Adeno-associated virus retinal cell-tropic capsid mutant and its application

By inserting a heterologous peptide at the AAV capsid protein Q574 position, AAV capsid protein is modified to improve retinal cell tropism and construct recombinant adeno-associated viral vectors, the problems of infection efficiency and immune evasion in the treatment of retinal diseases are solved, and more efficient gene transmission and long-term expression are achieved.

CN119552222BActive Publication Date: 2025-08-08ACADEMY OF MILITARY MEDICAL SCIENCES
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202510112439.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-24
Publication Date
2025-08-08
Estimated Expiration
2045-01-24

AI Technical Summary

Technical Problem

In the treatment of retinal diseases, it is difficult to achieve efficient and specific infection of retinal cells, and there is a problem of insufficient immune evasion ability.

Method used

By inserting heterologous peptides, especially V2 and V5 heterologous peptides at the Q574 position of the AAV capsid protein, the AAV capsid protein is engineered to improve retinal cell tropism, construct recombinant adeno-associated viral vectors, and bioeffector molecules such as the Crry gene or the Nrf2 gene are introduced into the vector to enhance immune regulation capabilities.

Benefits of technology

The modified AAV capsid protein mutants showed faster gene delivery kinetics and higher long-term expression levels of intraocular transgenes in BALB/cJ and C57BL/6J mouse models, especially in the specific transduction of the RPE cell layer, significantly improving the therapeutic effect of retinal disease.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119552222B_ABST
    Figure CN119552222B_ABST
Patent Text Reader

Abstract

The present invention discloses an adeno-associated virus (AAV) capsid mutant with retinal cell tropism and its application. The AAV capsid protein mutant is designed by inserting a heterologous peptide after Q574 of the AAV type 5 capsid protein to enhance the retinal cell tropism of the capsid protein, as well as a recombinant AAV vector containing the gene encoding the mutant. The recombinant AAV vector provided by the present invention has enhanced retinal cell infection tropism and has potential application as a delivery vector for the preparation of drugs for treating retinal diseases.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present disclosure relates to the technical field of viral vectors, and in particular to a recombinant adeno-associated virus targeting the retina and applications thereof. Background Art

[0002] Adeno-associated virus (AAV) is a small, non-enveloped virus with single-stranded DNA, measuring 24 to 26 nm in diameter. Its genome consists of the Rep and Cap genes, flanked by two ITRs. AAV requires the assistance of a helper virus for DNA replication. AAV attaches to the cell surface through receptors, triggering intracellular endocytosis signals and infecting target cells. Next, the virion is released from the endosome, releasing its single-stranded DNA, which is then converted to double-stranded DNA within the cell. AAV genes can be expressed long-term in non-dividing cells.

[0003] Retinal diseases, including Leber hereditary optic neuropathy (LHON), Leber congenital amaurosis (LCA), Stargardt disease, and age-related macular degeneration (AMD), can significantly impair patients' ability to lead independent lives and perform daily activities, yet effective treatments remain lacking. As one of the most promising gene delivery tools, AAV offers advantages such as high delivery efficiency and long-lasting expression, potentially revolutionizing the treatment of ocular diseases, particularly retinal disorders.

[0004] Due to the diverse pathogenesis of different fundus diseases, the AAV virus requires different cellular levels to be infected when treating retinal diseases. Different AAV serotypes have varying transduction efficiencies and ocular tissue tropisms. Modifying the AAV vector capsid can alter its tissue tropism, transduction efficiency, and ability to evade host immune responses. The present invention aims to screen recombinant AAV vectors with enhanced retinal infection efficiency and more specific cell tropism through capsid modification, and to provide their use in the preparation of gene therapy drugs for retinal diseases. Summary of the Invention

[0005] Based on the above objectives, the present invention first provides a heterologous peptide for increasing the tropism of adeno-associated virus capsid protein for retinal cells, wherein the sequence of the heterologous peptide is shown in SEQ ID NO. 3 or 9. In the present invention, the mutant having the sequence of SEQ ID NO. 3 is designated as the V2 heterologous peptide, and the mutant having the sequence of SEQ ID NO. 9 is designated as the V5 heterologous peptide.

[0006] Secondly, the present invention provides a polynucleotide encoding the above-mentioned heterologous peptide, the sequence of the polynucleotide is shown in SEQ ID NO.4 or 10, wherein the polynucleotide sequence encoding the heterologous peptide V2 with a sequence such as SEQ ID NO.3 is shown in SEQ ID NO.4, and the polynucleotide sequence encoding the heterologous peptide V5 with a sequence such as SEQ ID NO.9 is shown in SEQ ID NO.10.

[0007] Thirdly, the present invention provides an adeno-associated virus capsid protein mutant containing the aforementioned heterologous peptide. The term "containing" in the present invention means that the heterologous peptide is inserted into the adeno-associated virus capsid protein.

[0008] In a preferred embodiment, the insertion position of the heterologous peptide is located after Q574 of the adeno-associated virus capsid protein amino acid sequence. The adeno-associated virus capsid protein amino acid sequence of the present invention is based on the adeno-associated virus capsid protein amino acid sequence represented by Genbank ID YP_068409.1, and the insertion site is located in the variable region VIII.

[0009] In a more preferred embodiment, the amino acid sequence of the adeno-associated virus type 5 capsid protein mutant is shown in SEQ ID NO. 11 or 13. In the present invention, the adeno-associated virus type 5 capsid protein mutant having SEQ ID NO. 11 is named mutant #2, and the adeno-associated virus type 5 capsid protein mutant having SEQ ID NO. 13 is named mutant #5.

[0010] Fourth, the present invention provides a polynucleotide encoding the aforementioned adeno-associated virus capsid protein mutant, the sequence of the polynucleotide being shown in SEQ ID NO. 12 or 14. In the present invention, the sequence of the polynucleotide encoding the amino acid sequence shown in SEQ ID NO. 11 is shown in SEQ ID NO. 12, and the sequence of the polynucleotide encoding the amino acid sequence shown in SEQ ID NO. 13 is shown in SEQ ID NO. 14.

[0011] Fifth, the present invention provides a vector containing a polynucleotide encoding the above-mentioned adeno-associated virus capsid protein mutant.

[0012] In a preferred embodiment, the vector further contains genes encoding biological effector molecules and / or biomarker molecules. The genes encoding biological effector molecules described herein include, but are not limited to, the Crry gene or the Nrf2 gene. Crry (CR1-related protein Y) described herein encodes an important cell surface complement regulatory receptor that plays a key role in regulating the activity of the complement system, regulating both the classical and alternative complement pathways. As a membrane protein, Crry is a key cellular regulator of complement activation in mice, regulating complement system activity by inhibiting C3 activation. Nrf2 (Nuclear factor erythroid 2-related factor 2) encodes nuclear factor E2-related factor 2, a key transcription factor that plays a central role in cellular anti-oxidative stress responses. It protects cells from oxidative stress and inflammatory damage through multiple mechanisms and plays a crucial role in the prevention and treatment of various diseases. The biomarker molecules described herein may also include, but are not limited to, the green fluorescent protein (GFP) gene or the luciferase gene.

[0013] In a more preferred embodiment, the vector is a recombinant adeno-associated virus vector. In a specific embodiment of the present invention, the adeno-associated virus is adeno-associated virus type 5.

[0014] Finally, the present invention provides the use of the aforementioned recombinant adeno-associated viral vector in the preparation of a drug for treating retinal diseases. In some examples of such applications, the retinal disease is selected from any one of Leber hereditary optic neuropathy (LHON), Leber congenital amaurosis (LCA), Stargardt disease, and age-related macular degeneration (AMD). These diseases are all accompanied by damage or degenerative changes in the RPE layer, leading to impaired photoreceptor function and, in turn, decreased vision. The aforementioned recombinant adeno-associated viral vector can be used to deliver therapeutic genes to the RPE layer, alleviating pathological damage to the RPE.

[0015] The beneficial effects of the present invention are that compared with the parental serotype AAV5, the #2 mutant and the #5 mutant exhibit faster gene delivery kinetics and higher long-term expression levels of intraocular transgenes in BALB / cJ and C57BL / 6J mouse models, especially in the specific transduction of the RPE cell layer.

[0016] The adeno-associated virus capsid protein and the adeno-associated virus containing the same disclosed in the present invention have the characteristics of enhanced retinal transduction ability, can be used as a delivery vector for the treatment of retinal-related diseases, and play an important role in expanding AAV-related gene therapy. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 Schematic diagram of the production and screening of capsid variants from an AAV5 viral library using peptide display;

[0018] Figure 2 This is the plasmid map of the pAIRC vector;

[0019] Figure 3 Flow cytometry was used to analyze the transduction efficiency of rAAVs in 293T cell lines;

[0020] Figure 4 The histogram shows the percentage of transfected 293T cells gated for EGFP-positive cells as determined by flow cytometry;

[0021] Figure 5 Flow cytometry was used to analyze the transduction efficiency of rAAVs in the 661W cell line;

[0022] Figure 6 The histogram shows the percentage of transfected 661W cells gated for EGFP-positive cells as determined by flow cytometry;

[0023] Figure 7 Firefly luciferase activity was measured using a luminometer after rAAVs transduction into 293T cells;

[0024] Figure 8 Firefly luciferase activity was measured using a luminometer after rAAVs transduction into 661W cells;

[0025] Figure 9 This is an in vivo imaging test after recombinant AAVs-luc was injected into the vitreous cavity of BALB / cJ mice.

[0026] Figure 10 This is an in vivo imaging test after recombinant AAVs-luc was injected into the vitreous cavity of C57BL / 6J mice.

[0027] Figure 11 To analyze the gene expression level of recombinant AAVs-luc after intravitreal injection into BALB / cJ mice;

[0028] Figure 12 Analysis of gene expression levels after recombinant AAVs-luc injection into the vitreous cavity of C57BL / 6J mice. DETAILED DESCRIPTION

[0029] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, these embodiments are merely exemplary and do not constitute any limitation on the scope of protection defined by the claims of the present invention.

[0030] Example 1: Screening of AAV5 capsid mutants

[0031] Figure 1 The steps for the production and screening of capsid variants from an AAV5 viral library by peptide display are given.

[0032] (1) Construction of AAV5 backbone plasmid

[0033] The Rep gene was provided by AAV2 plasmid (Takara, 6230), the Cap gene was provided by AAV5 plasmid (Aonogene, pAAV-RC5), and the backbone vector was provided by pAAV-ITR-MCS plasmid (Takara, 6230). The Rep gene and Cap gene were cloned between the two ITRs on the backbone plasmid to construct the pAIRC vector containing the wild-type AAV genome (see the pAIRC vector plasmid map for details). Figure 2 ). The primers for amplifying the Rep gene and Cap gene are as follows:

[0034] Rep forward primer: 5'-gtttgaacgcgcagccgccatgccggggttttacgagattg-3' (SEQ ID NO.15),

[0035] Rep reverse primer: 5'-catacctgGCTAGCcatttattgttcaaagatgcagtcatcc-3' (SEQ ID NO.16);

[0036] Cap forward primer: 5'-caataaatgGCTAGCcaggtatgtcttttgttgatcaccctcc-3' (SEQ ID NO. 17);

[0037] Cap reverse primer: 5'-gattaacaagcaaACTAGTttaaaggggtcgggtaagg-3' (SEQ ID NO. 18).

[0038] (2) Construction of a 7-peptide-displayed AAV5 mutant plasmid library

[0039] Using pAIRC as the basic backbone vector, a sequence encoding 7 amino acids (aa) was inserted after Q574 on the AAV5 capsid using a trimer primer (completed by Suzhou Hongxun Biotechnology Co., Ltd.), generating an AAV5-NNK plasmid library. Finally, a 21-base random sequence was inserted after Cap Q574: NNK NNK NNK NNK NNK NNK NNK, generating 10 6 The purified plasmid library was electroporated into NEB 10-beta E. coli competent cells (NEB, C3019H).

[0040] (3) Construction of AAV5 mutant virus library

[0041] The AAV5-NNK plasmid library was co-transfected with the Ad Helper plasmid (Takara, 6230) into 293T cells using polyethyleneimine (polyciences, 23966) to generate the corresponding AAV viral library. 293T cells were harvested 72 hours after transfection and the virus was harvested by lysing the cells using three cycles of rapid freeze / thaw cycles.

[0042] (4) Amplification of AAV5 mutant virus library

[0043] Ad Helper was transfected into 293T cells. 24 h after transfection, the first-round packaged AAV virus library was used to infect the cells. 48 h after infection, the 293T cells were collected and the viruses were obtained by three rounds of rapid freezing / thawing and lysing the cells.

[0044] (5) Screening of AAV5 mutants

[0045] The screening process of AAV5 capsid mutants is as follows Figure 1 As shown in the figure (screening is based on the principle of engineering AAV capsid to change cell tropism), the packaged AAV5 mutant virus library was cultured at an MOI of 10 4 Infect 661W cell line (mouse retinal photoreceptor cells) ,BNCC,353554), 6 h after infection, the cells were centrifuged and washed twice with PBS to remove AAVs not bound to 661W cells. The AAV genome was extracted using a DNA extraction kit, and the recombinant CAP (rCap) gene sequence was amplified by PCR using the corresponding primers (Cap forward primer (SEQ ID NO. 17) and Cap reverse primer (SEQ ID NO. 18)).

[0046] The amplified rCap gene was cloned into the pAIRC vector digested with NheI and SpeI using the Gibson homologous recombination kit to construct a new plasmid library. This library was then electroporated into NEB 10-beta E. coli competent cells and inoculated into 5 mL of ampicillin-resistant LB medium. After culture, the plasmid was extracted using a plasmid extraction kit. This was the peptide-displaying AAV5 mutant plasmid library after the first round of screening. This library was then used again for AAV5 packaging and a second round of screening.

[0047] Perform the above three rounds of in vitro screening, extract the AAV genome from the cells after the third round of screening using a DNA extraction kit, and design corresponding primers for PCR amplification:

[0048] NGS F(5'→3'): caacatgctcatcaccag (SEQ ID NO.19);

[0049] NGS R(5'→3'): gtacacgtccctctccatc (SEQ ID NO. 20).

[0050] After amplification, a 170-bp sequence (caacatgctcatcaccagcgagagcgagacgcagccggtgaaccgcgtggcgtacaacgtcggcgggcagatggccaccaacaaccagXXXagctccaccactgcccccgcgaccggcacgtacaacctccaggaaatcgtgcccggcagcgtgtggatggagagggacgtgtac) was obtained for next-generation sequencing (NGS) analysis. DNA fragment size was confirmed by gel electrophoresis, and the target band was recovered using a gel extraction kit. The purified PCR fragments were sent to a sequencing company for high-throughput sequencing. The frequently inserted peptide sequences and their detection frequencies are shown in Table 1. The peptide insertion position is after the glutamine Q at position 574 of the wild-type AAV5 CAP protein. After the peptide V5 shown in the sequence of SEQ ID NO.9 is inserted into the wild-type AAV5 CAP protein original sequence, a Cap protein mutant (#5) with a sequence shown in SEQ ID No.13 is obtained; and after the peptide V2 shown in the sequence of SEQ ID NO.3 is inserted, a Cap protein mutant (#2) with a sequence shown in SEQ ID No.11 is obtained.

[0051] Table 1. Frequency and amino acid sequence of inserted oligopeptides detected in 9,323,750 peptide sequences

[0052]

[0053] Example 2: Construction of AAV5 capsid protein mutants and virus packaging

[0054] The coding sequences shown in SEQ ID NOs. 2, 4, 6, 8, and 10 were designed onto the homology arms using primers. These sequences were then ligated into the Cap gene Q574 of the pAAV-RC5 plasmid using Gibson assembly to construct a helper plasmid encoding the recombinant capsid protein. The eGFP or luciferase transgene was packaged into the pAAV-CMV-MCS vector and co-transfected with the pAAV-RC5 helper plasmid and an adeno-associated virus helper plasmid into 293T cells to package recombinant AAV expressing either fluorescent reporter gene. After three freeze-thaw cycles, the cells were treated with nuclease (50 U / ml) at 37°C for 1 hour. Cell debris was removed by centrifugation, and recombinant AAV-eGFP or AAV-Luciferase was titrated by qPCR using CMV primers.

[0055] CMV F primer: 5'-ttcctacttggcagtacatctacg-3' (SEQ ID No. 21),

[0056] CMV R primer: 5'-gtcaatggggtggagacttgg-3' (SEQ ID No. 22).

[0057] Example 3: In vitro functional verification of recombinant AAV5 virus

[0058] 293T cells or 661W cells in the logarithmic growth phase were seeded in 48-well plates and cultured overnight. 4 293T and 661W cell lines were transduced with AAV-eGFP or AAV-luciferase at an MOI of 1:1. WT-AAV5, AAV5-STCVNTNRA-CMV-eGFP (rAAV5 #1), AAV5-PGRSNST-CMV-eGFP (rAAV5 #5), AAV5-PNSPNRV-CMV-eGFP (rAAV5 #3), AAV5-STCVSTNRA-CMV-eGFP (rAAV5 #4), and AAV5-KGMSNVI-CMV-eGFP (rAAV5 #2) were used, respectively. After 48 h, the cells were trypsinized, washed twice with PBS, and resuspended. Live / dead staining was performed, and eGFP expression was analyzed by flow cytometry. Samples were acquired using a BD FACSCanto, and the number of eGFP-positive cells in the live or dead cell population was counted using FlowJo 10.8.1 software. The % Parent of the gated cells was then used to determine the transduction differences of rAAVs.

[0059] Figure 3 、 Figure 5 Shown are graphs showing the results of flow cytometric analysis of transduced 293T and 661W cell lines. Figure 4 and Figure 6 The histograms of the percentage of eGFP-positive cells gated for transfected 293T and 661W cell lines, respectively, as determined by flow cytometry (* p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001), Figure 4 and Figure 6 The results showed that the GFP expression of mutants #2 (16.9% in 293T and 4.3% in 661W), #4 (18.1% in 293T and 4.1% in 661W) and #5 (9.9% in 293T and 2.8% in 661W) after infection in 293T and 661W cells was significantly higher than that of WT AAV5 (6.4% in 293T and 0.9% in 661W).

[0060] On the other hand, for cells infected with AAV-luciferase, luciferase substrate was added to the cells 48 hours after infection. Luciferase reacted with the substrate to produce fluorescence. The intensity of the fluorescence was measured to determine the activity of luciferase and evaluate the gene expression level of the AAV mutant ( Figure 7 and Figure 8 ) The expression levels of luciferase in 293T cells infected with mutants #1, #2, #4, and #5 (RLU for #1 was 6.48×10 5 , the RLU of #2 is 1.58×10 6 , the RLU of #4 is 1.49×10 6 , the RLU of #5 is 2.20×10 6 ) was significantly higher than that of WT AAV5 (RLU was 6.20×10 4 ). In 661W cells, only the luciferase expression level after infection with the #5 mutant (RLU was 3.23×10 3 ) was significantly higher than that of WT AAV5 (RLU was 1.31×10 3 These results suggest that the capsid alteration of mutant #5 significantly enhances the transduction efficiency of AAV5 in 293T and 661W cell lines in vitro.

[0061] Example 4: Verification of in vivo transduction efficiency of recombinant AAV5 virus

[0062] Mice were anesthetized by intraperitoneal injection of ketamine (0.1 mg / g), and 1 μL of virus solution (10 11 The needle was positioned at 100 copies / μL (100 copies / μL) and positioned under a stereomicroscope to confirm needle positioning. The sclera, choroid, and retina were punctured, and the rAAV vector solution was injected into the mouse vitreous under direct visualization. Three mice were injected with each virus. After injection, erythromycin ointment was applied to the eyes, and the animals were placed on a heat pad to maintain body temperature during recovery.

[0063] The expression of luciferase in the mouse eyes was detected by in vivo imaging at 1, 2, 3, 4, 8, 12, and 24 weeks after injection. In BALB / cJ mice, the expression level of luciferase in the eyes of mutants #2 and #5 was higher than that of WT AAV5 ( Figure 9 and Figure 11 ), among which the luciferase expression level of mutant #5 was significantly higher than that of WT AAV5 at all time points tested.

[0064] In C57BL / 6J mice, the ocular luciferase expression level of mutant #5 was higher than that of WT AAV5 at all time points tested ( Figure 10 and Figure 12 ) Except for the 4th week after injection, the luciferase expression levels of mutant #5 and WT AAV5 were statistically different.

Claims

1. An adeno-associated virus capsid protein mutant containing a heterologous peptide, characterized in that: The insertion position of the heterologous peptide is located after Q574 of the amino acid sequence of the adeno-associated virus type 5 capsid protein. The amino acid sequence of the adeno-associated virus capsid protein mutant containing the heterologous peptide is shown in SEQ ID NO.

13.

2. A polynucleotide encoding the adeno-associated virus capsid protein mutant according to claim 1, characterized in that: The sequence of the polynucleotide is shown in SEQ ID NO.

14.

3. A vector containing the polynucleotide encoding the adeno-associated virus capsid protein mutant according to claim 2.

4. The carrier according to claim 3, characterized in that The vector also contains genes encoding biological effector molecules and / or biological marker molecules.

5. The carrier according to claim 4, characterized in that The vector is a recombinant adeno-associated virus vector.

6. Use of the carrier according to claim 5 in the preparation of drugs for treating retinal diseases.

Citation Information

Patent Citations

  • Retina and muscle high-affinity adeno-associated virus (AAV) capsid protein and related application

    CN113121652A

  • Novel muscle and retina specific adeno-associated virus (AAV) capsid protein

    CN113121653A

  • Eye and muscle specific targeting adeno-associated virus vector and application thereof

    CN113121655A