An artificially synthesized promoter Pw and its application in vitamin B12-producing strains

Abstract

The present invention belongs to the field of genetic engineering technology, and specifically relates to an artificially synthesized promoter Pw and its application in vitamin B12-producing strains. The nucleotide sequence of the artificial promoter is shown in SEQ ID NO: 1. Functional verification shows that it can be widely used in vitamin B12-producing strains such as Sinorhizobium alfalfa, Pseudomonas denitrificans and Xylocopa glutinosus. 12 The invention also relates to a plasmid vector containing the promoter, a method for constructing a genetic engineering strain using the promoter and the corresponding strain, and the use of a host cell in initiating the expression of a target gene.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and relates to an artificially synthesized promoter, in particular to a strain containing the promoter, and also to a plasmid containing the promoter and a transformant containing the plasmid vector, as well as their applications in homologous or heterologous protein expression and in the production of vitamin B12. 12 Application of strains. Background Art

[0002] The promoter is a DNA sequence recognized and bound by RNA polymerase. It is a cis-acting element necessary for gene expression. It determines when, where and how often the gene is expressed. Transcription is the first step of gene expression, and the promoter plays a decisive role in the initial stage of transcription. The strength of promoter activity directly affects the level of gene expression and plays a vital role in the regulation of gene transcription level.

[0003] In the process of microbial metabolic engineering pathway modification, a common strategy is to use promoters of different strengths to finely regulate the expression of target genes, achieve a coordinated balance between the generation and utilization of various intermediate metabolites, reduce or prevent the accumulation of intermediates and toxic substances, and improve the synthesis efficiency of metabolites. However, the currently available natural promoters are difficult to meet the above requirements and have certain defects in application. Therefore, it is necessary to construct some artificial promoters to meet different gene expression needs [Yasmeen E, Wang J, Riaz M, Zhang L, Zuo K. Designingartificial synthetic promoters for accurate, smart, and versatile geneexpression in plants. Plant Commun. 2023 Jul 10;4(4):100558.].

[0004] Vitamin B 12 Also known as cobalamin / VB 12 , is the most complex vitamin known so far, and is an essential nutrient for human growth and development. It is widely used in food additives, medicine, feed and other industries. 12 There are two active forms: adenosylcobalamin and methylcobalamin. Vitamin B 12 The synthetic pathway of vitamin B is very complicated, requiring more than 30 steps of enzyme catalysis reactions, and chemical synthesis is difficult. 12 Production is almost always carried out through microbial fermentation. 12 Production is mainly by Pseudomonas denitrificans ( Pseudomonas denitrificans )、Propionibacterium ( Propionibacterium freudenreichii)、Adhesive Sword Fungus( Ensifer adherents ) and Sinorhizobium meliloti ( Sinorhizobium meliloti ) is produced by microbial fermentation. 12 The growing demand has attracted widespread attention, but due to the lack of effective vitamin B 12 The synthetic method leads to its high market price [Liu Y, Huang W, Wang Q, Ma C, Chang Y, Su J. Research on the targeted improvement of the yield of a new VB12-producing strain, Ensifer adhaerens S305, based on genomic and transcriptomic analysis. BMC Biotechnol. 2023 Dec 11;23(1):53.].

[0005] To further investigate the production of vitamin B 12 Physiological characteristics of bacterial strains and cobalamin metabolic mechanism, enhance the production of vitamin B12 by corresponding bacterial strains 12 The ability to produce vitamin B often requires the appropriate expression of one or more genes in the bacteria, which requires a suitable promoter element. 12 The number of promoters available in a bacterial species is very limited. Summary of the invention

[0006] In order to overcome the shortcomings of the prior art, the inventor discovered a sequence on a plasmid vector. The inventor accidentally discovered that fusing it to the front of a natural promoter could enhance the expression of the natural promoter. Thus, an artificial protein was synthesized that can be used in a variety of vitamin B production. 12 Promoter in bacterial species. One of the purposes of the present invention is to provide an artificial synthetic promoter, which can drive the expression of endogenous or heterologous genes.

[0007] The present invention provides an artificial synthetic promoter, the nucleotide sequence of which is selected from the following sequences (a), (b) or (c):

[0008] (a) The artificially synthesized promoter is the nucleotide sequence shown in SEQ ID NO: 1 in the sequence listing;

[0009] (b) a nucleotide sequence having a homology of more than 75% with SEQ ID NO: 1 in the sequence listing and having promoter function;

[0010] (c) a nucleotide sequence that hybridizes with the nucleotide sequence described in (a) or (b) under high stringency conditions and has a promoter function;

[0011] Preferably, the (b) is a nucleotide sequence having more than 90% homology with SEQ ID NO: 1 in the sequence listing and having promoter function.

[0012] The present invention further provides an expression cassette containing the artificial synthetic promoter.

[0013] The present invention also provides a recombinant vector containing the artificial synthetic promoter or the expression cassette.

[0014] Specifically, the backbone vector of the recombinant vector is a broad host shuttle plasmid vector containing a replicon and a mob gene that can be recognized by Gram-negative bacteria.

[0015] More specifically, the backbone vector of the recombinant vector is PBBR1MCS2 or pME6032.

[0016] The present invention provides a recombinant bacterium containing the artificial synthetic promoter or the recombinant vector.

[0017] Specifically, the recombinant bacteria produces vitamin B 12 strains of Pseudomonas denitrificans ( Pseudomonas denitrificans )、Adhesive Sword Fungus( Ensifer adherents ) or Sinorhizobium meliloti ( Sinorhizobium meliloti ).

[0018] The present invention also provides the use of the artificial synthetic promoter in initiating the expression of target genes.

[0019] Specifically, the target gene is to synthesize vitamin B 12 Related genes, by starting the expression of the target gene to make the recombinant bacteria produce vitamin B 12 .

[0020] More specifically, the recombinant bacteria are obtained by introducing the recombinant vector.

[0021] The artificially synthesized promoter of the present invention can be used to drive the expression of endogenous or heterologous genes, especially to increase the production of vitamin B 12 The number of promoters available in the strain provides a basis for promoter engineering to be better applied to vitamin B production 12 The expression regulation of genes in the metabolic pathways of strains provides more options. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 The expression of the artificial promoter Pwgfp Gene. SM / control means control, which is not expressed in SM bacteria gfp Gene, SM / Pw means that in SM bacteria, P W Express gfp Gene, EA / control means control, not expressed in EA bacteria gfp Gene, EA / Pw means that in EA bacteria, P W Express gfp Gene, PD / control means control, not expressed in PD bacteria gfp gene, PD / Pw means P in PD bacteria W Express gfp Gene.

[0023] Figure 2 The verification bands of Sinorhizobium meliloti SM-Pw-cobFM strain are shown. Lane 1 is the PCR verification band of wild Sinorhizobium meliloti SM, lane 2 is the DNA marker, and lane 3 is the verification band of Sinorhizobium meliloti SM-Pw-cobFM strain with the Pw-cobFM expression cassette successfully inserted. The molecular weights of the bands from top to bottom in the above DNA marker lanes are: 10000 bp, 8000 bp, 6000 bp, 5000 bp, 4000 bp, 3000 bp, 2000 bp, 1000 bp.

[0024] Figure 3 It was shown that the artificial promoter Pw was used to overexpress B 12 Synthetic pathway genes cobFM Recombinant strain B 12 Yield. DETAILED DESCRIPTION

[0025] The following examples and drawings of the present invention only illustrate specific implementation schemes for implementing the present invention. These schemes and drawings should not be understood as limiting the present invention. Any changes made without departing from the principle and essence of the present invention fall within the protection scope of the present invention.

[0026] The experimental techniques and experimental methods used in this embodiment are conventional technical methods unless otherwise specified. The materials, reagents, etc. used in this embodiment can be obtained through regular commercial channels unless otherwise specified.

[0027] Example 1: Design of artificially synthesized promoter Pw sequence

[0028] The artificial promoter Pw is composed of a plasmid vector sequence and cobFMThe present inventors found that this sequence can enhance the expression of some natural promoters, so they extracted it and fused it with the natural promoter to obtain an artificially designed promoter, which is used to express the target gene. The nucleotide sequence is shown in SEQ ID NO: 1.

[0029] Example 2: Construction of an overexpression plasmid vector containing an artificially synthesized promoter Pw

[0030] (1) Gene Synthesis The promoter Pw was artificially synthesized, and the nucleotide sequence is shown in SEQ ID NO: 1.

[0031] (2) Construction of a recombinant vector, comprising the above-mentioned artificial synthetic promoter, the specific construction process is as follows:

[0032] The artificial promoter Pw nucleotide sequence with a linker was amplified using primers Pw-F and Pw-R; the GFPmut1 fragment with a linker was amplified using GFPmut1-F and GFPmut1-R; the plasmid backbone pKP-Gibson with a linker was amplified using primers pKP-ver-F and pKP-ver-R using pME6032 plasmid as a template. The three fragments were recombined by Gibson assembly to obtain the plasmid pKP-Pw-GFP, which was then transformed into 100 μL of E. coli DH5α competent cells. Mix well, put in ice bath for 30min, heat shock in 42℃ water bath for 90s, put on ice for 2min; add 1mL of liquid LB without antibiotics, culture at 220rpm, in 37℃ incubator for 1h; centrifuge the cultured bacterial solution at 5000rpm for 5min, remove part of the supernatant, keep 100μL and apply it on spectinomycin (100mg / L) resistance plate, put it in 37℃ incubator and invert and grow for 16-18h; pick colonies for colony PCR identification, verify primers: YZEF and YZER, the correct band size is 1530bp. After sequencing by sequencing company, the recombinant plasmid with correct sequencing was obtained.

[0033] Among them, the sequences of Pw-F, Pw-R, GFPmut1-F, GFPmut1-R, pKP-ver-F, pKP-ver-R, YZEF and YZER are:

[0034] Pw-F:GATGGTTCCCCCTGTACAGTGACTAATTATATGTCGTTGTGACAATTATTG (SEQ ID NO: 2);

[0035] Pw-R: GTTCTCTCCTTTACTCATTGCACATCCGCTCCATGTCAG (SEQ ID NO: 3);

[0036] GFPmut1-F: GCGGATGTGCAATGAGTAAAGGAGAAGAACTTTTCACTGGAG (SEQ ID NO: 4);

[0037] GFPmut1-R: CCGGGGATCCCTATTTGTATAGTTCATCCATGCCATGTGTAATC (SEQ ID NO: 5);

[0038] pKP-ver-F: TGGATGAACTATACAAATAGGGATCCCCGGGGCATGC (SEQ ID NO: 6);

[0039] pKP-ver-R: ATAATTAGTCACTGTACAGGGGGAACCATCCAACACCTG (SEQ ID NO: 7);

[0040] YZEF: GAATTAACGCCGAATTTCGGTCG (SEQ ID NO: 8);

[0041] YZER: GCCACCAATCCCCATATGGAAAC (SEQ ID NO: 9).

[0042] (3) Transform the correctly sequenced recombinant plasmid into Pseudomonas denitrificans ( Pseudomonas denitrificans )、Adhesive Sword Fungus( Ensifer adherents ) and Sinorhizobium meliloti ( Sinorhizobium meliloti ) to conduct activity test, the specific process is as follows:

[0043] The pKP-Pw-GFP recombinant plasmid was transformed into Pseudomonas denitrificans, Sword-like bacteria and Sinorhizobium meliloti, and single clones were picked and cultured in 5 mL of TYC medium containing spectinomycin (600 mg / L) at 32 °C and 200 rpm overnight. The fluorescence intensity (fluorescence expression intensity at an absorption wavelength of 488 nm and an emission wavelength of 525 nm) and the absorbance at 600 nm (OD 600 ), and the starting strain without plasmid was used as control. Each experiment was performed in triplicate. The results showed that the artificially synthesized promoter Pw can initiate gfp Gene expression, the results are as follows Figure 1TYC medium (g / L): 5% tryptone, 3% yeast extract, 0.67% calcium chloride, 18% agar powder added to solid medium. LB medium (g / L): 10% sodium chloride, 10% tryptone, 5% yeast extract, 15% agar powder added to solid medium.

[0044] Example 3: Artificially synthesized promoter overexpressing B 12 Synthetic pathway genes cobFM The construction method of Pseudomonas denitrificans, Xanthomonas adhering and Sinorhizobium meliloti, taking Sinorhizobium meliloti as an example, comprises the following steps:

[0045] (1) Using the genomic DNA of Sinorhizobium alfalfa as a template, PCR amplified orf933 The upstream homology arm and downstream homology arm of the gene, the artificially synthesized promoter Pw and cobFM Gene;

[0046] (2) Overlap extension PCR orf933 The upstream homology arm of the gene, the artificially synthesized promoter Pw, cobFM Genes and orf933 The downstream homologous arms of the gene are connected together to form the target gene fragment;

[0047] (3) PCR amplification with targeted orf933 The gene editing plasmid vector PBBR-CasX-sgRNA of the site;

[0048] (4) Using Gibson assembly, the target fragment obtained in (2) and the linear plasmid fragment obtained in step (3) were connected to obtain the gene editing plasmid PBBR-CasX-sgRNA-Pw-cobFM;

[0049] (5) The gene editing plasmid PBBR-CasX-sgRNA-Pw-cobFM was transferred into Sinorhizobium meliloti, and apramycin was used as a selection marker to screen for positive transformants;

[0050] (6) Cultivate the positive transformants at 30℃-32℃ until OD 600 The induction agent was added to the plate, and the colony PCR test was performed after dilution and plating. orf933 The upstream homology arm and the downstream homology arm of the gene produce homologous recombination with the genomic DNA of Sinorhizobium meliloti;

[0051] (7) Pick the strain that has correctly undergone homologous recombination and inoculate it into a medium without apramycin. After several transfer cultures, the plasmid is lost. After smearing, place it in a 30℃-32℃ incubator for culture. The grown colonies are copied on plates with apramycin resistance and plates without resistance to obtain the plasmid-free Pw-cobFM expression cassette-inserted strain Sinorhizobium meliloti SM-Pw-cobFM;

[0052] 1. The specific steps of step (1) are:

[0053] According to the genomic DNA sequence of Sinorhizobium meliloti SM orf933 Genes and cobFM Gene sequence, design orf933 The upstream homology arm primers of the gene (orf933-upF, orf933-upR), the downstream homology arm primers (orf933-dF, orf933-dR) and cobFM gene primers (cobFM-F, cobFM-R); and the genomic DNA of Sinorhizobium meliloti SM was used as template, respectively. orf933 The upstream homology arm primer, downstream homology arm primer and cobFM PCR amplification of the gene orf933 The upstream homology arm of the gene (1015bp), orf933 The downstream homology arm of the gene (1027 bp) and cobFM gene (8018 bp); using pKP-Pw-GFP as a template, primers Pw-1F and Pw-1R were designed and used to amplify the Pw promoter (495 bp).

[0054] The primer sequences used are:

[0055] orf933-upF: TCGGTCGAGATCCCGGGAACGCTCTCTGACCGCC (SEQ ID NO: 10);

[0056] orf933-upR:ATTAGTCACTGTACAGTTTGCTATAAACGGCAGAAAGGCC (SEQ ID NO: 11);

[0057] orf933-dF: CGCGGCGAATAGAGAGCGCTTTTGAAGTTCACGCG (SEQ ID NO: 12);

[0058] orf933-dR: CACTCATTAGGCACCTTTCACGCAGACAGCCGAGC (SEQ ID NO: 13);

[0059] cobFM-F: TGGAGCGGATGTGCAATGGAAACGGCAGTGAAGCTTG (SEQ ID NO: 14);

[0060] cobFM-R: GAACTTCAAAAGCGCTCTCTATTCGCCGCGCCCTC (SEQ ID NO: 15);

[0061] Pw-1F: GCGTTTATAGCAAACTGTACAGTGACTAATTATATGTCGTTGTGACAAATTATTG (SEQ IDNO: 16);

[0062] Pw-1R: CACTGCCGTTTCCATTGCACATCCGCTCCATGTC (SEQ ID NO: 17).

[0063] 2. The specific steps of step (2) are:

[0064] by orf933 The upstream homology arm of the gene, the artificially synthesized promoter Pw, cobFM Genes and orf933 The downstream homology arm of the gene was used as a template, and the upstream homology arm primer orf933-upF and the downstream homology arm primer orf933-dR were used as primers. orf933 The upstream homology arm of the gene, the artificially synthesized promoter Pw, cobFM Genes and orf933 The downstream homology arms of the gene were connected together to obtain the target gene fragment (10480 bp);

[0065] 3. The specific steps of step (3) are:

[0066] Using plasmid PBBR-CasX-sgRNA as a template, primers Vector-1F, Vector-1R, Vector-2F, and Vector-2R were designed for PCR amplification to obtain a target gene. orf933 Linearized plasmid vector fragment of the 20 nucleotide sequence of the gene (5124 bp, 4481 bp);

[0067] The primer sequences used are:

[0068] Vector-1F: TAGGCTTCGGAGCTGCCGATGGCTTTGATGCGTTTTACTTATCGGTTTCTC (SEQ IDNO: 18);

[0069] Vector-1R: TCAGAAGAGCGTTCCCGGGATCTCGACCGAAATTCG (SEQ ID NO: 19);

[0070] Vector-2F: GCTGTCTGCGTGAAAGGTGCCTAATGAGTGAGCTAACTTAC (SEQ ID NO: 20);

[0071] Vector-2R: CATCAAAGCCATCGGCAGCTCCGAAGCCTATAACGCAGAAAGGCCCACCC (SEQ ID NO: 21).

[0072] 4. The specific steps of step (4) are:

[0073] The fragment obtained in step (2) and the linear plasmid fragment obtained in step (3) were assembled by Gibson to obtain a ligation product; the product was transformed into Escherichia coli DH5α and screened in a culture medium containing apramycin resistance at 30°C-32°C to obtain transformants, and colony PCR was performed on the transformant colonies (primers used were: YZ-FF / YZ-FR, YZ-N20F / YZ-N20R). If the PCR verification result of the transformant is: electrophoresis bands appear at 10692 bp and 851 bp, the product was sent for sequencing. If the sequence is correct, it means that the knockout vector was successfully constructed, and the above transformant is a positive transformant, and the gene editing plasmid PBBR-CasX-sgRNA-Pw-cobFM is obtained;

[0074] The primer sequences used are:

[0075] YZ-FF: CTGGGTGGCAGGATATATTGTGGTG (SEQ ID NO: 22);

[0076] YZ-FR: CAATACGAAAACCGCCTCTC (SEQ ID NO: 23);

[0077] YZ-N20F: GTGGCCATGAAGTTCATGCTG (SEQ ID NO: 24);

[0078] YZ-N20R:GAAGTCCAGCGCCAGAAACAG (SEQ ID NO: 25).

[0079] 5. The specific steps of step (5) are:

[0080] The gene editing plasmid PBBR-CasX-sgRNA-Pw-cobFM was transferred into Sinorhizobium meliloti, and the transformants were screened at 30℃-32℃ in a culture medium containing apramycin resistance. The transformants were verified by colony PCR (primers used were: YZ-FF / YZ-FR). If the PCR verification result of the transformant is: an electrophoresis band appears at 10692 bp, it proves that the gene editing plasmid PBBR-CasX-sgRNA-Pw-cobFM was successfully transferred into Sinorhizobium meliloti, and at this time, the transformant is a positive transformant (i.e., Sinorhizobium meliloti SM transferred with the gene editing plasmid PBBR-CasX-sgRNA-Pw-cobFM).

[0081] 6. The specific steps of step (6) are:

[0082] The positive transformants obtained in step (5) were cultured at 30°C-32°C on a culture medium containing apramycin resistance. 600 When the pH value is about 0.8, add IPTG with a final concentration of 1mM for induction. After 24h of induction, dilute the cells by about 10 5 After folding, plate the transformants and perform colony PCR verification (primers used are: YZ-ISF / YZ-ISR); if the PCR verification result of the transformant is: an electrophoresis band appears at 10816 bp, it means that the genome of Sinorhizobium alfalfa SM orf933 The gene locus was successfully inserted into the Pw-cobFM expression cassette, and the transformant was a positive transformant, such as Figure 2 As shown. Then DNA sequencing was performed on the positive transformants for further verification. cobFM Gene overexpression strain (i.e., Sinorhizobium meliloti SM-Pw-cobFM).

[0083] The primer sequences used are:

[0084] YZ-ISF:CGTTCCGACAATCGATACTACACATCC (SEQ ID NO: 26);

[0085] YZ-ISR: CGCTTGACGCTTGCAAATCAG (SEQ ID NO: 27).

[0086] 7. The specific steps of step (6) are:

[0087] The strain in which homologous recombination has correctly occurred was inoculated into a culture medium without apramycin at 30°C-32°C and cultured several times to lose the plasmid. After plating, the plate was placed in an incubator at 30°C-32°C for culture, and the grown colonies were photocopied on apramycin-resistant and non-resistant plates. The colonies that grew on the non-resistant plates but not on the apramycin-resistant plates were picked, indicating that the plasmid of this colony had been completely lost during the subculture process, and finally the plasmid-free Pw-cobFM expression cassette-inserted strain Sinorhizobium meliloti SM-Pw-cobFM was obtained.

[0088] The recombinant strains PD-Pw-cobFM and EA-Pw-cobFM were obtained by the same method.

[0089] Example 4: Shake flask fermentation of recombinant strains PD-Pw-cobFM, EA-Pw-cobFM and SM-Pw-cobFM to produce vitamin B 12 Yield determination.

[0090] The present inventors also provide the above-mentioned recombinant strains PD-Pw-cobFM, EA-Pw-cobFM and SM-Pw-cobFM in vitamin B 12 The application in production includes the following steps: A seed fermentation, B production fermentation.

[0091] The medium formula of the seed fermentation is (g / L): sucrose 40, corn steep liquor 20, betaine 5, (NH 4)2 SO 4 1, (NH 4 ) 2 HPO 4 2. MnSO 4 ·H 2 O 0.8, CoCl 2 6H 2 O 0.02, MgO 0.3, DMBI 0.01, ZnSO4·7H 2 O 0.01, CaCO 3 1.5, pH was controlled at 7.0-7.4 by NaOH.

[0092] The fermentation medium formula is (g / L): sucrose 80, corn syrup 30, betaine 15, (NH 4 ) 2 SO 4 2. MgSO 4 1.5, K 2 HPO 4 0.75, CoCl 2 6H 2 O 0.14, DMBI 0.075, ZnSO4 7H 2 O 0.08, CaCO 3 1. The pH is controlled at 7.0-7.4 by NaOH.

[0093] The specific steps of seed fermentation are: first activate Pseudomonas denitrificans PD, PD-Pw-cobFM, Sword-like bacteria EA, EA-Pw-cobFM, and Sinorhizobium alfalfa SM, SM-Pw-cobFM, that is, first spread the frozen bacteria on LB solid culture medium, then inoculate the activated bacteria into the culture medium for seed fermentation and culture at 180-250 rpm and 30-32°C for 24-36h to obtain seed solution; the specific steps of production fermentation are: add 25-30mL of production fermentation culture medium into a 250mL triangular flask, then ferment and culture the seed solution with an inoculation amount of 10% (volume percentage), a rotation speed of 180-250 rpm, a temperature of 30-32°C for 7 days to obtain production fermentation bacterial solution. The specific steps of seed fermentation and production fermentation are both prior art.

[0094] The inventors used high performance liquid chromatography (HPLC) to analyze the vitamin B12 in the fermented bacterial broth produced in the above embodiment. 12 The yield was determined. Sample pretreatment: Take 1 mL of fermentation broth, add 8% sodium nitrite solution and 0.1 mL of glacial acetic acid, shake well, and place in a 95-100°C water bath for 30-60 minutes; after cooling to room temperature, centrifuge at 10,000 rpm for 1 min, and filter the supernatant through a 0.22 μm membrane filter into a sample bottle. The amount of sodium nitrite solution and glacial acetic acid added can be adjusted accordingly with the amount of fermentation broth. The specific determination conditions are: C18-250A column (Agilent, 4.6mmid 9×250mm, 5μm). The mobile phase is 30% organic phase (methanol) and 70% inorganic phase (water), the absorption wavelength is 361nm, the column temperature is 35°C, the flow rate is 0.8mL / min, and the injection volume is 15 μL. According to vitamin B 12 The standard curve prepared by the standard product can calculate the vitamin B content in the fermentation liquid 12 of production.

[0095] The above test results are as follows Figure 3 The results show that under the same seed fermentation and production fermentation conditions, compared with the prior art Pseudomonas denitrificans PD, Sword-like bacteria EA and Sinorhizobium meliloti SM, the production fermentation of Pseudomonas denitrificans PD-Pw-cobFM, Sword-like bacteria EA-Pw-cobFM and Sinorhizobium meliloti SM-Pw-cobFM of the present invention contains more vitamin B 12The potency has been greatly improved (increased by ~20%), indicating that the technical solution of the present invention is effective in increasing the potency of vitamin B 12 It has significant application value in terms of output.

[0096] The above are only preferred embodiments of the present invention, and are not limited to the above examples. For those skilled in the art, various changes and variations are possible under the principle of the present invention. Any modifications and improvements made should be considered within the scope of protection of the present invention.

Claims

1. An artificial synthetic promoter, characterized in that: The nucleotide sequence thereof is shown in SEQ ID NO:

1.

2. An expression cassette containing the artificial synthetic promoter as claimed in claim 1.

3. A recombinant vector containing the artificial synthetic promoter as claimed in claim 1 or the expression cassette as claimed in claim 2.

4. The recombinant vector according to claim 3, characterized in that The backbone vector of the recombinant vector is a broad host shuttle plasmid vector containing a replicon and a mob gene which can be recognized by Gram-negative bacteria.

5. The recombinant vector according to claim 4, characterized in that The vector backbone of the recombinant vector is PBBR1MCS2 or pME6032.

6. A recombinant bacterium containing the artificial synthetic promoter as claimed in claim 1, or the recombinant vector as claimed in any one of claims 3 to 5.

7. The recombinant bacterium according to claim 6, characterized in that The recombinant bacteria produces vitamin B 12 strains of Pseudomonas denitrificans ( Pseudomonas denitrificans )、Adhesive Sword Fungus( Ensifer adherents ) or Sinorhizobium meliloti ( Sinorhizobium meliloti ).

8. Use of the artificial synthetic promoter as claimed in claim 1 in initiating the expression of a target gene.

9. The use according to claim 8, characterized in that The target gene is to synthesize vitamin B 12 Related genes, by starting the expression of the target gene to make the recombinant bacteria produce vitamin B 12 .

10. The use according to claim 9, characterized in that The recombinant bacteria are obtained by introducing the recombinant vector according to any one of claims 3 to 5.

11. The use according to claim 10, characterized in that The recombinant bacteria produces vitamin B 12 strains of Pseudomonas denitrificans ( Pseudomonas denitrificans )、Adhesive Sword Fungus( Ensifer adherents ) or Sinorhizobium meliloti ( Sinorhizobium meliloti ).

Images