glidants, humectants, lubricants, oils, polymers, preservatives, saline, salts, solvents, sugars, suspending agents, sustained release matrices, sweeteners, thickeners, isotonic agents, vehicles, waterproofing agents, and wetting agents.

[0399] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (when water soluble) or dispersions, and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, The composition may be prepared in the form of ELTM (BASF, Parsippany, NJ) or phosphate buffered saline (PBS). It should be stable under the conditions of manufacture and storage and should resist the contaminating action of microorganisms such as bacteria and fungi during storage. The carrier may be a solvent or dispersion medium comprising water, ethanol, a polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol) and suitable mixtures thereof. Suitable fluidity may be maintained, for example, by the use of a coating such as lecithin, by maintaining the desired particle size in the case of dispersions, and by the use of a surfactant. In many cases, it may be preferred to include an isotonic agent, for example, a sugar, a polyol such as mannitol, sorbitol, and sodium chloride in the composition. Substances that delay absorption (e.g., aluminum monostearate and gelatin) may be included in the composition to prolong the absorption of the injectable composition.

[0400] The required amount of active compound and one of the above components or a combination thereof can be mixed into a suitable solvent as needed and then filtered and sterilized to prepare a sterile injection. Usually, the active active substance is mixed into a sterile carrier containing an alkaline dispersion medium and the above other required ingredients to prepare a dispersion. In the case of sterile powders for preparing sterile injections, the preparation method includes vacuum drying and freeze drying to obtain a powder of the active component and any other required components obtained from a solution thereof that has been previously sterile filtered.

[0401] Formulations suitable for intra-articular administration may be in the form of a sterile aqueous preparation of the drug, which may be in microcrystalline form, for example, as an aqueous microcrystalline suspension. Liposomal formulations or biodegradable polymer systems may also be used to present the drug for intra-articular and ophthalmic administration.

[0402] The active compound can be prepared in combination with a carrier that protects the compound from rapid clearance by the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid can be used. Methods for preparing such formulations will be apparent to those skilled in the art. Liposomal suspensions can also be used as pharmaceutically acceptable carriers. These can be prepared by methods known to those skilled in the art, for example, as described in U.S. Patent No. 4,522,811.

[0403] FXII RNAi substances can be formulated into unit dosage forms for ease of administration and dosage uniformity. Unit dosage forms refer to physically discrete units used as single doses for subjects to be treated, each unit containing a predetermined amount of active compound and a desired pharmaceutical carrier, the predetermined amount being calculated to produce the desired therapeutic effect. The specifications of the dosage unit forms in the present disclosure depend on or are directly dependent on the unique characteristics of the active compound and the therapeutic effect to be achieved, as well as the inherent limitations in the field of synthesizing such active compounds for treating individuals.

[0404] The pharmaceutical composition may include other additional ingredients commonly used in pharmaceutical compositions. Other such components include, but are not limited to, antipruritic agents, astringents, local anesthetics, or anti-inflammatory agents (e.g., antihistamines, diphenhydramine, etc.). It is also contemplated that cells, tissues, or separated organs expressing or comprising RNAi materials defined herein can be used as "pharmaceutical compositions". As described herein, "pharmaceutically effective amount", "therapeutically effective amount", or simply "effective amount" refers to the amount of RNAi materials that effectively produces the expected pharmaceutical, therapeutic, or preventive results.

[0405] In some embodiments, in addition to administering the RNAi substances disclosed herein, the methods disclosed herein also include administering a second therapeutic agent or treatment step. In some embodiments, the second therapeutic agent is another FXII RNAi substance (e.g., a FXII RNAi substance targeting a different sequence within the FXII target). In other embodiments, the second therapeutic agent can be a small molecule drug, an antibody, an antibody fragment, an aptamer and / or a vaccine.

[0406] Typically, the effective amount of the active compound will be in the range of about 0.1-about 100 mg / kg body weight / day, for example, about 1.0-about 50 mg / kg body weight / day. In some embodiments, the effective amount of the active compound will be in the range of about 0.25-about 5 mg / kg body weight for each dose. In some embodiments, the effective amount of the active ingredient will be in the range of about 0.5-about 4 mg / kg body weight for each dose. The amount administered may also depend on such variables as the overall health of the patient, the relative biological activity of the delivered compound, the formulation of the drug, the presence and type of excipients in the formulation, and the route of administration. In addition, it is understood that in some examples, the initial dose may exceed the above-mentioned higher levels to quickly achieve the desired blood level or tissue level, or in some examples, the initial dose may be less than the optimal value.

[0407] For the treatment of a disease or for the preparation of a drug or composition for treating a disease, the pharmaceutical composition comprising a FXII RNAi agent described herein can be combined with an excipient or with a second therapeutic agent or treatment including but not limited to the following: a second or additional RNAi agent, a small molecule drug, an antibody, an antibody fragment, a peptide and / or an aptamer.

[0408] When added to a pharmaceutically acceptable excipient or adjuvant, the FXII RNAi substance can be packaged in a kit, container, bag or dispenser. The pharmaceutical composition described herein is packaged in a pre-filled syringe or bottle.

[0409] Methods of treatment and suppression of expression

[0410] The FXII RNAi substances disclosed herein can be used to treat subjects (e.g., humans or other mammals) suffering from diseases or conditions that will benefit from the administration of the compound. In some embodiments, the RNAi substances disclosed herein can be used to treat subjects (e.g., humans) that will benefit from the reduction and / or inhibition of FXII gene expression, for example, subjects that have been diagnosed with or are at risk of developing symptoms associated with the following diseases or conditions: hereditary angioedema (HAE), acquired angioedema (AAE), angioedema associated with ACE inhibitors, allergic angioedema, non-histaminergic angioedema (INAE), idiopathic angioedema, thrombosis, venous thromboembolism (VTE), thrombotic occlusive diseases and / or the risk of associated symptoms. Prevention of perioperative venous occlusive diseases. The treatment of the subject may include therapeutic and / or prophylactic treatment. The subject is given a therapeutically effective amount of any one or more FXII RNAi substances described herein. The subject may be a human, a patient, or a human patient. The subject may be an adult, a teenager, a toddler, or an infant. The administration of the pharmaceutical composition described herein may be directed to humans or animals.

[0411] In some embodiments, the FXII RNAi substances described herein are used to treat subjects that would benefit from reduction and / or inhibition of FXII gene expression. In some embodiments, the FXII RNAi substances are used to treat (including prophylactically treat) at least one symptom or pathology mediated at least in part by FXII expression. Any one or more of the RNAi substances are administered to a subject in a therapeutically effective amount. In some embodiments, any one or more of the RNAi substances are administered to a subject in a preventive effective amount, thereby preventing the at least one symptom.

[0412] In certain embodiments, the present invention provides methods of treating a disease, disorder, condition or pathology mediated at least in part by FXII expression in a patient in need thereof, wherein the method comprises administering to the patient any of the FXII RNAi agents described herein.

[0413] In some embodiments, the FXII RNAi substance is used to treat or control a pathological state (e.g., a condition or disease) of a subject, the pathological state of which is mediated at least in part by FXII expression. A therapeutically effective amount of any one or more FXII RNAi substances described herein or a composition comprising a FXII RNAi substance is administered to the subject. In some embodiments, the method comprises administering a composition comprising a FXII RNAi substance described herein to the subject to be treated.

[0414] In some embodiments, the gene expression level and / or mRNA level of the FXII gene in a subject administered the FXII RNAi substance is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 95%, 96%, 97%, 98%, 99% or greater than 99% relative to a subject prior to administration of the FXII RNAi substance or a subject that did not receive the FXII RNAi substance. The gene expression level and / or mRNA level in the subject is reduced in a cell, cell population and / or tissue of the subject.

[0415] In some embodiments, the protein level of FXII in a subject administered the FXII RNAi agent is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 95%, 96%, 97%, 98%, 99% or greater than 99% relative to a subject prior to administration of the FXII RNAi agent or a subject not receiving the FXII RNAi agent. The protein level in the subject is reduced in a cell, cell population, tissue, blood, and / or other fluid of the subject.

[0416] The reduction of FXII gene expression, FXII mRNA or FXII protein level can be evaluated and quantified by common methods known in the art. The embodiments disclosed herein are generally known for evaluating methods for suppressing FXII gene expression and reducing FXII protein levels. The reduction or decrease of FXII mRNA levels and / or protein levels is collectively referred to herein as a reduction or decrease of FXII or an inhibition or reduction of the expression of target FXII.

[0417] Cells, tissues and non-human organisms

[0418] Cells, tissues, and non-human organisms comprising at least one FXII RNAi agent described herein are contemplated. Cells, tissues, or non-human organisms are produced by delivering the RNAi agent to the cell, tissue, or non-human organism.

[0419] The embodiments and items provided above are illustrated by the following non-limiting examples.

[0420] Example

[0421] Example 1 Identification of FXII RNAi Substance Sequence and Synthesis of FXII RNAi Substance

[0422] The selection process for identifying guide sequences targeting FXII begins with a computer simulation approach to identify conserved sequences between variants of the FXII gene (SEQ ID NO: 1). FXII sequences were initially screened using bioinformatics to screen for 19 nucleotide sequences with complementary sequences that cross-reactive with human and non-human primate AAT. Sequences known to be difficult to manufacture and predicted to have poor RNAi activity based on known parameters were excluded. The specificity of the sequences was also evaluated to avoid off-target effects on the human and cynomolgus macaque genomes. Seventeen (17) 19-mer sequence families were initially selected as potential candidates. Other sequences were identified by changing the nucleotide at position 1 (5′→3′) of the antisense strand and the corresponding base pair on the sense strand to form a U:A base pair. The modification pattern was selected and the modified RNAi material sense and antisense strands were synthesized on a solid phase according to the phosphoramidite technique using oligonucleotide synthesis methods known in the art. For example, the duplexes in Tables 5 and 6 herein were synthesized according to the following:

[0423] synthesis

[0424] The sense and antisense strands of FXII RNAi agents were synthesized using the phosphoramidite technique on a solid phase for oligonucleotide synthesis. (Bioautomation) or (BioAutomation, Inc.), or an equivalent commercially available synthesizer. or The syntheses were performed on solid supports made by Prime Synthesis (Aston, PA, USA). All RNA and 2′-modified RNA phosphoramidites were purchased from ThermoFisher Scientific (Milwaukee, WI, USA). Specifically, the following 2′-O-methyl phosphoramidites were used: (5′-O-dimethoxytrityl-N 6 -(benzoyl)-2′-O-methyl-adenosine-3′-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite, 5′-O-dimethoxytrityl-N 4 -(acetyl)-2′-O-methyl-cytidine-3′-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite, (5′-O-dimethoxy-trityl-N 2 -(isobutyryl)-2′-O-methyl-guanosine-3′-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite and 5′-O-dimethoxy-trityl-2′-O-methyl-uridine-3′-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite. 2′-Deoxy-2′-fluorophosphoramidites carry the same protecting groups as 2′-O-methyl RNA amides. The following UNA phosphoramidites were used: 5′-(4,4′-methoxytrityl)-N-benzoyl-2′,3′-secocyosine, 2′-benzoyl-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5′-(4,4′-methoxytrityl)-N-acetyl-2′,3′-secocyosine, 2′-benzoyl-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite )]-phosphoramidite, 5′-(4,4′-methoxytrityl)-N-isobutyryl-2′,3′-secouridine, 2′-benzoyl-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, and 5′-(4,4′-dimethoxytrityl)-2′,3′-secouridine, 2′-benzoyl-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite.

[0425] Targeting ligands containing phosphoramidites were dissolved in anhydrous dichloromethane or anhydrous acetonitrile (50 mM), while all other amidites were dissolved in anhydrous acetonitrile (50 mM) with the addition of molecular sieves. 5-Benzylthio-1H-tetrazolyl (BTT, 250 mM in acetonitrile) or 5-ethylthio-1H-tetrazolyl (ETT, 250 mM in acetonitrile) was used as the activator solution. Coupling times were 10 min (RNA), 15 min (targeting ligand), 90 sec (2′OMe), and 60 sec (2′F). To introduce phosphorothioate linkages, a 100 mM solution of 3-phenyl-1,2,4-dithiazolin-5-one (POS, obtained from PolyOrg, Inc., Leominster, MA, USA) was used in anhydrous acetonitrile.

[0426] Cleavage and deprotection of support-bound oligomers.

[0427] At the end of the solid phase synthesis, the dried solid support was treated with a 1:1 volume of 40 wt% methylamine solution and 28% v 31% ammonium hydroxide solution (Aldrich) in water for 1.5 hours at 30° C. The solution was evaporated and the solid residue was reconstituted in water (see below).

[0428] purification

[0429] Crude oligomers were purified by anion exchange HPLC using a TKSgel SuperQ-5PW 13u column and a Shimadzu LC-8 system. Buffer A was 20 mM Tris, 5 mM EDTA, pH 9.0 and contained 20% acetonitrile and buffer B was the same as buffer A with 1.5 M sodium chloride added. UV traces were recorded at 260 nm. Appropriate fractions were pooled and then run on a size exclusion HPLC using a GE Healthcare XK 16 / 40 column filled with Sephadex G-25 media, with a running buffer of 100 mM ammonium bicarbonate, pH 6.7 and 20% acetonitrile or filtered water.

[0430] annealing

[0431] Complementary strands were mixed to form RNAi material by mixing equimolar solutions (sense and antisense) in 1×PBS (phosphate buffered saline, 1×, Corning, Cellgro). Some RNAi materials were lyophilized and stored at -15 to -25°C. The duplex concentration was determined by measuring the absorption of the solution on a UV-Vis spectrometer in 1×PBS. The duplex concentration was then determined by multiplying the absorption of the solution at 260nm by the conversion factor and the dilution factor. Unless otherwise stated, all conversion factors are 0.037 mg / (mL·cm). For some experiments, the conversion factor was calculated from the experimentally determined extinction coefficient.

[0432] Example 2. In vitro testing of RNAi agent candidates

[0433] To test modified FXII RNAi constructs in vitro, a human FXII cDNA sequence (Accession # NM_000505.3 (SEQ ID NO: 1)) was synthesized and cloned into the commercially available reporter-based screening plasmid psiCHECK2 (Promega, Madison, WI), which produces Renilla luciferase / FXII fusion mRNA. For siRNA efficacy in a human background, Huh7 cells (a human hepatocyte-derived cancer cell line) were seeded in 96-well plates at approximately 7,500 cells per well. Each FXII siRNA selected for in vitro studies was co-transfected at three concentrations, 10 nM, 1 nM, and 0.1 nM, with 25 ng of FXII-psiCHECK2 plasmid DNA per well and 0.2 μL of LipoFectamine 2000 per well. Gene knockdown was determined by measuring the level of Renilla luciferase normalized to the level of constitutively expressed firefly luciferase (also present on the psiCHECK2 plasmid, using a dual-luciferase reporter assay (Promega, Madison, Wisconsin)). The candidate sequence duplexes listed in Table 6 were tested in vitro. The data are reported in Table 8 below.

[0434] Table 8: Results of FXII RNAi agents in human background as determined by dual luciferase reporter assay.

[0435]

[0436]

[0437]

[0438] Example 3. FXII knockdown in wild-type mice after FXII RNAi delivery

[0439] NAG-coupled FXII RNAi agents were prepared and combined in a pharmaceutically acceptable buffer as described above for subcutaneous (SQ) injection. On day 1, three mice in each group (n=3) were injected with saline or 3 mg / kg AD03632 (for modified FXII RNAi agents and NAG ligand structures, see Tables 3-5 and 7). Blood samples were drawn and analyzed for FXII protein levels on days 8, 15, 22, 29, and 36. FXII protein levels were measured using an in-house developed mF12 (Perkin Elmer), which utilizes commercially available antibodies (Molecular Innovations), which allows for increased throughput; alternatively, the commercially available mF 12 ELISA kit can be used. For normalization, the FXII level at the corresponding time point in each animal is divided by the pre-treatment expression level in that animal (in this case at day 1) to determine the expression ratio "normalized" to day 1. Knockdown of FXII in Figure 1 Reported in.

[0440] Example 4. Factor 12 (FXII) in wild-type mice following FXII RNAi delivery

[0441] NAG-conjugated FXII RNAi agents were prepared and combined in a pharmaceutically acceptable buffer as described above for subcutaneous (SQ) injection. On day 1, 4 mice in each group were injected with (i) 0.6 mg / kg AD03632; (ii) 2 mg / kg AD03632; or (iii) saline (for modified FXII RNAi agents and NAG ligand structures, see Tables 3-5 and 7). Blood samples were drawn and analyzed for FXII protein levels on days 7, 14, 21, 28, 35, 42, 49, 56, and 63. FXII protein levels were measured using an in-house developed mF12 (Perkin Elmer), which utilizes commercially available antibodies (Molecular Innovations), which allows for increased throughput; alternatively, the commercially available mF12 ELISA kit can be used. For normalization, the FXII level at the corresponding time point for each animal was divided by the pre-treatment expression level in that animal (in this case at day 1) to determine the expression ratio "normalized" to day 1. Knockdown of FXII in Figure 2 Reported in.

[0442] Example 5. Factor 12 (FXII) Dose Response in Mice Following Delivery of FXII RNAi Agents

[0443] NAG-coupled FXII RNAi agents were prepared and combined in a pharmaceutically acceptable buffer as described above for subcutaneous (SQ) injection. On day 1, 6 mice in each group were injected with (i) 0.6 mg / kg AD03632; (ii) 2 mg / kg AD03632; or (iii) saline (for modified FXII RNAi agents and NAG ligand structures, see Tables 3-5 and 7). During the next six weeks, mice were injected again once a week with the same dose of AD03632 or saline as given on day 1. Blood samples were drawn and analyzed for FXII protein levels one day before the next injection (i.e., blood samples drawn on days 7, 14, 21, 28, 35, 42, 49, 56, and 63). FXII protein levels were measured using the mF12 developed in-house. (PerkinElmer) using commercially available antibodies (Molecular Innovations), which allows for increased throughput; alternatively, the commercially available mF12 ELISA kit can be used. For normalization, the FXII level at the corresponding time point in each animal was divided by the pre-treatment expression level in that animal (in this case at day 1) to determine the expression ratio "normalized" to day 1. Knockdown of FXII in Figure 3 Reported in.

[0444] Example 6. Clot Weight and Factor 12 (FXII) Serum Protein Levels in the Rat Arteriovenous Shunt Model Following FXII RNAi Delivery

[0445] NAG-conjugated FXII RNAi agents were prepared and combined in a pharmaceutically acceptable buffer as described above for subcutaneous (SQ) injection. On day 1, 5 rats in each group were injected with (i) saline; (ii) saline on day 1 followed by 1000 U / kg heparin at the time of intubation on day 7, day 8, or day 9; (iii) 1 mg / kg FXII RNAi agent AD03224; or (iv) 3 mg / kg FXII RNAi agent AD03224. (See Tables 3-5 and 7 for modified FXII RNAi agents and NAG ligand structures). Blood samples were drawn on the day of surgery (i.e., day 7, 8, or 9). For normalization, the FXII level in each animal at the corresponding time point was divided by the pre-treatment serum level in that animal (in this case on day 1) to determine the expression ratio "normalized" to day 1. XII serum protein levels were Figure 4 FXII protein levels were reported using the in-house developed mF12 (Perkin Elmer) measurement, which utilizes commercially available antibodies (Molecular Innovations), which allows for increased throughput; alternatively, the commercially available mF 12 ELISA kit can be used.

[0446] In addition, these mice were subjected to arteriovenous shunt model measurements. On the day of the shunt experiment (i.e., day 7, 8, or 9), a polyurethane tube (with silk thread) was implanted to connect the carotid artery to the jugular vein (cannulation). After 15 minutes, the shunt was removed and the net thrombus weight was measured. Figure 5 Clot weight (mg) is reported in .

[0447] Example 7. Administration of NAG-coupled FXII RNAi Agents in Cynomolgus Monkeys

[0448] NAG-coupled FXII RNAi agents were manufactured and combined with pharmaceutically acceptable buffers known in the art for subcutaneous (SC) injection. On day 1, cynomolgus macaques (Macaca fascicularis) primates (referred to herein as "macaques" or "monkeys") were injected subcutaneously with 3 mg / kg of AD03635, AD04131, AD04157, AD04162, AD04254, or AD04443 (see modified FXII RNAi agents and NAG ligand structures in Tables 3-5 and 7). For the AD03635, AD04131, AD04157, AD04162, AD04254 groups, three monkeys in each group (n=3) were tested. For the AD04443 group, only two monkeys (n=2) were tested. On day 29, two (2) monkeys in each group were given a subsequent dose of 1.5 mg / kg of the same corresponding FXII RNAi agent given on day 1.

[0449] Serum samples from the cynomolgus monkeys treated were collected on the first 29 days, the first 7 days and the 1st day (before treatment) and the 8th, 15th, 22nd, 29th, 36th, 43rd, 50th, 57th, 64th and 78th days. At the specified time point, blood samples were collected and serum FXII protein levels were analyzed. According to the manufacturer's recommendation, commercially purchased human F12 (Molecular Innovations) ELISA was used to measure FXII protein levels. According to the manufacturer's recommendation, standard clinical chemistry was also evaluated on an automatic chemical analyzer, including blood urea nitrogen (BUN), alanine aminotransferase (ALT), aspartate aminotransferase (AST) and creatinine. STACompact was also used. (Stago) determines the activated partial thromboplastin time (aPTT). The functional readings of F12 knockdown can also be observed by the extension of the activated partial thromboembolism time (aPTT) compared with before treatment. The FXII activity of the sample is also assessed by using the FXII activity assay. The FXII activity assay is performed using the aPTT method (standard techniques known in the art) and factor-deficient substrates. The subject plasma is combined and incubated with the FXII-deficient substrate (normal plasma depleted of FXII by immunoadsorption) and the aPTT reagent. After the specified incubation time, calcium is added to initiate the coagulation process and measure clot formation. The results are then compared with the normal results (100%), and the percentage activity is calculated.

[0450] The FXII protein level at the corresponding time point for each animal was divided by the pre-treatment level expressed by that animal (average of the first 29 days, first 7 days, and day 1 (before treatment)) to determine the ratio of expression "normalized to pre-treatment". In addition, the average knockdown levels of FXII protein and FXII activity at their respective nadirs (i.e., the average nadir expression level on the day serum was collected) were calculated.

[0451] Table 9. Normalized FXII protein from ELISA (normalized to pre-treatment) in Example 7.

[0452]

[0453]

[0454] Table 10. Average FXII protein knockdown percentage at nadir from Example 7.

[0455]

[0456] Table 11. Average FXII activity percentage from Example 7 (normalized to before treatment)

[0457]

[0458] Table 12. Normalized aPTT (seconds) from Example 7 (normalized to before treatment).

[0459]

[0460]

[0461] Each FXII RNAi material tested in Example 7 showed a large amount of FXII knockdown in macaques. In addition, administration of a second dose of FXII RNAi material showed knockdown of FXII protein and FXII activity and further improvement of aPTT prolongation in macaques. For example, AD04162, which comprises an antisense strand having a sequence at least partially complementary to positions 127-145 of the FXII gene (SEQ ID NO: 1), showed 93.5% inhibition of FXII protein expression at the lowest point after the second dose.

[0462] Example 8. Administration of NAG-coupled FXII RNAi Agents in Cynomolgus Monkeys

[0463] NAG-coupled FXII RNAi agents were manufactured and combined with pharmaceutically acceptable buffers known in the art for subcutaneous (SC) injection. On day 1, cynomolgus macaques (Macaca fascicularis) primates (referred to herein as "macaques" or "monkeys") were injected subcutaneously with 3 mg / kg of AD04623, AD04624, AD04625, AD04626, AD04627, or AD04628 (see modified FXII RNAi agents and NAG ligand structures in Tables 3-5 and 7). Two monkeys in each group (n=2) were tested, one male and one female in each group. On day 24, each macaque was given a single 3 mg / kg SC injection of the same corresponding FXII RNAi agent as was given to the corresponding animal on day 1 (i.e., the second dose).

[0464] Serum samples of the treated cynomolgus macaques were collected on the first 6 days and the 1st day (before treatment) and on the 8th, 15th, 24th, 29th, 36th and 43rd days. At the specified time points, blood samples were collected and analyzed for serum FXII protein levels. According to the manufacturer's recommendation, commercially purchased human F12 (Molecular Innovations) ELISA was used to determine FXII protein levels. According to the manufacturer's recommendation, standard clinical chemistry, including blood urea nitrogen (BUN), alanine aminotransferase (ALT), aspartate aminotransferase (AST) and creatinine, were also evaluated on an automatic chemical analyzer. The FXII activity of the sample was also evaluated by using FXII activity assay. FXII activity assay was performed using aPTT method (standard technique known in the art) and factor-deficient substrates. Subject plasma was combined and incubated with FXII defective substrate (normal plasma depleted of FXII by immunoadsorption) and aPTT reagent. After the specified incubation time, calcium was added to initiate the coagulation process and measure clot formation. The results were then compared with normal human results (100%), and the percentage activity was calculated.

[0465] The FXII protein level at the corresponding time point for each animal was divided by the pre-treatment level expressed by that animal (average of the first 6 days and day 1 (before treatment)) to determine the ratio of expression "normalized to pre-treatment". In addition, the average knockdown levels of FXII protein and FXII activity at their respective nadirs (i.e., the average nadir expression level on the day serum was collected) were calculated.

[0466] Table 13. Normalized FXII protein from ELISA in Example 8 (normalized to pre-treatment).

[0467]

[0468]

[0469] Table 14. Mean normalized FXII protein from Example 8 (normalized to pre-treatment).

[0470]

[0471]

[0472] Table 15. Normalized FXII activity from Example 8 (normalized to before treatment).

[0473]

[0474]

[0475] Each FXII RNAi agent administered in Example 8 showed significant inhibition of FXII expression in macaques. For example, AD04625, which comprises an antisense strand designed to target positions 127-145 of the FXII gene (SEQ ID NO: 1), showed an average normalized knockdown of 91.2% of FXII protein (0.090 + / - 0.007) on day 29 (see Table 14, Group 3).

[0476] Example 9. Administration of NAG-coupled FXII RNAi Agents in Cynomolgus Monkeys

[0477] NAG-coupled FXII RNAi agents were manufactured and combined with pharmaceutically acceptable buffers known in the art for subcutaneous (SC) injection. On day 1, cynomolgus macaques (Macaca fascicularis) primates (referred to herein as "macaques" or "monkeys") were injected subcutaneously with 4.0 mg / kg of AD04623, AD04625, AD04753, or AD04757 (see modified FXII RNAi agents and NAG ligand structures in Tables 3-5 and 7). A second subcutaneous injection of 4.0 mg / kg of the same FXII RNAi agent was given on day 29. Two female monkeys (n=2) were tested in each group.

[0478] Serum samples were collected from the treated cynomolgus macaques at the first 14 days, the first 7 days, and the first day (before treatment) and at the 8th, 15th, 22nd, 29th, 30th, 36th, and 43rd days. At the specified time points, blood samples were collected and analyzed for serum FXII protein levels. FXII protein levels were determined using a commercially available human F12 (Molecular Innovations) ELISA according to the manufacturer's recommendations. Standard clinical chemistry, including blood urea nitrogen (BUN), alanine aminotransferase (ALT), aspartate aminotransferase (AST), and creatinine, was also assessed on an automated chemistry analyzer according to the manufacturer's recommendations. -PTT Automate 5 (Stago) measures activated partial thromboplastin time (aPTT). Functional readouts of F12 knockdown can also be observed by the extension of activated partial thromboembolism time (aPTT) compared to before treatment. The FXII activity of the sample is also assessed by using FXII activity assay. FXII activity assay is performed using aPTT method (standard techniques known in the art) and factor-deficient substrates. Subject plasma is combined and incubated with FXII-deficient substrate (normal plasma depleted of FXII by immunoadsorption) and aPTT reagent. After the specified incubation time, calcium is added to initiate the coagulation process and measure clot formation. The results are then compared with normal results (100%), and the percentage activity is calculated.

[0479] The FXII protein level at the corresponding time point for each animal was divided by the pre-treatment level expressed by that animal (average of the first 6 days and day 1 (before treatment)) to determine the ratio of expression "normalized to pre-treatment". In addition, the average knockdown levels of FXII protein and FXII activity at their respective nadirs (i.e., the average nadir expression level on the day serum was collected) were calculated.

[0480] Table 16. Normalized FXII protein from ELISA in Example 9 (normalized to pre-treatment).

[0481]

[0482] Table 17. Mean normalized FXII protein from Example 9 (normalized to pre-treatment).

[0483]

[0484]

[0485] Table 18. Mean normalized FXII activity from Example 9 at nadir.

[0486]

[0487]

[0488] Table 19. Normalized aPTT (seconds) from Example 7 (normalized to before treatment).

[0489]

[0490] In Example 9, each FXII RNAi material showed significant knockdown of the FXII gene. For example, AD04625 showed the greatest knockdown of the RNAi material given after the first and second doses in the FXII protein (91% knockdown after the first dose; 94.5% knockdown after the second dose). AD04625 also showed the greatest knockdown of FXII activity and showed the greatest extension of aPTT relative to baseline (2.02 higher than baseline after the first dose; 2.435 higher than baseline at the highest point after the second dose).

[0491] Example 10. Factor 12 (FXII)-SEAP Mouse Model

[0492] Six to eight week old female C57BL / 6 albino mice were transiently transfected with plasmids by hydrodynamic tail vein injection, at least 15 days before administration of FXII RNAi agents or controls. The plasmid contained the human FXII cDNA sequence (GenBank NM_000505.3 (SEQ ID NO: 1)) inserted into the 3′UTR of the SEAP (secreted human placental alkaline phosphatase) reporter gene. 50 μg of the plasmid containing the FXII cDNA sequence in a total volume of 10% of the animal's body weight of Ringer's solution was injected into the mice via the tail vein to generate FXII-SEAP model mice. The solution was injected within 5-7 seconds through a 27-gauge needle as described previously (Zhang G et al., "High levels of foreign gene expression in hepatocytes after tail vein injection of naked plasmid DNA". Human Gene Therapy 1999, Vol. 10, pp. 1735-1737). Inhibition of FXII expression by FXII RNAi agents resulted in concomitant inhibition of SEAP expression, which was detected by Phospha-Light TM SEAP reporter gene assay system (Invitrogen) was used to measure the SEAP expression level in serum before treatment, and mice were grouped according to the average SEAP level.

[0493] Analysis: SEAP levels can be measured at various times before and after administration of FXII RNAi agents.

[0494] i) Serum collection: Mice were anesthetized with 2-3% isoflurane and blood samples were collected from the submandibular area into serum separator tubes (Sarstedt AG & Co., Nümbrecht, Germany). The blood was allowed to clot at ambient temperature for 20 minutes. The tubes were centrifuged at 8,000×g for 3 minutes to separate the serum and stored at 4°C.

[0495] ii) Serum SEAP level: Serum was collected and analyzed by Phospha-Light according to the manufacturer's instructions. TMSEAP reporter gene assay system (Invitrogen) was used to measure. The serum SEAP level of each animal was normalized to the control group of mice injected with saline to account for the non-treatment-related decrease in FXII expression with this model. First, the SEAP level of each animal at the corresponding time point was divided by the pre-treatment expression level in the animal ("pre-treatment") to determine the ratio of "normalized to pre-treatment" expression. The expression at a specific time point was then normalized to the saline control group by dividing the "normalized to pre-treatment" ratio of the individual animal by the average "normalized to pre-treatment" ratio of all mice in the saline control group.

[0496] Example 11. FXII RNAi Substances in the FXII-SEAP Mouse Model

[0497] The FXII-SEAP mouse model described in Example 10 above was used. On day 1, each mouse was subcutaneously injected with a single dose of 200 μl of saline without FXII RNAi material as a control, or 200 μl of an amount containing FXII RNAi material, according to Table 20 below.

[0498] Table 20. Dosing groups of FXII-SEAP mice of Example 11.

[0499]

[0500]

[0501] Each FXII RNAi agent includes an N-acetyl-galactosamine targeting ligand coupled to the 5′ end of the sense strand, as shown in Tables 4 and 5. The injections were injected (i.e., subcutaneously) into the loose skin of the neck and shoulder area between the skin and muscle. Three (3) mice were tested in each group (n=3). Serum was collected on the first 3 days, 8 days, 15 days, 22 days, and 29 days, and the SEAP expression level was determined according to the procedure described in Example 10 above. The data from the experiment are shown in Table 21 below, where the average SEAP reflects the standardized mean value of SEAP:

[0502] Table 21. Mean SEAP in FXII-SEAP mice from Example 11 normalized to pre-treatment and saline controls.

[0503]

[0504]

[0505] Each of the FXII RNAi substances tested in Example 11 showed significant inhibition of FXII expression in the SEAP mouse model compared to the control.

[0506] Example 12. FXII RNAi Substances in the FXII-SEAP Mouse Model

[0507] The FXII-SEAP mouse model described in Example 10 above was used. According to Table 22 below, on day 1, each mouse was subcutaneously injected with a single 200 μl saline solution without FXII RNAi material as a control, or 200 μl containing 1.0 mg / kg FXII RNAi material.

[0508] Table 22. Dosing groups of FXII-SEAP mice of Example 12.

[0509] Group RNAi substances and dosage Dosage regimen 1 brine Single injection on day 1 2 1mpk AD04625 Single injection on day 1 3 1mpk AD05330 Single injection on day 1 4 1mpk AD05331 Single injection on day 1 5 1mpk AD05332 Single injection on day 1 6 1mpk AD05333 Single injection on day 1 7 1mpk AD05334 Single injection on day 1 8 1mpk AD05335 Single injection on day 1 9 1mpk AD05336 Single injection on day 1 10 1mpk AD05337 Single injection on day 1 11 1mpk AD05338 Single injection on day 1 12 1mpk AD05339 Single injection on day 1 13 1mpk AD05340 Single injection on day 1

[0510] Each FXII RNAi agent includes an N-acetyl-galactosamine targeting ligand coupled to the 5′ end of the sense strand, as shown in Tables 4 and 5. Injections were injected between the skin and muscle (i.e., subcutaneously) into the loose skin of the neck and shoulder area. Three (3) mice were tested in each group (n=3). Serum was collected on the first 2 days, 8 days, 15 days, 22 days, 29 days, and 36 days, and SEAP expression levels were determined according to the procedure described in Example 10 above. The data from the experiment are shown in Table 23 below, where the average SEAP reflects the average value of SEAP normalized (to pre-treatment only):

[0511] Table 23. Mean SEAP in FXII-SEAP mice from Example 12 normalized to pre-treatment.

[0512]

[0513]

[0514]

[0515] As shown in Table 23, almost all tested FXII RNAi agents showed significant inhibition of FXII expression in the SEAP mouse model compared to the control. For example, at day 15, AD04625, AD05330, and AD05331 each showed approximately 95% knockdown compared to pre-treatment expression levels.

[0516] Example 13. FXII RNAi Substances in the FXII-SEAP Mouse Model

[0517] The FXII-SEAP mouse model described in Example 10 was used. On day 1, each mouse was subcutaneously injected with a single dose of 200 μl of saline without FXII RNAi material as a control, or 200 μl of a certain amount of FXII RNAi material according to Table 24 below.

[0518] Table 24. Dosing groups of FXII-SEAP mice of Example 13.

[0519] Group RNAi substances and dosage Dosage regimen 1 Saline (no RNAi material) Single injection on day 1 2 0.25mg / kg AD04625 Single injection on day 1 3 0.5mg / kg AD04625 Single injection on day 1 4 1.0mg / kg AD04625 Single injection on day 1 5 0.5mg / kg AD05331 Single injection on day 1 6 1.0mg / kg AD05331 Single injection on day 1 7 0.25mg / kg AD05333 Single injection on day 1 8 0.5mg / kg AD05333 Single injection on day 1 9 1.0mg / kg AD05333 Single injection on day 1 10 1.0mg / kg AD05336 Single injection on day 1 11 0.5mg / kg AD05339 Single injection on day 1 12 1.0mg / kg AD05339 Single injection on day 1

[0520] Each FXII RNAi agent includes an N-acetyl-galactosamine targeting ligand coupled to the 5′ end of the sense strand, as shown in Tables 3 and 4. The injections were injected (i.e., subcutaneously) into the loose skin of the neck and shoulder area between the skin and muscle. Three (3) mice were tested in each group (n=3). Serum was collected on the first 3 days, 8 days, 15 days, 22 days, and 29 days, and the SEAP expression level was determined according to the procedure described in Example 10 above. The data from the experiment are shown in Table 25 below, where the average SEAP reflects the average value of SEAP normalized (to pre-treatment only):

[0521] Table 25. Mean SEAP in FXII-SEAP mice from Example 13 normalized to pre-treatment.

[0522]

[0523]

[0524] Other Implementations

[0525] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages and modifications are within the scope of the appended claims.

Claims

1. An RNAi substance for inhibiting factor XII (FXII) gene expression, wherein the RNAi substance comprises a sense strand and an antisense strand, wherein the antisense strand comprises nucleotides 2-18 of any antisense strand sequence in Table 2, Table 3 or Table 6, and wherein the sense strand is at least partially complementary to the antisense strand.

2. An RNAi substance for inhibiting factor XII (FXII) gene expression, wherein the RNAi substance comprises a sense strand and an antisense strand, wherein the sense strand comprises nucleotides 2-18 of any sense strand sequence in Table 2, Table 4 or Table 6, and wherein the antisense strand is at least partially complementary to the sense strand.

3. The RNAi agent of claim 1, wherein the antisense strand comprises a nucleotide sequence of any one of the antisense strand sequences in Table 2, Table 3 or Table 6.

4. The RNAi agent of claim 2, wherein the sense strand comprises a nucleotide sequence of any sense strand sequence in Table 2, Table 4 or Table 6.

5. The RNAi agent of claim 1, wherein the sense strand comprises a nucleotide sequence of any sense strand sequence in Table 4, and the antisense strand comprises a nucleotide sequence of any antisense strand sequence in Table 3.

6. The RNAi agent of any one of claims 1 to 5, wherein the RNAi agent comprises at least one modified nucleotide.

7. The RNAi agent of claim 6, wherein the modified nucleotide is selected from the group consisting of 2′-O-methyl nucleotides, 2′-fluoro nucleotides, 2′-deoxy nucleotides, 2′,3′-open ring nucleotide mimetics, locked nucleotides, 2′-F-arabino nucleotides, 2′-methoxyethyl nucleotides, abasic ribose, ribitol, reverse nucleotides, reverse abasic nucleotides, reverse 2′-OMe nucleotides, reverse 2′-deoxy nucleotides, 2′-amino modified nucleotides, 2′-alkyl modified nucleotides, morpholino nucleotides, cyclopropylphosphonic acid deoxyribonucleotides and 3′-OMe nucleotides.

8. The RNAi agent of any one of claims 1-5, wherein the RNAi agent comprises at least one phosphorothioate internucleoside linkage.

9. The RNAi agent of any one of claims 1-5, wherein the sense strand comprises at least one phosphorothioate internucleoside linkage.

10. The RNAi agent of any one of claims 1-5, wherein the antisense strand comprises 1, 2, 3 or 4 phosphorothioate internucleoside linkages.

Images