A method for identifying arisaema amurense and zantedeschia

Abstract

The present application relates to the technical field of molecular marker, and particularly relates to a method for identifying and distinguishing between Arisaema amurense and Arisaema erubescens by using molecular marker. The method can accurately identify and distinguish between Arisaema amurense and Arisaema erubescens by sequencing or electrophoresis.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, and particularly relates to a method for identifying Arisaema amurense and Arisaema bockii by using molecular markers. BACKGROUND

[0002] Arisaema amurense Maxim. and Arisaema bockii Engler are both perennial herbs of Arisaema in Araceae, and Arisaema amurense is one of the original bases of Arisaema prescribed in Chinese Pharmacopoeia. According to the description of the identification points of the two species in Chinese Plant Flora, Arisaema amurense has one leaf, and Arisaema bockii has two leaves. However, in the field observation of Arisaema amurense and Arisaema bockii, it is found that Arisaema amurense often has two leaves, and Arisaema bockii often has one leaf, and both of them have short-stalked club-shaped appendages, and the leaf blades are both bird-toe-shaped compound leaves. Figure 1

[0003] Therefore, it is difficult to distinguish the two species according to the description in Chinese Plant Flora, so that Arisaema bockii with one leaf is mistakenly included as Arisaema amurense in Anhui Plant Flora, which shows that it is possible for professionals to make mistakes in distinguishing Arisaema bockii and Arisaema amurense according to traditional taxonomy, which may lead to Arisaema bockii being mistakenly used as Arisaema amurense in medicine. Therefore, it is necessary to seek a new way to distinguish the two species, and molecular identification is a relatively fast and reliable identification method at present, and the development of molecular markers for identifying Arisaema amurense and Arisaema bockii can provide an important basis for the management of germplasm resources and the formulation of standards for Chinese medicinal materials. SUMMARY

[0004] The present application mainly aims at the above technical problems, and provides a simple method for identifying and distinguishing Arisaema amurense and Arisaema bockii by using molecular markers.

[0005] Specifically, the present application provides the following technical solutions:

[0006] In a first aspect, the present application provides a method for identifying and distinguishing Arisaema amurense and Arisaema bockii, characterized in comprising the following steps:

[0007] 1) extracting total DNA of a sample to be detected;

[0008] 2) sequencing the total DNA to obtain a sequencing sequence;

[0009] 3) comparing the sequencing sequence to a DNA barcode, wherein the DNA barcode is any one of SEQ ID NO. 1-4;

[0010] ​4) judging the species of the sample according to the coverage of sequencing reads on the DNA barcode, such as being able to completely cover SEQ ID NO. 1 and / or SEQ ID NO. 4,

[0011] that is, judging that the species of the sample to be detected contains Arisaema amurense; such as being able to completely cover SEQ ID NO. 2 and / or SEQ ID NO. 3, that is, judging that the species of the sample to be detected contains Arisaema erubescens.

[0012] Further, the sample in step 1) is a single-species sample or a mixed multi-species sample.

[0013] Further, the high-throughput sequencing in step 2) is second-generation sequencing or third-generation sequencing.

[0014] Further, the polar reads alignment in step 3) uses any one of Geneious, Bowtie, Bowtie, Tophat or HISAT.

[0015] In another aspect, the present application provides a second method for identifying and distinguishing Arisaema amurense and Arisaema erubescens, characterized in comprising the following steps:

[0016] 1) extracting total DNA of the sample to be detected;

[0017] 2) using primer pairs to respectively PCR the total DNA of the sample, wherein the upstream primer of the primer pair is any one of SEQ ID NO. 5-9, and the downstream primer is any one of SEQ ID NO. 10-14;

[0018] 3) using SEQ ID NO. 1 and / or SEQ ID NO. 2 as a standard, performing electrophoresis detection on the PCR product and the standard, and judging the species information of the sample to be detected according to the electrophoresis result;

[0019] When the electrophoresis result shows that the length of the PCR product is close to that of SEQ ID NO. 1, and / or greater than that of SEQ ID NO. 2, it is judged that the sample to be detected is Arisaema amurense;

[0020] When the electrophoresis result shows that the length of the PCR product is close to that of SEQ ID NO. 2, and / or less than that of SEQ ID NO. 1, it is judged that the sample to be detected is Arisaema erubescens;

[0021] When the electrophoresis result shows that the PCR product contains two main bands, and the lengths of the two main bands are close to those of SEQ ID NO. 1 and SEQ ID NO. 2 respectively, it is judged that the sample to be detected contains both Arisaema amurense and Arisaema erubescens.

[0022] Further, the upstream primer of the primer is SEQ ID NO. 5, and the downstream primer is SEQ ID NO. 10.

[0023] In another aspect, the present application provides a third method for identifying and distinguishing between A. fimbriatum and A. speciosum, which comprises the following steps:

[0024] 1) extracting total DNA of the sample to be detected;

[0025] 2) PCR of the total DNA of the sample using a primer pair, wherein the upstream primer of the primer is any one of SEQ ID NO. 15-19, and the downstream primer is any one of SEQ ID NO. 20-24;

[0026] 3) electrophoresis detection of the PCR product and the standard product using SEQ ID NO. 3 and / or SEQ ID NO. 4 as the standard product, and determining the species information of the sample to be detected according to the electrophoresis result;

[0027] When the electrophoresis result shows that the length of the PCR product is close to that of SEQ ID NO. 3 and / or greater than that of SEQ ID NO. 4, it is determined that the sample to be detected is A. speciosum;

[0028] When the electrophoresis result shows that the length of the PCR product is close to that of SEQ ID NO. 4 and / or less than that of SEQ ID NO. 3, it is determined that the sample to be detected is A. fimbriatum;

[0029] When the electrophoresis result shows that the PCR product contains two main bands, and the lengths of the two main bands are close to those of SEQ ID NO. 3 and SEQ ID NO. 4 respectively, it is determined that the sample to be detected contains both A. fimbriatum and A. speciosum.

[0030] Further, the upstream primer of the primer is SEQ ID NO. 15, and the downstream primer is SEQ ID NO. 20.

[0031] 5. In another aspect, the present application provides a fourth method for identifying and distinguishing between A. fimbriatum and A. speciosum, which comprises the following steps:

[0032] 1) extracting total DNA of the sample to be detected;

[0033] 2) PCR of the total DNA of the sample using a primer pair, wherein the primer is two pairs of primers;

[0034] The upstream primer of the first pair of primers is any one of SEQ ID NO. 5-9, and the downstream primer is any one of SEQ ID NO. 10-14;

[0035] The upstream primer of the second pair of primers is any one of SEQ ID NO. 15-19, and the downstream primer is any one of SEQ ID NO. 20-24.

[0036] 3) The PCR products and standards are detected by electrophoresis with SEQ ID NO. 1 and / or SEQ ID NO. 2 and / or SEQ ID NO. 3 and / or SEQ ID NO. 4 as the standard, and the species information of the sample to be detected is determined according to the electrophoresis results, and the table is as follows:

[0037] a. When the electrophoresis result shows that the PCR product of the first pair of primers is close in length to SEQ ID NO. 1, and / or greater than SEQ ID NO. 2,

[0038] and the PCR product of the second pair of primers is close in length to SEQ ID NO. 4, and / or less than SEQ ID NO. 3, it is determined that the sample to be detected is northeast aconite;

[0039] b. When the electrophoresis result shows that the PCR product of the first pair of primers is close in length to SEQ ID NO. 2, and / or less than SEQ ID NO. 1,

[0040] and the PCR product of the second pair of primers is close in length to SEQ ID NO. 3, and / or greater than SEQ ID NO. 4, it is determined that the sample to be detected is lampstand lotus;

[0041] c. When the electrophoresis result shows that the PCR product of the first pair of primers contains two main bands, and is close in length to SEQ ID NO. 1 and SEQ ID NO. 2, respectively,

[0042] and the PCR product of the second pair of primers contains two main bands, and is close in length to SEQ ID NO. 3 and SEQ ID NO. 4, respectively, it is determined that the sample to be detected contains northeast aconite and lampstand lotus.

[0043] Further, the upstream primer of the first pair of primers is SEQ ID NO. 5, and the downstream primer is SEQ ID NO. 10, the upstream primer of the second pair of primers is SEQ ID NO. 15, and the downstream primer is SEQ ID NO. 20.

[0044] In a preferred case, the PCR reaction conditions are as follows: the PCR amplification reaction system is 25 μL, 2x Phanta Max Master Mix 12.5 μL, 1 μL of each of the upstream primer (10 μM) and the downstream primer (10 μM), 200-300 ng of DNA template, and ddH2O is supplemented to 25 μL. The 2x Phanta Max Master Mix contains Phanta Max Super-Fidelity DNA Polymerase, dNTP, a protective agent, and a buffer system; the PCR amplification procedure is as follows: ① 95°C pre-denaturation for 3 min; ② 95°C denaturation for 15 s, 60°C annealing for 15 s, 72°C extension for 75 s, 35 cycles; and ③ 72°C extension for 5 min.

[0045] In another preferred case, the PCR amplification product electrophoresis conditions are as follows: the PCR product is detected by 1% agarose gel electrophoresis, 10x Loading Buffer is used for staining and loading, and the PCR amplification condition is observed under a gel imaging system.

[0046] Compared with the prior art, the identification method of the present application can simply and effectively distinguish whether the to-be-tested variety is Arisaema amurense or Arisaema erubescens, thereby providing a guarantee for the identification, planting, resource utilization, and breeding of Arisaema amurense and Arisaema erubescens. It also has important significance for the classification, phylogenetic development, and systematic geography of Arisaema species, and the protection and utilization of Arisaema resources. BRIEF DESCRIPTION OF DRAWINGS

[0047] Figure 1 Different numbers of leaves of Arisaema amurense and Arisaema erubescens samples; wherein A is double-leaf Arisaema erubescens, B is single-leaf Arisaema erubescens, C is double-leaf Arisaema amurense, and D is single-leaf Arisaema amurense.

[0048] Figure 2 is the molecular marker SEQ ID NO. 1 and SEQ ID NO. 2 of Arisaema amurense and Arisaema erubescens obtained by high-throughput sequencing assembly and comparative analysis results; wherein sequence 1 is Arisaema amurense, and sequence 2 is Arisaema erubescens.

[0049] Figure 3 is the molecular marker SEQ ID NO. 3 and SEQ ID NO. 4 of Arisaema amurense and Arisaema erubescens obtained by high-throughput sequencing assembly and comparative analysis results; wherein sequence 1 is Arisaema amurense, and sequence 2 is Arisaema erubescens.

[0050] Figure 4 is the result of aligning the reads of the second-generation high-throughput sequencing of Arisaema amurense to the molecular marker sequence, Figure 4 A and B are the alignment results on SEQ ID NO. 1 and SEQ ID NO. 4, respectively,Figure 4 C, D are the alignment results on SEQ ID NO. 2 and SEQ ID NO. 3, respectively.

[0051] Figure 5 is the result of aligning reads of second-generation high-throughput sequencing of Zantedeschia aethiopica to molecular marker sequences, Figure 5 A, B are the alignment results on SEQ ID NO. 2 and SEQ ID NO. 3, respectively, Figure 5 C, D are the alignment results on SEQ ID NO. 1 and SEQ ID NO. 4, respectively.

[0052] Figure 6 is an electrophoresis picture of PCR products of 6 (three of each of two leaves) Arisaema amurense samples and 6 (three of each of two leaves) Zantedeschia aethiopica amplified by SEQ ID NO. 5-10, wherein M is mark, 1-3 are double leaves of Arisaema amurense, 4-6 are single leaves of Arisaema amurense, 7-9 are double leaves of Zantedeschia aethiopica, and 10-12 are single leaves of Zantedeschia aethiopica.

[0053] Figure 7 is an electrophoresis picture of PCR products of 6 (three of each of two leaves) Arisaema amurense samples and 6 (three of each of two leaves) Zantedeschia aethiopica amplified by SEQ ID NO. 15-20, wherein M is mark, 1-3 are double leaves of Arisaema amurense, 4-6 are single leaves of Arisaema amurense, 7-9 are double leaves of Zantedeschia aethiopica, and 10-12 are single leaves of Zantedeschia aethiopica. DETAILED DESCRIPTION

[0054] In order to make the purposes, technical solutions and beneficial technical effects of the present application clearer, the present application will be further described in detail below in combination with examples. It should be understood that the following examples are given only for the purpose of illustration and are not intended to limit the scope of the present application. Those skilled in the art can make various modifications and replacements to the present application without departing from the spirit and principles of the present application. The experimental methods used in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained from commercial channels unless otherwise specified.

[0055] The Arisaema amurense and Zantedeschia aethiopica plant samples used in the following examples can be obtained through commercial purchase or collected from the wild.

[0056] Example 1 Collection of Arisaema amurense and Zantedeschia aethiopica

[0057] The Arisaema amurense and Zantedeschia aethiopica of the present application are collected from Jilin City, Jilin Province and Lu'an City, Anhui Province, respectively.

[0058] Example 2 Development of specific molecular markers for Arisaema amurense and Zantedeschia aethiopica

[0059] The specific molecular marker distinguishing between A. chinensis and A. speciosum is obtained by the following steps, i.e. molecular marker:

[0060] 1) Collecting leaves of A. chinensis and A. speciosum;

[0061] 2) Extracting total DNA from leaves of A. chinensis and A. speciosum;

[0062] 3) Performing second-generation high-throughput sequencing on the total DNA to obtain sequencing reads;

[0063] 4) Performing genome assembly on A. chinensis and A. speciosum to obtain genome contigs sequences.

[0064] 5) Comparing the genome contigs of A. chinensis and A. speciosum to obtain species-specific fragments, i.e. molecular marker.

[0065] The results are shown in Figure 2 and Figure 3 , Figure 2 It is shown that compared with A. speciosum, A. chinensis has an insertion sequence of 143 bp in the genome, which is long and can be used as an Indel molecular marker to distinguish between A. chinensis and A. speciosum by conventional PCR and agarose gel electrophoresis.

[0066] The insertion sequence of 143 bp in the genome of A. chinensis is shown below, wherein the underlined part of SEQ ID NO. 1 is the insertion fragment specific to A. chinensis, and the sequence of the homologous region in the genome of A. speciosum is shown in SEQ ID NO. 2, and the dash '-' represents the fragment deleted in the homologous region of the genome of A. speciosum relative to A. chinensis:

[0067] 5'-GCCGAAAAGAACGAGCATCCTTATGTATTTGCATATATCTTTTTTTATAATATATACAGAATGCGCAGGGGCAGGGACCTTACCCACAATCCATATATACAAGATCTAAATACAAGATAAGATCTAAGGCTAAACAACTAAATATTTCTTTTTATTATTTGTTGGATCTATAAAAAATCCTATGGATCCTTTTGATTGGTAGATTATTTTATATACCAGAGTTTCAGACCATAGCTCAACCCAAGGGAGGGTATCTTCCACTGGTCCTGTATATTGTCTTTTTCGTTCCGTGTCGTGTTCCTATGGAAACTAATATTATACGAGAATGAATTCTTTCCAGAGGTAACAAGTATTTCTACTTTCGATGAAAATTTATACACGATATACGATATGAGAAGAAACCCCTACTTATATTTTTTTCTATTTTTTATAATTGAGGAAAAGATTCCATTATTTAAATCATAAATCATAATCATATTAAATCATAAGAAATC ATATATATAAATCATAAATCATAATAA ATCATATTCATATACATATTCATATAATCATATATATAATATATATAATAAATCATAATCATATATAAATCATATC ATATATAAATCATATTAAATCATATATAAATCATATTCAT ATATCATATATATAATCATATAACTAATACATAATAATAATATATATTGAAATGAGACCCTGGATCCCCACAACACAAAAAAAAATTATTTCTTTCAATACTCATTCGTATTAGTTAACGATCCAAACGGCTGGATCCATATGCTTAATTCTGATACGAAATCAAATAGTAAAATAATTATTCATCGAATGACTATTCATCCATTATATTTTCAAATAAGGCGCGGGAAGATTCTATG-3' (SEQ ID NO. 1)

[0068] 5'-GCCGAAAAGAACGAGCATCCTCATGTATTTGCATATATCTTTTTTTATAATATATACAGAATGCGCAGGGGCAGGGACCTTACCCACAATCCATATATACAAGATCTAAATACAAGATAAGATCTAAGGCTAAACAACTAAATATTTCTTTTTATTATTTGTTGGATCTATAAAAAATCCTATGGATCCTTTGGATTGGTAGATTATTTTATATACCAGAGTTTCAGACCATAGCTCAACCCAAGGGAGGGTATCTTCCACCGGTCCTGTATATTGTCTTTTTCGTTCCGTGTCGTGTTCCTATGGAAACTAATATTATATATTATACGAGAATGAATTCTTTCCAGAGGTAACAAGTATTTCTACTTTCGATGAAAATTTATACACGATATACGATATGAGAAGAAACCCCTACTTATATTTTTTTTCTATTTTTTATAATTGAGGAAAAGATTCCATTATTTAAATCATAAATCATAATCATATTAAATCATAAGAAATC-----------------------------------------------------------------------------------------------------------------------------------------------ATATCATATATATAATCATATAACTAATACATAATAATAATATATATTGAAATGAGACCCTGGATCCCCACAACACAAAAAAAAATTATTTCTTTCAATACTCATTCGTATTAGTTAACGACCCAAACGGCTGGATCCATATGTTTAATTCTGATACGAAATCAAATAGTAAAATAATTATTCATCGAATGACTATTCATCCATTATATTTTCAAATAAGGCGCGGGAAGATTCTATG-3' (SEQ ID NO. 2)

[0069] Figure 3A 491 bp AT-rich region was found in the genome of Z. candidum, with an AT content of 98.6%. In comparison, the homologous region in the genome of Z. aquatilis was only 223 bp, with an AT content of 96.9%. In comparison with Z. aquatilis, the genome of Z. candidum had 268 bp of continuous insertion sequences arranged in intervals in the above-mentioned region. These insertion sequences were long in total length, and were speculated to be used as molecular markers to identify and distinguish Z. aquatilis and Z. candidum through conventional PCR and agarose gel electrophoresis.

[0070] The base sequence of the genome of Z. candidum in the above-mentioned region was SEQ ID NO. 3, wherein the sequence in the AT-rich region was in bold font with a gray background, and the underlined part was the insertion fragment specific to the genome of Z. candidum. The base sequence of the genome of Z. aquatilis in the above-mentioned homologous region was SEQ ID NO. 4, wherein the sequence in the AT-rich region was in bold font with a gray background, and the dash '-' represented the deletion fragment of the genome of Z. aquatilis relative to the homologous region of the genome of Z. candidum:

[0071]

[0072] Example 3 Design of primers for specific molecular markers of Z. aquatilis and Z. candidum

[0073] According to the alignment results in Example 2, and in combination with the corresponding contig sequences, a plurality of pairs of PCR primers for identifying Z. aquatilis and Z. candidum were designed using Geneious software, and the primer sequences were as follows:

[0074] Primers for SEQ ID NO. 1 and homologous sequences thereof

[0075] Forward primer TM-4F1: 5'-GCCGAAAAGAACGAGCATCC-3' (SEQ ID NO. 5)

[0076] Forward primer TM-4F2: 5'-CCGCTGCTTGTGAGATTTGG-3' (SEQ ID NO. 6)

[0077] Forward primer TM-4F3: 5'-TGAGCCGAAAAGAACGAGCA-3' (SEQ ID NO. 7)

[0078] Forward primer TM-4F4: 5'-TATACAGAATGCGCAGGGGC-3' (SEQ ID NO. 8)

[0079] Forward primer TM-4F5: 5'-CGTTCCGTGTCGTGTTCCTA-3' (SEQ ID NO. 9)

[0080] Reverse primer TM-4R1 : 5'-CATAGAATCTTCCCGCGCCT-3' (SEQ ID NO. 10)

[0081] Reverse primer TM-4R2: 5'-TGGGGATCCAGGGTCTCATT-3' (SEQ ID NO. 11)

[0082] Reverse primer TM-4R3: 5'-TTGTGTTGTGGGGATCCAGG-3' (SEQ ID NO. 12)

[0083] Reverse primer TM-4R4: 5'-TCCATAGAATCTTCCCGCGC-3' (SEQ ID NO. 13)

[0084] Reverse primer TM-4F5: 5'-TCTTCCCGCGCCTTATTTGA-3' (SEQ ID NO. 14)

[0085] This pair of primers of SEQ ID NO. 2 and SEQ ID NO. 3

[0086] Forward primer TM-8F1 : 5'-GCAGAACCGGACATGAGAGT-3' (SEQ ID NO. 15)

[0087] Forward primer TM-8F2: 5'-ACTGCAGAACCGGACATGAG-3' (SEQ ID NO. 16)

[0088] Forward primer TM-8F3: 5'-CTGCAGAACCGGACATGAGA-3' (SEQ ID NO. 17)

[0089] Forward primer TM-8F4: 5'-TGCAGAACCGGACATGAGAG-3' (SEQ ID NO. 18)

[0090] Forward primer TM-8F5: 5'-GGCTCCTCGCGAAAGAAGAA-3' (SEQ ID NO. 19)

[0091] Reverse primer TM-8R1 : 5'-ATTCATTGGGTGGGATGGCG-3' (SEQ ID NO. 20)

[0092] Reverse primer TM-8R2: 5'-GGAACCCGTGACTGCATAGG-3' (SEQ ID NO. 21)

[0093] Reverse primer TM-8R3: 5'-AGAGTCAATATTCGCCCGCG-3' (SEQ ID NO.22)

[0094] Reverse primer TM-8R4: 5'-GAACCCGTGACTGCATAGGA-3' (SEQ ID NO.23)

[0095] Reverse primer TM-8F5: 5'-ATTGACGGAGAAGCCATGGG-3' (SEQ ID NO.24)

[0096] Example 4: Identification method of Northeastern Arisaema and Lantern Lotus 2

[0097] 1) Leaves of *Arisaema heterophyllum* and *Liriope muscari* were collected as samples for testing.

[0098] 2) Extract total DNA from the sample to be tested;

[0099] 3) Perform next-generation high-throughput sequencing on the total DNA of the two samples to obtain sequencing reads;

[0100] 3) Using the default parameters of Geneious software, align the above sequencing reads to the molecular markers described in Example 2;

[0101] 4) Determine whether the sample is *Arisaema heterophyllum* or *Lycoris radiata* based on the coverage of the sequencing reads on the molecular markers; if SEQ ID NO.1 and SEQ ID NO.4 are completely covered, the species of the sample to be tested is *Arisaema heterophyllum*; if SEQ ID NO.2 and SEQ ID NO.3 are completely covered, the species of the sample to be tested is *Lycoris radiata*.

[0102] Test results as follows Figures 6-7 As shown, where Figure 4 The sample is from Northeast Arisaema. The figure shows that the sequencing reads completely cover SEQ ID NO.1 and SEQ ID NO.4. Figure 4 A, B), while SEQ ID NO.2 and SEQ ID NO.3 have a large number of uncovered areas ( Figure 4 C, D). Figure 5 The sample is a *Ligustrum lucidum*. The image shows that the sequencing reads completely cover SEQ ID NO.2 and SEQ ID NO.3. Figure 5 A and B), while there are a large number of uncovered areas in SEQ ID NO.1 and SEQ ID NO.4.

[0103] Example 5: Identification method of Northeastern Arisaema and Lantern Lotus 1

[0104] 1) Collect leaves of Arisaema heterophyllum and Lithops truncata as samples to be tested, with 3 double-leaf and 3 single-leaf samples of each plant.

[0105] 2) Extract total DNA from the sample to be tested;

[0106] 3) Using the primers designed in Example 3 (using TM-4F1 and TM-4R1, TM-8F1 and TM-8R1 for amplification respectively), the total DNA of the above samples was PCRed.

[0107] The PCR amplification reaction system consisted of 25 μL of 2×Phanta Max Master Mix, 1 μL each of upstream (10 μM) and downstream (10 μM) primers, 200-300 ng of DNA template, and ddH2O to bring the total volume to 25 μL. The 2×Phanta Max Master Mix contained Phanta Max Super-Fidelity DNA Polymerase, dNTPs, a protective agent, and a buffer system.

[0108] The PCR amplification program was as follows: ① 95℃ pre-denaturation for 3 min; ② 95℃ denaturation for 15 s, 60℃ annealing for 15 s, 72℃ extension for 75 s, 35 cycles; ③ 72℃ extension for 5 min; 4) PCR product detection: PCR products were detected by 1% agarose gel electrophoresis, stained with 10× Loading Buffer, and the PCR amplification was observed under a gel imaging system. The main band was clear. Figure 6 , Figure 7 ).

[0109] from Figure 6 The results show that the PCR product length of *Arisaema heterophyllum* (wells 1-6) is significantly longer than that of *Ligustrum lucidum* (wells 7-12), which is in line with expectations. Figure 7 As can be seen, the PCR product length of *Arisaema heterophyllum* (wells 1-6) is significantly shorter than that of *Ligustrum lucidum* (wells 7-12), consistent with expectations. This demonstrates that the above identification method can provide a simple and effective way to identify and differentiate between *Arisaema heterophyllum* and *Ligustrum lucidum*.

[0110] Based on the disclosure and teachings of the foregoing specification, those skilled in the art can make appropriate changes and modifications to the above embodiments. Therefore, the present invention is not limited to the specific embodiments disclosed and described above, and some modifications and changes to the present invention should also fall within the protection scope of the claims of the present invention. Furthermore, although some specific terms are used in this specification, these terms are only for convenience of explanation and do not constitute any limitation on the present invention.

Claims

1. A method for identifying and distinguishing Arisaema amurense and Arisaema griffithii, characterized by Comprising the following steps: 1) Extracting total DNA of the sample to be detected, the sample being Zantedeschia aethiopica and / or Arisaema amurense Maxim; 2) High-throughput sequencing of the total DNA, obtaining sequencing reads sequences; 3) Aligning the sequencing reads sequences to the DNA barcodes, the DNA barcodes being SEQ ID NO. 1~4; 4) Judging the species of the sample according to the coverage of the sequencing reads sequences on the DNA barcodes, such as completely covering SEQ ID NO. 1 and SEQ ID NO. 4, that is, judging that the species of the sample to be detected contains Arisaema amurense Maxim; such as completely covering SEQ ID NO. 2 and SEQ ID NO. 3, that is, judging that the species of the sample to be detected contains Zantedeschia aethiopica.

2. The method for identifying and distinguishing between *Arisaema heterophyllum* and *Ligustrum lucidum* as described in claim 1, characterized in that, The sample in step 1) is a single-species sample or a mixed multi-species sample.

3. The method for identifying and distinguishing between *Aristolochia debilis* and *Ligustrum lucidum* as described in claim 1, characterized in that... The high-throughput sequencing in step 2) is second-generation sequencing or third-generation sequencing.

4. The method for identifying and distinguishing between *Aristolochia debilis* and *Ligustrum lucidum* as described in claim 1, characterized in that... In step 3), any one of Geneious, Bowtie, Tophat or HISAT software is used for reads alignment.

5. A method for identifying and distinguishing Arisaema amurense and Arisaema griffithii, characterized by Comprising the following steps: 1) Extracting total DNA of the sample to be detected, the sample being Zantedeschia aethiopica and / or Arisaema amurense Maxim; 2) Using primers to respectively PCR the total DNA of the sample, the primers being two pairs of primers; The upstream primer of the first pair of primers is SEQ ID NO. 5, and the downstream primer is SEQ ID NO. 10; The upstream primer of the second pair of primers is SEQ ID NO. 15, and the downstream primer is SEQ ID NO. 20; 3) Taking SEQ ID NO. 1~SEQ ID NO. 4 as a standard, performing electrophoresis detection on the PCR product and the standard, and judging the species information of the sample to be detected according to the electrophoresis result, the judgment criteria being as follows: a. When the electrophoresis result shows that the PCR product of the first pair of primers is close in length to SEQ ID NO. 1, and greater than SEQ ID NO. 2, and the PCR product of the second pair of primers is close in length to SEQ ID NO. 4, and less than SEQ ID NO. 3, it is judged that the sample to be detected is Arisaema amurense Maxim; b. When the electrophoresis result shows that the PCR product of the first pair of primers is close in length to SEQ ID NO. 2, and less than SEQ ID NO. 1, and the PCR product of the second pair of primers is close in length to SEQ ID NO. 3, and greater than SEQ ID NO. 4, it is judged that the sample to be detected is Zantedeschia aethiopica; c. When the electrophoresis result shows that the PCR product of the first pair of primers contains two main bands, and is close in length to SEQ ID NO. 1 and SEQ ID NO. 2 respectively, and the PCR product of the second pair of primers contains two main bands, and is close in length to SEQ ID NO. 3 and SEQ ID NO. 4 respectively, it is judged that the sample to be detected contains Arisaema amurense Maxim and Zantedeschia aethiopica.

Images