A highly effective and broad-spectrum biocontrol bacterium Pseudomonas FM36 and its application

Abstract

The present application discloses a highly effective and broad-spectrum biocontrol bacterium Pseudomonas FM36 and its application. The Pseudomonas aestivum is strain FM36, which is classified and named Pseudomonas aestivum Pseudomonas rye , deposited in the General Microbiology Center of China Microorganism Culture Collection Committee, with the deposit number of CGMCC NO.32868. The present application also provides the use of the above-mentioned Pseudomonas aestivum FM36 strain in promoting tomato growth, preventing and controlling plant viruses and pathogenic fungi. The Pseudomonas aestivum provided in the present application has a promoting effect on tomato growth and yield increase, and has an effect on tobacco mosaic virus (TMV) and red pepper vein mottle virus (ChiVMV), as well as Rhizoctonia solani ( Rhizoctonia solani )、Pyricularia grisea( Magnaporthe rice )、Alternaria tenuifolia( Alternaria tenuissima )、White wax spiny spore ( Colletotrichum spaethianum ), Fusarium spp. Cuban type ( Fusarium oxysporum f.sp. from Cuba ) and other pathogenic fungi showed obvious antagonistic and inhibitory effects.

Description

Technical Field

[0001] The present application belongs to the technical field of biological control of plant diseases, and specifically relates to a strain of Pseudomonas aestivum FM36, and the application of the strain in preventing and controlling plant viral diseases and plant fungal diseases, promoting tomato growth, etc. Background Art

[0002] Plant virus diseases are known as "plant cancers", among which tobacco mosaic virus genus ( Tobamovirus ) is one of the most common and harmful plant viruses in the world. It is reported that TMV alone causes more than $100 million in damage worldwide each year. Potatovirus Y ( Potyvirus ) is one of the main viruses that cause serious damage to pepper and tobacco production in Asia. In some areas of my country, ChiVMV has surpassed TMV to become the most serious virus that harms tobacco. Fungal diseases are the number one disease that harms crops. Rice, bananas and chives are important food and cash crops, and they are extremely susceptible to invasion and damage by pathogenic fungi during cultivation. As one of the most important food crops in the world, the production safety of rice has attracted much attention. However, the rice blast fungus ( Magnaporthe rice ) and rice blast caused by Rhizoctonia solani ( Rhizoctonia solani ) is widely distributed in various rice-producing areas, seriously threatening rice yield and quality. Banana wilt is widely distributed in banana-growing areas in Asia, Africa, Oceania, the South Pacific and the Americas. Its pathogen is Fusarium oxysporum Cuban type ( Fusarium oxysporum f. sp. from Cuba , Foc) species 4 are listed in the list of quarantine pests for imported plants and the national list of quarantine pests for agricultural plants. As a widely used seasoning vegetable, chives occupy an important position in the vegetable industry in many regions of my country. However, when chives are planted in high density all year round, the fungus caused by Colletotrichum fraxini ( Colletotrichum spaethianum ) caused by chive anthracnose and Alternaria tenuissima ( Alternaria tenuissima ) have become increasingly prominent, becoming the two main diseases affecting chive yield and quality.

[0003] Chemical control is one of the commonly used measures for plant disease control. However, the large-scale use of chemical pesticides has brought about a series of problems, such as the destruction of natural ecosystems, the enhancement of plant pathogen resistance, the impact on the survival of non-target organisms, and the endangerment of human and animal health by pesticide residues. Viral diseases are called "plant cancer" because of their extremely complex occurrence, infection and transmission mechanisms. There has always been a lack of effective prevention and control agents and technologies for the prevention and control of viral diseases. Therefore, plant viral diseases have brought extremely serious and widespread harm to agricultural production and are a global problem in current agricultural production. Cultivating and utilizing resistant varieties is also one of the effective measures to prevent and control plant diseases, but this method has problems such as long breeding cycle and high cost. Microbial products have the advantages of rich exploitable resources, low production cost, environmental friendliness and no drug residues. More and more researchers are investing in the research and creation of microbial biocontrol products, committed to developing new green microbial products, and vigorously promoting green disease control measures.

[0004] Pseudomonas bacteria ( Pseudomonas spp.) are widely present in various ecological environments and can inhibit plant diseases by promoting plant growth and producing antibacterial secondary metabolites. At present, there have been many research reports on the use of biocontrol Pseudomonas to control viral and fungal diseases. However, the practical application of Pseudomonas in biological control of plant diseases is still rare, mainly facing problems such as poor strain stability and lack of efficient and broad-spectrum strain resources. At present, the development and utilization of Pseudomonas bacteria in disease resistance and growth promotion is still not sufficient. Therefore, it is particularly important to screen biocontrol bacteria and develop their functions. It can also provide a new type of biological control resource for protecting crop health, effectively controlling and reducing crop diseases, and promoting sustainable agricultural development. Summary of the invention

[0005] To solve the problems existing in the above-mentioned technologies, the present application provides a wheat Pseudomonas strain FM36 and describes its application in preventing and controlling various plant diseases and promoting tomato growth, thereby providing a new microbial resource for disease resistance and yield increase of crops.

[0006] On the one hand, the present application provides a Pseudomonas aeruginosa ( Pseudomonas siliqua ) FM36, the wheat Pseudomonas FM36 was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on December 2, 2024, with the deposit number CGMCC NO. 32868; the classification name is wheat Pseudomonas Pseudomonas siliqua .

[0007] On the other hand, the present application also provides a strain fermentation broth, including the above-mentioned Pseudomonas aestivum FM36.

[0008] On the other hand, the present application also provides a crude protein extract, comprising the above-mentioned Pseudomonas aestivum FM36.

[0009] On the other hand, the present application also provides an application of a wheat Pseudomonas fermentation liquid in preventing and controlling plant viruses. The wheat Pseudomonas fermentation liquid contains the above-mentioned wheat Pseudomonas FM36; the plant viruses contain tobacco mosaic virus and / or red pepper vein mottle virus.

[0010] On the other hand, the present application also provides an application of a crude protein extract of Pseudomonas aestivum in preventing and controlling plant viruses, wherein the Pseudomonas aestivum is the above-mentioned Pseudomonas aestivum FM36; the plant viruses include tobacco mosaic virus and / or red pepper vein mottle virus.

[0011] On the other hand, the present application also provides an application of Pseudomonas aestivum in inhibiting plant pathogenic fungi, wherein the fermentation liquid of Pseudomonas aestivum comprises the above-mentioned Pseudomonas aestivum FM36, and the plant pathogenic fungi is Rhizoctonia solani ( Rhizoctonia solani )、Pyricularia grisea( Magnaporthe rice )、Alternaria tenuifolia( Alternaria very thin )、White wax spiny spore ( Colletotrichum spaethianum ) or / and Fusarium spp. Cuban specific type ( Fusarium oxysporum f. sp. from Cuba ).

[0012] On the other hand, the present application also provides a use of Pseudomonas aestivum in promoting tomato growth and increasing yield, wherein the Pseudomonas aestivum is the above-mentioned Pseudomonas aestivum FM36.

[0013] Beneficial Effects

[0014] 1. The Pseudomonas aestivum strain FM36 provided in the present application, the fermentation broth and crude protein extract thereof can induce Nicotiana benthamiana plants to produce resistance to tobacco mosaic virus (TMV), thereby inhibiting the systemic infection of TMV in Nicotiana benthamiana.

[0015] 2. The fermentation liquid and crude protein extract of the wheat Pseudomonas aeruginosa strain FM36 provided in the present application can effectively inactivate TMV virus particles, thereby inhibiting the virus from infecting plants. Specifically, the inhibitory effects of these two substances on TMV are 72.04% and 82.66%, respectively.

[0016] 3. The wheat Pseudomonas strain FM36 provided in the present application, its fermentation broth and crude protein extract can effectively inactivate the viral particles of red pepper vein mottle virus (ChiVMV), thereby inhibiting the systemic infection of ChiVMV to common tobacco K326 plants. Specifically, the inhibitory effects of these two substances on ChiVMV are 85.28% and 70.55%, respectively.

[0017] 4. The wheat Pseudomonas strain FM36 provided in the present application has a significant inhibitory effect on a variety of plant pathogenic fungi. Specifically, it can effectively inhibit the mycelial growth of Rhizoctonia solani, Magnaporthe oryzae, Alternaria tenuissima, Colletotrichum affine and Cuban specialization of Fusarium lanceolatum, with inhibition rates of 72.3%, 70.8%, 62.3%, 51.8% and 48%, respectively. Therefore, the strain has a good control effect on diseases such as rice sheath blight, rice blast, chive leaf spot, chive anthracnose and banana wilt.

[0018] 5. The Pseudomonas aeruginosa FM36 strain provided in the present application has the ability to secrete IAA, thereby promoting the growth of tomatoes, increasing the number of tomato stamens, and thereby increasing tomato yield by 5.48%.

[0019] The present application provides a new beneficial microbial resource, which can not only promote crop growth, but also economically and effectively prevent and control crop viral diseases and fungal diseases.

[0020] It should be understood that the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the present application. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] The above and other objects, features and advantages of the present application will become more apparent through a more detailed description of exemplary embodiments of the present application in conjunction with the accompanying drawings.

[0022] Figure 1 The morphology and Gram staining identification results of Pseudomonas aestivum FM36 strain;

[0023] Wherein, a is the growth state of Pseudomonas aestivum FM36 strain on LB medium;

[0024] b is the bacterial morphology of Pseudomonas aestivum FM36 strain under transmission electron microscope;

[0025] c is the Gram staining result of Pseudomonas agriculturae FM36 strain.

[0026] Figure 2 Phylogenetic tree of Pseudomonas tritici strain FM36 and other Pseudomonas strains based on 16S rRNA gene;

[0027] The red triangle represents the Pseudomonas aestivum FM36 strain obtained in the present application.

[0028] Figure 3 The preventive effect of the fermentation liquid of Pseudomonas aestivum FM36 on TMV;

[0029] Among them, a is the preventive effect of the fermentation liquid of Pseudomonas agriculturae FM36 strain on TMV observed under natural light and ultraviolet light;

[0030] b is the qRT-PCR detection of the inhibition of TMV in Nicotiana benthamiana by the fermentation broth of Pseudomonas aestivum FM36 mp Resulting in RNA accumulation.

[0031] Figure 4 The preventive effect of crude protein extract of Pseudomonas aestivum FM36 on TMV;

[0032] Among them, a is the preventive effect of crude protein extract of Pseudomonas alginosus strain FM36 and heat-treated crude protein extract on TMV observed under natural light and ultraviolet light;

[0033] b) qRT-PCR detection of the inhibition of TMV in Nicotiana benthamiana by crude protein extract of Pseudomonas alginosus FM36 strain and heat-treated crude protein extract mp Resulting in RNA accumulation.

[0034] Figure 5 The inactivation effect of the fermentation broth and crude protein extract of Pseudomonas aestivum FM36 on TMV;

[0035] Figure 6 The inactivation effect of the fermentation broth and crude protein extract of Pseudomonas aestivum FM36 strain on ChiVMV;

[0036] Figure 7 The plate inhibition effect of Pseudomonas aestivum FM36 strain on five plant pathogenic fungi;

[0037] Figure 8 This is a schematic diagram of the layout of the field trial plot for Pseudomonas aestivum FM36 strain;

[0038] Figure 9 The effect of increasing the average plant height of tomatoes after applying the fermentation liquid of Pseudomonas agriculturae FM36 strain in the field experiment;

[0039] Figure 10 This is the effect of increasing the average number of tomato flower stalks after applying the fermentation liquid of Pseudomonas aestivum FM36 strain in the field experiment. DETAILED DESCRIPTION

[0040] The embodiments of the present application will be described in more detail below with reference to the accompanying drawings. Although the embodiments of the present application are shown in the accompanying drawings, it should be understood that the present application can be implemented in various forms and should not be limited by the embodiments described herein. On the contrary, these embodiments are provided to make the present application more thorough and complete, and to fully convey the scope of the present application to those skilled in the art.

[0041] In order to make the purpose, technical scheme and advantages of the embodiments of the present application clearer, the technical scheme in the embodiments of the present application will be clearly and completely described below. If the specific conditions are not specified in the embodiments, they are carried out according to the conditions recommended by the normal conditions or the manufacturers. If the manufacturer is not specified in the reagents or instruments used, they are all conventional products that can be purchased commercially. Based on the embodiments in the present application, all other embodiments obtained by ordinary technicians of the art without making creative work are within the scope of protection of this application.

[0042] Pseudomonas bacteria ( Pseudomonas spp.) are widely found in various ecological environments. They inhibit the occurrence of plant diseases by promoting plant growth and producing secondary metabolites with antibacterial activity. Although there are many research reports on the use of biocontrol Pseudomonas to control plant viral and fungal diseases, the promotion and application of Pseudomonas in the actual application of plant disease control is still relatively limited. This is mainly due to the low stability of strains and the lack of efficient and broad-spectrum strains.

[0043] The present application provides a Pseudomonas tritici strain ( Pseudomonas siliqua ) FM36, which has obvious passivation and inhibition effects on TMV and ChiVMV. At the same time, the FM36 strain also has good control effects on fungal diseases such as rice sheath blight, rice blast, chive leaf spot, chive anthracnose and banana wilt. In addition, the FM36 strain may promote the growth of tomato plants and increase tomato yields, thus providing a new type of biological control resource for protecting crop health, effectively controlling and reducing crop diseases, and promoting sustainable agricultural development.

[0044] Example 1: Isolation, morphology and molecular biological identification of strain FM36

[0045] 1. Isolation of FM36 strain

[0046] Tobacco rhizosphere soil samples were collected from the tobacco planting base in Fumin County, Kunming City, Yunnan Province. The whole tobacco plant was dug out with roots, and large pieces of soil were shaken off. The root samples and the rhizosphere soil attached to them were placed in sterile self-sealing bags and transported back to the laboratory at 4°C for strain isolation and culture.

[0047] In a sterile operating table, use a brush to gently brush off the soil attached to the tobacco roots and filter it with a 0.2 cm mesh. Weigh 2 g of soil sample, place it in a 50 mL centrifuge tube, add 18 mL of sterile water, and shake at 200 rpm for 30 min at 28 °C to prepare a soil suspension. Take 100 μL of the dilution gradient of 10 ‑3 , 10 ‑4 , 10 ‑5The soil dilution was spread on LB medium (tryptone 10 g, yeast extract 5 g, NaCl 10 g, agar 15 g, distilled water 1L, pH=7.5) plates. The culture dish was placed in a 28 ℃ incubator for about 48 h. When colonies appeared on the culture medium plate, single colonies of different bacteria were picked and inoculated on a new LB medium plate. The strains were purified 3 to 4 times and then preserved. The genomic DNA of the bacteria was extracted using a column-type bacterial genomic DNA extraction kit. The 16S rRNA gene of the bacteria was amplified using primers 27F (AGAGTTTGATCCTGGCTCAG) and 1492R (TACGGCTACCTTGTTACGACTT) using the genomic DNA of the strain as a template. After the obtained products were detected by 1% agarose gel electrophoresis, the positive PCR products were sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. Finally, a target strain of Pseudomonas was obtained, numbered FM36.

[0048] (II) Morphological identification of FM36 strain

[0049] The FM36 strain isolated from tobacco rhizosphere soil was Figure 1 As shown in the figure, the FM36 colonies on LB medium are white with a yellowish tint, with a protruding surface, neat edges, moist and shiny bacteria, easy to pick up, and no pigment is produced. Under an electron microscope, the strain is long and rod-shaped, with 1 to several flagella, which are polar. Gram staining is negative.

[0050] 3. Molecular biological identification of FM36 strain

[0051] The 16S rRNA gene sequence of FM36 strain was entered into the NCBI database and compared with the 16S rRNA gene sequences of other strains by Blast. The 16S rRNA gene sequences of other Pseudomonas strains were downloaded from the NCBI database, and the phylogenetic tree was constructed using MEGA7.0 with the neighbor-joining method.

[0052] The 16S rRNA gene of the FM36 strain obtained by sequencing is 1440 bp long, and the sequence is shown in SEQ ID NO. 1:

[0053]

[0054] The blast comparison of 16S rRNA gene sequences of FM36 strain in NCBI database showed that FM36 strain was Grams of rye strain P(CP173722) Grams of rye The 16S rRNA gene sequence of strain OTU6BANIB1 (CP099598) was the highest, reaching 99.58%. The phylogenetic tree constructed based on the 16S rRNA gene sequences of different Pseudomonas bacteria showed that the FM36 strain had Grams of rye strain P(CP173722) P. rye strain OTU6BANIB1 (CP099598), Grams of rye strain OTU6BAGNBB1 (CP099596) and Grams of rye strain OTU6MEDAA1 clustered in the same branch ( Figure 2 ).

[0055] In summary, based on the morphology and molecular biological identification of FM36 strain, it was determined that FM36 strain was Grams of rye . Rye The Latin word for wheat is so the FM36 strain was named Pseudomonas tritici.

[0056] Example 2: Physiological and biochemical identification of strain FM36

[0057] The physicochemical properties of strain FM36 were determined by referring to the relevant contents of the determination of physiological and biochemical characteristics in the Bergey's Manual of Bacterial Identification (9th edition).

[0058] Determination of phosphate solubilization ability: 60 μL of overnight cultured strain FM36 was inoculated in the center of NBPIP medium (glucose 10.0 g, Ca3(PO4)25.0 g, MgCl25.0 g, MgSO47H2O 0.25 g, KCl 0.2 g, (NH4)2SO40.1 g, agar 15 g, distilled water 1000 mL), cultured at 28 °C for 6 days, stained with 5% bromophenol blue for 3 min, and washed 3 times with sterile water. Observe whether there is a degradation zone around the colony. If there is a degradation zone, it is positive, and if there is no degradation zone, it is negative.

[0059] Potassium-dissolving ability determination: 60 μL of overnight cultured strain FM36 was inoculated in the center of potassium feldspar medium (CaCO3 0.1 g, Na2HPO4 0.2 g, MgSO4·7H2O 0.2 g, CaSO4 0.2 g, glucose 10 g, potassium feldspar powder 10 g, agar 15 g, distilled water 1000 mL), and cultured at 28 °C for 5 days. Observe whether there is a degradation zone around the colony. If there is a degradation zone, it is positive, and if there is no degradation zone, it is negative.

[0060] Nitrogen fixation test: Spread 100 μL of strain FM36 bacterial solution on Ashby medium (KH2PO4 0.2 g, CaCO3 5.0 g, MgSO4 0.2 g, glucose 10.0 g, NaCl 0.2 g, CaSO4 0.1 g, agar powder 20 g, add distilled water to 1000 mL), and culture at 28℃ for 24 h. If the strain has the ability to fix nitrogen, it can grow normally.

[0061] Ferrophilic ability determination: 60 μL of overnight cultured strain FM36 was inoculated in the center of the ferritin medium, cultured at 28°C for 6 days, and observed whether there was a degradation zone formed around the colony. If a degradation zone is formed around the colony, it has the ability to be ferritin, otherwise it does not have the ability to be ferritin. Ferrophilic medium: A solution, sucrose 20.0 g, (NH4)2SO4 3.5 g, L-methionine 0.02 g, L-aspartic acid 1.5 g, L-histidine 0.02 g, KH2PO4 1.0 g, MgSO4 0.5 g, NaCl 0.5 g, dissolved in 1000 mL distilled water; B solution: chrome azurol 0.6 g, FeCl3 0.02 g, hexadecyl trimethyl ammonium bromide (CTAB) 1.5 g, dissolved in 1000 mL 0.01 mol / L PBS buffer. When using, add 5 mL of B solution and 2 g of agar to every 100 mL of A solution. 0.01 mol / L PBS buffer: 8 g NaCl, 0.2 g KCl, 1.44 g Na2HPO4, 0.24 g KH2PO4, dissolved in 800 ml distilled water, adjust the pH value of the solution to 7.2 with HCl or NaOH, and add distilled water to make up to 1000 mL.

[0062] Gelatin liquefaction test: Pipette 10 μL of overnight cultured strain FM36 into a gelatin medium tube, incubate at 27°C for 5 days, and place at 4°C for 30 min. If the gel is liquefied when taken out, it is positive; if the gel resolidifies or does not liquefy, it is negative.

[0063] VP test: Mix 2 mL of overnight cultured FM36 strain, 1 mL of 6% α-naphthol and 0.4 mL of 40% KOH and shake for 5 min. If the color turns red immediately or within 2 h at room temperature, it is positive; if no red color appears, it is negative.

[0064] IAA production test: Mix 5 mL of overnight cultured strain FM36 and 0.5 mL of Salkowski colorimetric solution and culture at 28 ℃ 200 rpm for 30 min. If the bacterial solution turns red or pink, it is positive; if the color does not change, it is negative.

[0065] Methyl red test: Add 2 to 3 drops of methyl red along the wall of the test tube into 5 mL of overnight culture of strain FM36. If the color of the culture turns red, it is positive; if there is no color change, it is negative.

[0066] Nitrate reduction reaction: Inoculate strain FM36 in nitrate reduction reaction medium, culture at 37 ℃ 200 rpm for 3 days, add 2-3 drops of agent A and agent B, mix well, and if red appears, it is positive, and if there is no color change, it is negative. Nitrate reduction reaction medium: 3 g beef extract, 5 g peptone, 1 g KON, 1000 mL sterile water. Agent A: 8.0 g p-aminobenzenesulfonic acid dissolved in 1000 mL 5 mol / L acetic acid; Agent B: 2.5 g α-naphthol dissolved in 1000 mL 5 mol / L acetic acid.

[0067] NaCl tolerance test: 100 μL of FM36 bacterial suspension of the same amount and in the same logarithmic growth phase was added to LB liquid culture medium with NaCl concentrations of 0, 0.5%, 1%, 2%, 4%, 6%, 8%, and 10%, respectively. After culturing at 28°C and 220 rpm for 24 h, the OD was measured. 600 Values ​​were used to compare the status of the analyzed strains.

[0068] As shown in Table 1, strain FM36 has the property of dissolving phosphate, can liquefy gelatin, and can produce IAA, and can tolerate 6% NaCl salt when cultured on LB medium. In addition, the FM36 strain can produce IAA, indicating that it may have a growth-promoting effect on plants.

[0069] Table 1 Physiological and biochemical identification results of strain FM36

[0070]

[0071] Note: “+”: positive; “-”: negative

[0072] Example 3: The fermentation broth and crude protein extract of Pseudomonas aestivum FM36 strain have a good inhibitory effect on TMV

[0073] Preparation of FM36 fermentation broth: Pick a single colony of FM36 strain that has grown well in Example 1 and inoculate it into 3 mL LB medium. After shaking and culturing at 28°C and 200 rpm for 24 h, inoculate it into fresh LB liquid medium at a ratio of 1:100 and ferment it for 48 h. When using, dilute the fermentation broth with LB liquid medium to OD 600 =1.0.

[0074] Preparation of crude protein extract of FM36 strain: The fermentation broth of strain FM36 cultured for 48 hours was centrifuged at 12000 rpm for 10 min at 4 ℃, and the bacteria were removed. Ammonium sulfate was added to 80% saturation and then precipitated at 4 ℃ overnight. Centrifuged at 4 ℃, 10000 rpm for 25 min, and the precipitate was dissolved with 0.02 mol / L PBS buffer (pH 7.2) with a volume of 1 / 15 of the fermentation broth. The crude protein extract was obtained by dialyzing and desalting (the molecular weight cutoff of the dialysis bag was 100 Da). When used, the concentration of the crude protein extract was adjusted to 1 mg / mL with 0.01 mol / L PBS buffer.

[0075] 0.02 mol / L PBS buffer: 8 g NaCl, 0.2 g KCl, 1.44 g Na2HPO4, 0.24 g KH2PO4, dissolved in 400 ml distilled water, adjust the pH value of the solution to 7.2 with HCl or NaOH, and add distilled water to make up to 500 mL.

[0076] 1. FM36 strain fermentation broth and protein crude extract have obvious preventive effect on TMV

[0077] Test the preventive effect of FM36 fermentation liquid on TMV: spray OD 600 = 1.0 of FM36 fermentation liquid (2 mL per plant), and 24 h later inoculated with Agrobacterium tumefaciens carrying gfp Each strain of Nicotiana benthamiana was inoculated with a TMV-infectious clone (TMV-GFP) at an OD of 600 100 μL of Agrobacterium containing TMV-GFP infectious clones with a value of 0.8. Spray 4-5 leaf stage Nicotiana benthamiana with 1000 times dilution of 30% chlorpyrifos wettable powder (2 mL per plant), and inoculate the same amount of TMV-GFP infectious clones 24 hours later as a drug control. At the same time, spray 4-5 leaf stage Nicotiana benthamiana with LB liquid culture medium (2 mL per plant), and inoculate the same amount of TMV-GFP infectious clones 24 hours later as a negative control. Each treatment has 5 plants and 3 replicates.

[0078] Test the preventive effect of FM36 protein extract on TMV: 1 mg / mL FM36 protein extract was sprayed on 4-5 leaf N. benthamiana plants (2 mL per plant). 24 h later, the transformed Agrobacterium carrying gfp Each strain of Nicotiana benthamiana was inoculated with a TMV-infectious clone (TMV-GFP) at an OD of 600 100 μL of Agrobacterium containing TMV-GFP infectious clones with a value of 0.8. 4-5 leaf stage Nicotiana benthamiana was sprayed with 0.01 mol / L PBS buffer (2 mL per plant), and 24 hours later, the same amount of TMV-GFP infectious clones were inoculated as negative controls. In addition, 1 mg / mL of FM36 strain protein crude extract was boiled in a 98℃ water bath for 10 min, cooled and sprayed on 4-5 leaf stage Nicotiana benthamiana (2 mL per plant), and 24 hours later, the same amount of TMV-GFP infectious clones were inoculated to test the thermal stability of FM36 strain protein crude extract and its control effect on TMV. Each treatment consisted of 5 plants and repeated 3 times.

[0079] Evaluation of the preventive effect of FM36 strain fermentation broth and protein crude extract on TMV-GFP: After inoculation with TMV-GFP infectious clones, the symptoms of N. benthamiana, GFP fluorescence area and intensity were continuously observed and photographed. 12 days after inoculation with TMV-GFP, leaves of N. benthamiana system were collected and total RNA was extracted. Subsequently, qRT-PCR technology was used to detect TMV mp The total RNA of Nicotiana benthamiana leaves was extracted using TRIzol reagent, and the extracted RNA was reverse transcribed into cDNA using HiScript III 1stStrand cDNA Synthesis Kit (+gDNAwiper). mp Gene sequence design TMV-MP-qF (TTCTGTCCGCTTTCTCTGG) and TMV-MP-qR (ACTTTGCAAGCCTGATTGAC) specific detection primers. The actin gene of Nicotiana benthamiana was used as the internal reference gene, and the primers were ActinF (CTGAGGTCCTTTTCCAACCA) and ActinR (TACCCGGGAACATGGTAGAG).

[0080] like Figure 3 As shown in the figure, 12 days after inoculation with TMV-GFP, the GFP green fluorescence intensity and area on the systemic leaves of N. benthamiana sprayed with FM36 fermentation liquid were significantly lower than those of the control sprayed with LB liquid medium and 1000 times diluted 30% chlorpyrifos wettable powder. mpThe RNA accumulation of FM36 strain was also significantly lower than that of the control, indicating that the fermentation liquid of FM36 strain could inhibit the systemic infection of TMV-GFP to Nicotiana benthamiana.

[0081] like Figure 4 As shown in the figure, the intensity and area of ​​GFP green fluorescence on the systemic leaves of N. benthamiana sprayed with FM36 protein crude extract or FM36 protein crude extract heat-treated at 98 ℃ were significantly lower than those of the control sprayed with PBS buffer 12 days after inoculation with TMV-GFP. mp The RNA accumulation of FM36 strain crude protein extract and heat-treated FM36 strain crude protein extract inoculated with TMV-GFP for 12 days showed that the fluorescence area on the systemic leaves and the TMV mp The difference in RNA accumulation between the two strains was not significant. This indicates that the protein extract of FM36 strain has a significant inhibitory effect on TMV, and the inhibitory effect of the protein extract on the virus can still be maintained after being treated at 98 ℃ for 10 min.

[0082] (II) The fermentation broth and crude protein extract of FM36 strain have a good passivation effect on TMV

[0083] The half-leaf spot method was used to test the passivation effect of the fermentation broth and crude protein extract of FM36 strain on TMV, and the test plants were all heartleaf tobacco at the 6-7 leaf stage. The preparation method of the fermentation broth and crude protein extract of FM36 strain was the same as that of Example 2.

[0084] Preparation of TMV toxin source: Weigh 0.5 g of fresh tobacco leaves infected with TMV, add 10 mL of sterilized 0.01 mol / L PBS buffer, grind into a homogenate, centrifuge at 6000 rpm at 4 °C for 5 min, and then aspirate the supernatant as the inoculation toxin source.

[0085] Test the passivation effect of FM36 fermentation broth on TMV: 600 = 1.0 FM36 strain fermentation liquid was mixed with TMV inoculation source in equal volumes, incubated at room temperature for 2 h, and 100 μL of the mixture was rubbed and inoculated on the right half of the heartleaf tobacco leaf; LB liquid medium was mixed with TMV inoculation source in equal volumes, incubated at room temperature for 2 h, and 100 μL of the mixture was rubbed and inoculated on the left half of the heartleaf tobacco leaf as a negative control. A total of 2 heartleaf tobacco plants were inoculated, with 3 leaves inoculated from each heartleaf tobacco plant, and repeated 3 times.

[0086] The passivation effect of FM36 strain protein crude extract on TMV was tested: 1 mg / mL FM36 strain protein crude extract was mixed with equal volumes of TMV inoculation source, incubated at room temperature for 2 h, and 100 μL of the mixture was rubbed and inoculated on the right half of the heartleaf tobacco leaf; 0.01 mol / L PBS buffer was mixed with equal volumes of TMV inoculation source, incubated at room temperature for 2 h, and 100 μL of the mixture was rubbed and inoculated on the left half of the heartleaf tobacco leaf as a negative control. At the same time, 1000 times of 30% chlorpyrifos wettable powder was mixed with equal volumes of TMV inoculation source, incubated at room temperature for 2 h, and 100 μL of the mixture was rubbed and inoculated on the right half of the heartleaf tobacco leaf as a drug control; 100 μL of 0.01 mol / L PBS buffer and TMV inoculation solution was rubbed and inoculated on the left half of the heartleaf tobacco leaf as a negative control. A total of 2 heartleaf tobacco plants were inoculated, with 3 leaves inoculated per plant, and repeated 3 times.

[0087] Before inoculation, sprinkle corundum evenly on the leaves of the heartleaf tobacco. After 10 minutes of inoculation, spray an appropriate amount of water on the surface of the inoculated leaves to keep the leaves moist. Three days after inoculation, the number of dead spots on the heartleaf tobacco was investigated and the inhibition rate was calculated.

[0088] Inhibition rate (%) = (average number of necrotic spots in control group - average number of necrotic spots in treatment group) / average number of necrotic spots in control group × 100%.

[0089] As shown in Table 2 and Figure 5 As shown in the figure, the inhibition rates of FM36 fermentation broth and its crude protein extract on TMV were 72.04% and 82.66%, respectively. The passivation effect of FM36 fermentation broth on TMV was comparable to that of chlorpyrifos. This indicates that FM36 fermentation broth and its crude protein extract both have good passivation effects on TMV.

[0090] Table 2 The passivation effect of Pseudomonas aestivum FM36 fermentation broth and its crude protein extract on TMV

[0091]

[0092] Example 4: The fermentation broth of Pseudomonas aestivum FM36 strain and its crude protein extract have a passivating effect on ChiVMV

[0093] Preparation of ChiVMV source: The source plants of common tobacco K326 inoculated with ChiVMV were cultured in an insect-proof greenhouse. 1 g of leaves of common tobacco K326 infected with ChiVMV were taken, added with 10 mL of 0.01 mol / L PBS buffer and ground, centrifuged at 6000 rpm for 5 min at 4 °C, and the supernatant was taken as the ChiVMV inoculation source for later use.

[0094] The inactivation effect of FM36 fermentation broth and protein crude extract on ChiVMV was tested: the test plants were common tobacco K326 plants at the 3-leaf stage. The experimental treatment was to mix the fermentation broth or protein crude extract of FM36 with the ChiVMV inoculation source in a ratio of 1:1, stand at room temperature for 30 min, and then take 100 μL of the mixture and rub it into common tobacco K326. The negative control was to mix an equal amount of 0.01 mol / L PBS buffer and the ChiVMV inoculation source in a ratio of 1:1, and then stand at room temperature for 30 min, and then take 100 μL of the mixture and rub it into common tobacco K326. The drug control group was to mix 8% Ningnanmycin aqueous solution diluted 1000 times with 0.01 mol / L PBS buffer with the ChiVMV inoculation source in a ratio of 1:1, stand at room temperature for 30 min, and then take 100 μL of the mixture and rub it into common tobacco K326. Each treatment consisted of 6 plants, with 3 replicates.

[0095] The severity classification of ChiVMV disease refers to the national standard GB / T 23222-2008 "Grading and Investigation Methods of Tobacco Pests and Diseases" for "Tobacco Mosaic Virus (TMV), Cucumber Mosaic Virus (CMV), Potato Virus Y (PVY)" classification standards, and on this basis, appropriate adjustments are made according to the specific symptoms of ChiVMV on ordinary tobacco K326, specifically:

[0096] Investigation by plant number

[0097] Level 0: There are no obvious symptoms on the whole plant.

[0098] Level 1: The heart leaf veins are clear or the leaves are slightly mosaic, and the diseased plants have no obvious dwarfing

[0099] Level 3: 1 / 3 of the leaves are mosaic but not deformed, or the diseased plants are shrunk to more than 3 / 4 of the normal plant height.

[0100] Level 5: 1 / 3 to 1 / 2 of the leaves are mosaic, or 1 / 3 to 1 / 2 of the leaves are deformed (the leaves become thinner), or the diseased plants are dwarfed to 2 / 3 to 3 / 4 of the normal plant height.

[0101] Level 7: 1 / 2 to 2 / 3 of the leaves are mosaic or blister-spotted, or 1 / 2 to 2 / 3 of the leaves are deformed (the leaves become thinner), or the diseased plants are shrunk to 1 / 2 to 2 / 3 of the normal plant height.

[0102] Level 9: All leaves of the plant are mosaic-like and have blister spots, more than 2 / 3 of the leaves are severely deformed (needle-shaped leaves appear) or necrotic, or the diseased plant is dwarfed to more than 1 / 2 of the normal plant height.

[0103] Calculation method of incidence rate: Incidence rate (%) = number of diseased plants / total number of plants investigated × 100%

[0104] Disease index calculation method: Disease index = ∑ (number of diseased plants or leaves at each level × value of the disease level) / (total number of plants or leaves surveyed × highest level value) × 100

[0105] Inhibition rate calculation method: Inhibition rate (%) = (disease index of negative control - disease index of treatment) / disease index of negative control × 100%

[0106] As shown in Table 3 and Figure 6 As shown in the results, the fermentation broth of FM36 strain and its crude protein extract can effectively inactivate ChiVMV virus particles and significantly reduce the incidence of ChiVMV infection in common tobacco K326. The inhibition rates of the fermentation broth of FM36 strain and its crude protein extract on ChiVMV reached 85.28% and 70.55%, respectively.

[0107] Table 3 Inactivation effect of fermentation broth and crude protein extract of Pseudomonas aestivus FM36 strain on ChiVMV

[0108] Example 5: Pseudomonas aestivum FM36 strain has an inhibitory effect on five plant pathogenic fungi

[0109] Plate inhibition experiment of FM36 strain on plant pathogenic fungi: The cultured FM36 strain fermentation liquid was diluted with LB liquid medium to OD 600 =1.0 for standby use. Take 100 μL of FM36 strain fermentation liquid and spread it on PDA solid medium. After the surface of the medium is dry, use a 1 mL pipette tip to take the plant pathogenic fungus cake to the center of the PDA medium, seal it and place it in an incubator at 25°C and 60% air humidity to culture in the dark. The control was set as PDA medium without FM36 strain, and only pathogenic fungi were inoculated. After 5 days of culture, the diameter of the pathogenic fungus colony in different treatments and controls was measured to calculate the mycelial growth inhibition rate. The plant pathogenic fungi are Rhizoctonia solani, Magnaporthe oryzae, Alternaria tenuissima, Colletotrichum cerevisiae and Fusarium lanceolatum Cuban specialization type.

[0110] Inhibition rate (%) = (control colony diameter - treated colony diameter) / control colony diameter × 100%.

[0111] From Table 4 and Figure 7 It can be seen that when the fermentation broth OD of FM36 strain 600 =1.0, the highest inhibition rate was 72.3% against Rhizoctonia solani, the pathogen of rice sheath blight, followed by 70.8% against Magnaporthe oryzae, while the inhibition rates against the other three plant pathogenic fungi were all greater than or equal to 48%. FM36 strain had an inhibitory effect on all five pathogenic fungi, demonstrating the broad-spectrum antibacterial activity of Pseudomonas aeruginosa FM36 strain.

[0112] Table 4 Inhibitory effect of Pseudomonas aestivum FM36 strain on five plant pathogenic fungi

[0113]

[0114] Example 6: The fermentation broth of Pseudomonas aestivum FM36 has a promoting effect on the growth and yield of tomatoes

[0115] The results of the indoor experiment showed that the Pseudomonas aeruginosa FM36 strain had a good inhibitory effect on TMV, ChiVMV and five plant pathogenic fungi. A field experiment was further designed to test whether the strain could promote tomato growth and increase yield. The experiment was carried out from June to November 2024 at the tomato planting base in Jinma Town, Luxi County, Honghe Prefecture, Yunnan Province. The tomato variety planted was the "Ruifei" coated variety.

[0116] Field trial layout: Figure 8 As shown in the figure, the experimental plots were designed to be 6 m × 7.2 m, with each plot having an area of ​​43.2 m 2 A total of 64 tomato plants were planted in each plot, with 4 rows at a row spacing of 1.2 m and 16 plants in each row at a plant spacing of 0.45 m. The experiment was designed with three treatments: FM36 strain test group, HNI-1 sulfur-loving micropyle test group and farmer self-defense control group, with three replicates.

[0117] Experimental area design:

[0118] Fermentation preparation OD 600 =1.0 FM36 strain fermentation liquid, diluted with water to 150 times liquid when used. The concentration of sulfur-loving red oomycete HNI-1 is 2 × 10 8 cfu / mL, diluted to 300 times before use.

[0119] The farmer self-defense control group was conventionally treated without additional application of FM36 strain fermentation broth or sulfur-loving Rhodomyces thiophilus HNI-1.

[0120] FM36 strain fermentation liquid test group: 2 weeks after tomato sowing (3-4 leaf stage), spray the tomato seedlings with 1L of 150-fold fermentation liquid of FM36 strain on the seedbed; on the day of transplanting, dip the roots of the tomato seedlings in 150-fold fermentation liquid of FM36 strain for 5 minutes; in the first month after transplanting, spray the 150-fold fermentation liquid of FM36 strain once every 7 days, spray 3 L in each plot, for a total of 3 times; thereafter, spray the 150-fold fermentation liquid of FM36 strain once every 10 days, spray 5 L in each plot, for a total of 3 times.

[0121] Experimental group of sulfur-loving red oomycetes HNI-1: 2 weeks after tomato sowing (3-4 leaf stage), spray the tomato seedlings with 1 L of 300-fold diluted HNI-1 on the seedbed; on the day of transplanting, dip the roots of the tomato seedlings in 300-fold diluted HNI-1 for 5 minutes; in the first month after transplanting, spray 300-fold diluted HNI-1 once every 7 days, spray 3 L in each plot, for a total of 3 times; thereafter, spray 300-fold diluted HNI-1 once every 10 days, spray 5 L in each plot, for a total of 3 times.

[0122] Survey method: The five-point sampling method was used. Ten tomato plants were marked in each plot, and 30 tomato plants were surveyed in each treatment. The height of the tomato plants was measured 3 to 5 weeks after transplanting, and the number of tomato flower stalks was surveyed 3 to 8 weeks after transplanting. After the fruits were ripe, the tomato fruits were harvested three times and the tomato yield was measured. Ten tomato plants were fixed in each plot, and 30 plants were measured in each treatment each time. The yield per mu was calculated based on 2,000 plants per mu.

[0123] Tomato yield per mu (kg) = total weight of 3 surveys (kg) × 2000 / 30

[0124] Increased yield rate per mu (%) = (yield per mu in the experimental area - yield per mu in the farmers’ self-defense area) / yield per mu in the farmers’ self-defense area × 100%.

[0125] Depend on Figure 9 and Figure 10 It can be seen that the plant height and number of flower stalks of tomatoes treated with FM36 fermentation liquid and sulfur-loving red oomycete HNI-1 were higher than those in the farmers' self-defense area at all survey periods, and the average plant height was 15 cm and 6.5 cm higher than the control, respectively. As shown in Table 5, compared with the farmers' self-defense area, the average tomato yield per mu increased by 5.48% and 3.29% in the FM36 fermentation liquid and sulfur-loving red oomycete HNI-1 treatments. The above data show that FM36 can promote tomato growth, increase the number of tomato flower stalks and increase yield.

[0126] Table 5 The yield-increasing effects of Pseudomonas aestivus strain FM36 and R. sulfidophilus on tomatoes

[0127]

[0128] The embodiments of the present application have been described above, and the above description is exemplary, not exhaustive, and is not limited to the disclosed embodiments. Many modifications and changes will be apparent to those of ordinary skill in the art without departing from the scope and spirit of the described embodiments. The selection of terms used herein is intended to best explain the principles of the embodiments, practical applications, or improvements to the technology in the market, or to enable other persons of ordinary skill in the art to understand the embodiments disclosed herein.

Claims

1. A strain of Pseudomonas siligini FM36, characterized in that: The wheat Pseudomonas FM36 was deposited in the General Microbiology Center of the China Microorganism Culture Collection Administration on December 2, 2024, with the deposit number CGMCC NO. 32868; the classification name is Pseudomonas siliginis.

2. A strain fermentation broth, characterized in that: The fermentation broth is obtained by fermenting the Pseudomonas aestivum FM36 in claim 1.

3. A crude protein extract, characterized in that The crude protein extract is prepared from the fermentation broth in claim 2.

4. An application of wheat Pseudomonas fermentation liquid in preventing and controlling plant viruses, characterized in that: The Pseudomonas aestivum fermentation broth is obtained by fermenting the Pseudomonas aestivum FM36 described in claim 1; the plant virus comprises tobacco mosaic virus and / or red pepper vein mottle virus.

5. Use of a crude protein extract of Pseudomonas aeruginosa in preventing and controlling plant viruses, characterized in that: The Pseudomonas aestivum is the Pseudomonas aestivum FM36 described in claim 1; the plant virus comprises tobacco mosaic virus and / or red pepper vein mottle virus.

6. An application of wheat Pseudomonas fermentation liquid in inhibiting plant pathogenic fungi, characterized in that: The wheat Pseudomonas fermentation broth comprises the wheat Pseudomonas FM36 described in claim 1, and the plant pathogenic fungus is Rhizoctonia solani ( Rhizoctonia solani )、Pyricularia grisea( Magnaporthe oryzae )、Alternaria tenuifolia( Alternaria tenuissima )、White wax spiny spore ( Colletotrichum spaethianum ) or / and Fusarium spp. Cuban specific type ( Fusarium oxysporium f . sp. cubense ).

7. An application of Pseudomonas tritici in promoting tomato growth and increasing yield, characterized in that: The Pseudomonas aestivum is the Pseudomonas aestivum FM36 in claim 1.

Images