Editing oligonucleotides

Abstract

The present invention relates to oligonucleotides for editing target nucleic acids, as well as conjugates, salts and pharmaceutical compositions thereof. The invention also relates to the use of such oligonucleotides, conjugates, salts and pharmaceutical compositions in methods for editing target nucleic acids and in medical applications and methods for treating disease.

Description

Technical Field

[0001] The present invention relates to oligonucleotides for editing target nucleic acids, and conjugates, salts and pharmaceutical compositions thereof. The present invention also relates to the use of such oligonucleotides, conjugates, salts and pharmaceutical compositions in methods for editing target nucleic acids and in medical applications and methods for treating diseases. Background Art

[0002] Nucleic acid editing holds promise for treating or preventing disease by altering or removing genetic sequences that produce dysfunctional gene products that cause disease phenotypes.

[0003] RNA sequences, especially protein-encoding mRNA sequences, can be edited using adenosine deaminase (ADAR) enzymes acting on RNA. ADAR binds to double-stranded RNA and deaminates adenine nucleobases to form hypoxanthine nucleobases, thereby converting adenosine (A) nucleosides into inosine (I) nucleosides. Inosine nucleosides are structurally similar to guanosine (G) and form complementary base pairs with cytidine (C). Therefore, inosine nucleosides are "read" as guanosine (G) nucleosides by the cell translation machinery. Therefore, adenosine to inosine editing of codons in mRNA sequences can change the amino acid sequence and thereby change the function of the protein encoded by the mRNA. ADAR can also be used to edit non-coding sequences. Three ADAR genes (ADAR1, ADAR2, and ADAR3) have been identified in mammals (Nishikura 2016Nat Rev Mol Cell Bio 1783-96).

[0004] ADAR can be recruited to single-stranded nucleic acids, such as mRNA, by guide oligonucleotides that form complementary base pairs with target nucleic acids, thereby forming double-stranded molecules that ADAR can bind to. Therefore, the sequence of the guide oligonucleotide determines the ADAR effect, that is, the site where ADAR can convert adenosine into inosine. Therefore, by introducing guide oligonucleotides of specific sequences into cells, endogenous ADARs can be guided to convert specific adenosine into inosine. In the context of treatment, the use of endogenous ADARs is advantageous to avoid ectopic expression of exogenous proteins (Merkle et al. 2019 Nat Biotech 37133-138; Qu et al. Nat Biotech 371059-1069).

[0005] Alpha-1 antitrypsin (A1AT) deficiency (A1AD) is a disease that can be treated using RNA editing technology. A1AD is associated with mutations in the SERPINA1 gene. SERPINA1 encodes A1AT, a serine protease inhibitor synthesized in the liver that is released to other tissues to protect them from endogenous inflammatory serine proteases (such as neutrophil elastase). Subjects suffering from A1AD express reduced levels of A1AT, which may lead to excessive decomposition of elastin in the lungs, and thereby reduce lung elasticity and related health problems, such as emphysema. Accumulation of misfolded A1AT in the liver may also lead to liver-related problems such as cirrhosis and jaundice. The most severe form of A1AD is associated with a single base pair substitution, resulting in E342 in A1AT mutating to K (E342K mutation). Less severe A1AD is associated with a single base pair substitution, resulting in E264 in A1AT mutating to V (E264V mutation). SERPINA1 mRNA in cultured cells has been targeted by RNA editing technology in an attempt to correct the E342K mutation (see WO 2021 / 071858A1 and WO 2021 / 243023A1). Summary of the invention

[0006] The present invention relates to oligonucleotides that provide ADAR-mediated editing of a target nucleic acid, such as RNA.The oligonucleotides of the invention comprise a mixed-mer structure.

[0007] The present invention provides an oligonucleotide comprising: an editing region containing an editing nucleoside, a 5' mixed polymer region located at the 5' position of the editing region, and a 3' mixed polymer region located at the 3' position of the editing region.

[0008] The invention also provides an oligonucleotide conjugate comprising an oligonucleotide of the invention covalently attached to at least one conjugate moiety.

[0009] The present invention also provides a pharmaceutical composition comprising the oligonucleotide or oligonucleotide conjugate of the present invention and a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.

[0010] The present invention also provides an in vitro and in vivo method for editing a target nucleic acid in a target cell, the method comprising administering to the target cell an effective amount of the oligonucleotide, oligonucleotide conjugate or pharmaceutical composition of the present invention.

[0011] The present invention also provides a method for treating or preventing a disease, the method comprising administering a therapeutically or prophylactically effective amount of an oligonucleotide, oligonucleotide conjugate or pharmaceutical composition of the present invention to a subject suffering from or susceptible to a disease. The present invention also provides an oligonucleotide, oligonucleotide conjugate or pharmaceutical composition of the present invention for use in treating or preventing a disease in a subject. The present invention also provides the use of an oligonucleotide, oligonucleotide conjugate or pharmaceutical composition of the present invention for preparing a medicament for treating or preventing a disease in a subject. In a preferred embodiment, the disease is A1AD. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 Shown is the degradation over time of oligonucleotides containing a mixed polymer region of alternating 2′-O-methyl-RNA and 2′-fluoro-RNA nucleosides (CMP ID NO 3_3 and 91_1) and an oligonucleotide containing a region of RNA nucleosides (CMP ID NO 91_2), wherein the oligonucleotides were incubated in fetal bovine serum (FBS), cerebrospinal fluid (CSF) or lysosomes isolated from rat liver (Rat Liver Trisomy - Trit.).

[0013] Figure 2 The editing efficiency of oligonucleotides containing mixed-mer or non-mixed-mer regions on GAPDH mRNA (A) and SERPINA1 mRNA (B) is shown.

[0014] Figure 3 Editing efficiency of oligonucleotides containing mixed-mer or non-mixed-mer regions of SERPINA1 mRNA (A and B) is shown.

[0015] Figure 4 The editing efficiency on SERPINA1 mRNA of an oligonucleotide containing a guanosine (G) nucleoside at position -1 (CMP ID NO 2_1) and an oligonucleotide containing an inosine (I) nucleoside at position -1 (CMP ID NO 3_1) was compared.

[0016] Figure 5 The editing efficiency on GAPDH mRNA of an oligonucleotide comprising a DNA cytidine (C) nucleoside at position 0 (CMP ID NO 91_3) and an oligonucleotide comprising a DNA nucleoside with a Benner base at position 0 (CMP ID NO 93_1) was compared.

[0017] Figure 6The editing efficiency on SERPINA1 mRNA is shown for oligonucleotides with different symmetries, in particular for oligonucleotides with different numbers of nucleosides at the 3′ position of the editing nucleoside (A and B) and at the 5′ position of the editing nucleoside (C). The influence of the symmetry of the inverted oligonucleotide was also tested (D).

[0018] Figure 7 Editing efficiency on SERPINA1 mRNA of oligonucleotides with different symmetries is shown.

[0019] Figure 8 Editing efficiency on GAPDH mRNA of oligonucleotides with different symmetries is shown (A and B).

[0020] Fig. 9 Editing efficiency on GAPDH mRNA of oligonucleotides with different symmetries is shown.

[0021] Fig.10 The editing efficiency on mHprt mRNA is shown for oligonucleotides with different symmetries, in particular for oligonucleotides with different numbers of nucleosides 3' to the editing nucleoside (A) and 5' to the editing nucleoside (B).

[0022] Fig.11 Editing efficiency on SERPINA1 mRNA of oligonucleotides with different modifications to the editing nucleoside is shown.

[0023] Fig.12 Editing efficiency on SERPINA1 mRNA of oligonucleotides with different modifications to the editing nucleoside is shown.

[0024] Fig.13 Editing efficiency on GAPDH mRNA for oligonucleotides with different nucleobase and sugar moiety modifications on the editing nucleoside is shown.

[0025] Fig.14 The editing efficiency on GAPDH mRNA of oligonucleotides with different nucleobase and sugar moiety modifications for editing nucleosides expressing exogenous human ADAR1 p110 is shown.

[0026] Fig.15 Shown are the editing efficiencies on GAPDH mRNA of oligonucleotides with different nucleobase and sugar moiety modifications for the edited nucleosides in HEK293 cells expressing exogenous human ADAR1 p150.

[0027] Fig.16 Shown are the editing efficiencies on GAPDH mRNA of oligonucleotides with different nucleobase and sugar moiety modifications for the edited nucleoside in HEK293 cells expressing exogenous human ADAR2.

[0028] Fig.17 Shown are the editing efficiencies on GAPDH mRNA of oligonucleotides with different nucleobase and sugar moiety modifications in the editing triplets in HEK293 cells expressing exogenous human ADAR2 (A) and exogenous human ADAR1 p110 (B).

[0029] Fig.18 Editing efficiencies on mHprt mRNA for oligonucleotides with different nucleobase modifications in the editing triplet are shown.

[0030] Fig.19 Editing efficiency on GAPDH mRNA of oligonucleotides containing different numbers of phosphorothioate (PS) internucleoside linkages is shown.

[0031] Fig. 20 Editing efficiency on GAPDH mRNA of oligonucleotides in cells expressing human ADAR2 (A) and human ADAR1 p11 0 (B) is shown, where all internucleoside bonds are phosphorothioate (PS) internucleoside bonds except for phosphodiester (PO) bonds at the indicated positions.

[0032] Fig.21 Editing efficiency on GAPDH mRNA of oligonucleotides in cells expressing human ADAR2 (A) and human ADAR1 p11 0 (B) is shown, where all internucleoside bonds are phosphorothioate (PS) internucleoside bonds except for phosphodiester (PO) bonds at the indicated positions.

[0033] Fig. 22 Editing efficiency on GAPDH mRNA in Huh7 cells is shown for oligonucleotides in which all internucleoside bonds are phosphorothioate (PS) internucleoside bonds except for phosphodiester (PO) bonds at the indicated positions.

[0034] Fig.23 Editing efficiency on mHprt mRNA is shown for oligonucleotides in which all internucleoside bonds are phosphorothioate (PS) internucleoside bonds except for phosphodiester (PO) bonds at the indicated positions.

[0035] Fig.24 Editing efficiency on SERPINA1 mRNA of oligonucleotides containing mixed-mer regions of 2′-fluoro RNA nucleosides and 2′-O-methyl RNA nucleosides in the first (A) or second (B) alternating pattern, with additional 2′-O-methyl RNA nucleosides at specific positions, is shown.

[0036] Fig.25Editing efficiency on SERPINA1 mRNA of oligonucleotides containing mixed-mer regions of 2′-fluoro RNA nucleosides and 2′-O-methyl RNA nucleosides in a first (A) or second (B) alternating pattern, with additional 2′-fluoro RNA nucleosides at specific positions, is shown.

[0037] Fig.26 Editing efficiency on GAPDH mRNA of oligonucleotides with or without MOE flanking regions in cells expressing human ADAR2 (A) or human ADAR1 p1 1 0 (B) and in HuH-7 cells (C) is shown.

[0038] Fig. 27 Editing efficiency on mHprt mRNA of the oligonucleotides and the corresponding oligonucleotide conjugates (CNJ ID NO 126_2_1) is shown.

[0039] Fig.28 The editing efficiency on mHprt mRNA by reverse stripping of oligonucleotides delivered to cells is shown.

[0040] Fig.29 The chemical structure of CMP ID NO 32_1 is shown. Due to the length of oligonucleotide CMP ID NO 32_1, Fig.29 It is divided across three pages to ensure that all atoms in the structure are clearly visible. Fig.29 The structure on page 1 (page 32 of the figure) is connected to the Fig.29 The structure on page 2 (page 33 of the figure). Fig.29 The ends of the split carbon-carbon bonds on page 1 of Fig.29 The ends of the split carbon-carbon bonds on page 2 of are indicated by "*2". Fig.29 The structure on page 2 is connected to Fig.29 The structure on page 3 (page 34 of the figure). Fig.29 The ends of the split carbon-carbon bonds are indicated by "*3" on page 2 of Fig.29 The ends of the split carbon-carbon bonds on page 3 of are indicated by "*4".

[0041] The chemical diagram of oligonucleotide herein illustrates the protonated form of oligonucleotide, and it should be understood that each hydrogen on the sulphur atom in the internucleoside bond of thiophosphate may exist or not exist independently.It should be understood that the presence of proton will depend on the acidity of the molecular environment.In salt form, one or more hydrogens in hydrogen may, for example, be replaced with a cation (such as a metal cation, such as a sodium cation or a potassium cation).Protonated thiophosphate exists in the form of tautomerism. DETAILED DESCRIPTION

[0042] Unless otherwise stated, all ranges are inclusive of the starting and ending values.

[0043] The present invention provides an oligonucleotide comprising: an editing region containing an editing nucleoside, a 5' mixed polymer region located at the 5' position of the editing region, and a 3' mixed polymer region located at the 3' position of the editing region.

[0044] The present invention also provides an oligonucleotide comprising an editing region, wherein the editing region comprises an editing nucleoside.

[0045] Oligonucleotides

[0046] As used herein, the term "oligonucleotide" is defined as a molecule comprising two or more covalently linked nucleosides as commonly understood by the skilled artisan. Such covalently linked nucleosides may also be referred to as nucleic acid molecules or oligomers.

[0047] Oligonucleotides are usually prepared in the laboratory by solid phase chemical synthesis followed by purification and separation. When referring to the sequence of an oligonucleotide, it is a reference to the sequence or order of the covalently linked nucleobase moieties of nucleotides or nucleosides or their modifications. Oligonucleotides of the present invention are artificial and chemically synthesized and are usually purified or separated.

[0048] Nucleotides and nucleosides

[0049] Nucleotides and nucleosides are the building blocks of oligonucleotides and polynucleotides, and for the purposes of the present invention, include naturally occurring and non-naturally occurring nucleotides and nucleosides. In essence, nucleotides (such as DNA and RNA nucleotides) comprise a ribose moiety, a core base moiety, and one or more phosphate groups. One or more phosphate groups are not present in nucleosides. Nucleosides and nucleotides are also interchangeably referred to as "units" or "monomers." When referring to these units in the context of oligonucleotides of the present invention, the terms "nucleosides" and "nucleotides" are used interchangeably herein.

[0050] The nucleosides of the oligonucleotides of the present invention can be referred to by their positions in the oligonucleotide relative to the editing nucleosides. Therefore, in some embodiments of the oligonucleotides of the present invention, the editing nucleoside is designated as position 0, each nucleoside at the 5′ of the editing nucleoside is designated as position + x, wherein x is the number of nucleosides at the 5′ of the editing nucleoside at that position, including the nucleosides at that position, and each nucleoside at the 3′ of the editing nucleoside is designated as position -y, wherein y is the number of nucleosides at the 3′ of the editing nucleoside at that position, including the nucleosides at that position. For example, the nucleosides of the two nucleosides at the 5′ of the editing nucleoside will be position +2, and the nucleosides of the three nucleosides at the 3′ of the editing nucleoside will be position -3. As a further example, SEQ ID NO 32 is shown below, wherein the editing region is underlined and the editing nucleosides are shown in bold:

[0051] The editing nucleoside C is at position 0. The editing region's T is at position +1, the C immediately 5' to it is at position +2, and so on. The editing region's I is at position -1, the U immediately 3' to it is at position -2, and so on.

[0052] In some embodiments, the oligonucleotides of the present invention comprise inosine nucleosides (i.e., nucleosides comprising the nucleobase inosine). In some embodiments, the oligonucleotides of the present invention comprise one or more abasic nucleosides (i.e., nucleosides without nucleobases). In some embodiments, the oligonucleotides of the present invention comprise one or more TNA nucleosides. In some embodiments, the oligonucleotides of the present invention comprise one or more SNA nucleosides. In some embodiments, the oligonucleotides of the present invention comprise one or more iDNA nucleosides. In some embodiments, the oligonucleotides of the present invention comprise one or more ScEt nucleosides. Examples of such nucleosides are described below:

[0053]

[0054] Nucleobase

[0055] The term nucleobase includes purines (e.g., adenine and guanine) and pyrimidines (e.g., uracil, thymine, and cytosine) present in nucleosides and nucleotides, which form hydrogen bonds in nucleic acid hybridization. In the context of the present invention, the term nucleobase also encompasses modified nucleobases that are different from naturally occurring nucleobases but functional during nucleic acid hybridization. In this context, "nucleobase" refers to naturally occurring nucleobases such as adenine, guanine, cytosine, thymidine, uracil, xanthine, and hypoxanthine, as well as non-naturally occurring variants. Such variants are described, for example, in Hirao et al., 2012, Accounts of Chemical Research, 45, 2055-2065 and Bergstrom, 2009, Curr. Protoc. Nucleic Acid Chem., 37, 1.4.1-1.4.32.

[0056] In some embodiments, the nucleobase moiety is modified by changing a purine or pyrimidine to a modified purine or pyrimidine, such as a substituted purine or substituted pyrimidine, such as a nucleobase selected from isocytosine, pseudoisocytosine, 5-methylcytosine, 5-thiazolo-cytosine, 5-propynyl-cytosine, 7-deaza-8-azaguanine, 5-propynyl-uracil, 5-bromouracil, 5-thiazolo-uracil, 2-thio-uracil, 2′thio-thymine, inosine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6-diaminopurine, and 2-chloro-6-aminopurine.

[0057] The structures of modified nucleobases that may be included in the oligonucleotides of the present invention as well as hypoxanthine are shown below:

[0058]

[0059] The nucleobase moiety may be represented by a letter code for each corresponding nucleobase, such as A, T, G, C, or U, wherein each letter may optionally include a functionally equivalent modified nucleobase. 5-methylcytosine may be represented as "E". 7-deaza-8-azaguanine may be represented as "F". Hypoxanthine (such as in inosine nucleoside) may be represented as "I".

[0060] Editing target nucleic acid

[0061] The oligonucleotides of the present invention are suitable for editing target nucleic acids. The oligonucleotides of the present invention are capable of editing target nucleic acids. The term "editing" refers to changing the nucleobase sequence of a target nucleic acid. The oligonucleotides of the present invention may be referred to as "editing oligonucleotides". The target nucleic acid is the nucleic acid to be edited.

[0062] The target nucleic acid comprises a target adenosine. The term "target adenosine" refers to an adenosine nucleoside of a target nucleic acid, which is converted to an inosine nucleoside by deamination of an adenine nucleobase to form a hypoxanthine nucleobase. Thus, the oligonucleotides of the present invention are capable of achieving conversion of a target adenosine (A) to inosine (I).

[0063] In some embodiments, the target nucleic acid is RNA. In some embodiments, the target nucleic acid encodes a protein. In some embodiments, the target nucleic acid is mRNA. In some embodiments, the target nucleic acid is non-coding RNA.

[0064] ADAR

[0065] The oligonucleotide of the present invention is a guide oligonucleotide for adenosine deaminase (ADAR) acting on RNA. Therefore, the oligonucleotide of the present invention can be referred to as a "guide oligonucleotide" or an "editing guide oligonucleotide".

[0066] ADAR is an enzyme that binds to double-stranded RNA and deaminates adenine nucleobase to form hypoxanthine nucleobase, thereby converting adenosine (A) nucleoside into inosine (I) nucleoside. Three ADAR genes (ADAR1, ADAR2 and ADAR3) have been identified in mammals. ADAR1 and ADAR2 are expressed in many tissues, but ADAR3 is specifically expressed in the brain and may not have catalytic activity. In some embodiments, the oligonucleotide of the present invention is ADAR1 or ADAR2 as the ADAR of the guide oligonucleotide. In some embodiments, ADAR is endogenous human ADAR1 or ADAR2. The reference sequences for human ADAR1 and ADAR2 in UniProtKB and NCBI databases are given in Table 1 below.

[0067] Table 1 - Human ADAR1 and ADAR2 reference sequences

[0068]

[0069] The term "guide oligonucleotide" means that the oligonucleotide of the present invention is capable of guiding ADAR to the target nucleic acid and to a specific target adenosine on the target nucleic acid, so that ADAR removes adenine from the target adenosine. The oligonucleotide achieves this by hybridizing with the target nucleic acid in the target adenosine region to form a double-stranded molecule. Therefore, the oligonucleotide of the present invention is capable of binding to the target nucleic acid through complementary base pairing. ADAR can be associated with the extension of double-stranded nucleic acid. Therefore, the oligonucleotide of the present invention is capable of recruiting ADAR to the target nucleic acid. Therefore, the specific sequence of the oligonucleotide determines which adenosine the deamination activity of the ADAR is directed to, because the sequence of the oligonucleotide determines which target nucleic acid the oligonucleotide can hybridize with.

[0070] Edit SERPINA1

[0071] In some embodiments of the invention, the target nucleic acid encodes alpha-1 antitrypsin (A1AT). In other words, in some embodiments, the oligonucleotides of the invention are used to edit a target nucleic acid encoding A1AT.

[0072] A1AT is a serine protease inhibitor synthesized in the liver, which is released into other tissues to protect them from endogenous inflammatory serine proteases (such as neutrophil elastase). A1AT is encoded by the SERPINA1 (serine protease inhibitor family A member 1) gene. Therefore, in some embodiments, the target nucleic acid is SERPINA1mRNA. In other words, in some embodiments, the oligonucleotides of the present invention are used to edit SERPINA1 mRNA. The term "SERPINA1 mRNA" refers to any mRNA transcribed from the SERPINA1 gene. The UnitProtKB entry of A1AT is P01009, and the reference sequence number of the SERPINA1 gene in the NCBI database is NG_008290.1. The reference sequence numbers of eleven known mRNA transcript variants from the SERPINA1 gene are shown in Table 2 below.

[0073] Table 2 - SERPINA1 mRNA reference sequences

[0074]

[0075]

[0076] In some embodiments, the SERPINA1 mRNA comprises or consists of the sequence of any one of the mRNA transcripts listed in Table 2.

[0077] Mutations in the SERPINA1 gene are associated with a disease called A1AT deficiency (A1AD). The most severe form of A1AD is associated with a single base pair substitution resulting in a mutation of glutamic acid (E) 342 to lysine (K) in A1AT (E342K mutation).

[0078] As described herein, the oligonucleotides of the present invention can be used to treat A1AD by editing the SERPINA1 mRNA of mutation. In particular, the mutant codons encoding E342K mutation can be edited to treat A1AD. Glutamic acid (E) is encoded by codons GAA and GAG. Lysine (K) is encoded by codons AAA and AAG. In some embodiments, the oligonucleotides of the present invention can achieve the conversion of the AAA codons encoding lysine on the target nucleic acid to the IAA codons encoding glutamate. In such embodiments, the oligonucleotides of the present invention raise ADARs, which convert the first adenosine (target adenosine) of the AAA codon (encoding lysine) into inosine, producing an IAA codon read as GAA (encoding glutamate), thereby correcting the mutation of glutamate to lysine. In some embodiments, the oligonucleotides of the present invention can achieve the conversion of the AAG codons encoding lysine on the target nucleic acid to the IAG codons encoding glutamate. In such embodiments, the oligonucleotides of the invention recruit ADARs, which convert the first adenosine (target adenosine) of an AAG codon (encoding lysine) to inosine, generating an IAG codon that is read as GAG (encoding glutamate), thereby correcting the glutamate to lysine mutation.

[0079] In some embodiments, the SERPINA1 mRNA comprises or consists of the sequence of any one of the mRNA transcripts listed in Table 2, and the GAG ​​codon is mutated to AAG. In some embodiments, the SERPINA1 mRNA comprises or consists of the sequence of any one of the mRNA transcripts listed in Table 2, and the GAG ​​codon encoding E342 in the A1AT protein is mutated to AAG.

[0080] The coding sequence from SERPINA1 mRNA transcript variant 11 (NM_001127707.2) comprising the E342K mutation is presented below as SEQ ID NO 186. The codon for K342 is AAG (underlined in the sequence below), and the first adenosine in the AAG codon is A1024 (shown in bold below).

[0081] SERPINA1 mRNA E342K mutant coding sequence - SEQ ID NO 186:

[0082]

[0083] In some embodiments, the target adenosine corresponds to A1024 of SEQ ID NO 186. The term "corresponding to" means that the target adenosine need not be the 1024th nucleoside of the target nucleic acid and the sequence of the target nucleic acid is not otherwise limited to SEQ ID NO 186 but must be the first nucleoside in the AAG codon encoding K342 within the coding sequence for A1AT, such as A1024. Thus, in some embodiments, the target adenosine is the first nucleoside in the AAG codon encoding K342 in the coding sequence for A1AT.

[0084] In some embodiments, the target nucleic acid comprises a sequence having at least 80% identity to SEQ ID NO 186, such as at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity to SEQ ID NO 186, wherein the target nucleic acid comprises A1024 of SEQ ID NO 186. In some embodiments, the target nucleic acid comprises a sequence according to SEQ ID NO: 186. In some embodiments, the target nucleic acid consists of a sequence having at least 80% identity to SEQ ID NO 186, such as at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity to SEQ ID NO 186, wherein the target nucleic acid comprises A1024 of SEQ ID NO 186. In some embodiments, the target nucleic acid consists of the sequence according to SEQ ID NO 186.

[0085] Editing nucleotides and editing regions

[0086] The term "editing nucleoside" refers to the nucleoside opposite to the target adenosine in the oligonucleotide of the present invention when the oligonucleotide of the present invention is hybridized with the target nucleic acid. In other words, the oligonucleotide of the present invention forms a double-stranded molecule with the target nucleic acid by complementary base pairing between the nucleoside of the oligonucleotide and the target nucleic acid, wherein the sequence alignment of the oligonucleotide and the target nucleic acid aligns the editing nucleoside with the target adenosine. The editing nucleoside is not complementary to the target adenosine. In other words, the editing nucleoside forms a mismatch with the target adenosine. In some embodiments, the nucleobase of the editing nucleoside is selected from the group consisting of cytosine, 5-methylcytosine, guanine and hypoxanthine. In some embodiments, the editing nucleoside is cytidine (C). In some embodiments, the nucleobase of the editing nucleoside is cytosine (C) or 5-methylcytosine (m5C). In some embodiments, the nucleobase of the editing nucleoside is 5-methylcytosine (m5C). In some embodiments, the editing nucleoside is guanosine (G). In some embodiments, the editing nucleoside is inosine (I).

[0087] The term "editing region" refers to one or more consecutive nucleosides (i.e., nucleosides connected by internucleoside bonds) comprising an editing nucleoside. The editing region can be defined so as to distinguish the nucleosides of the editing region from the nucleosides of other regions of the oligonucleotide of the present invention (such as the mixed polymer region and the flanking region). The nucleosides of the editing region can have common features as described herein.

[0088] In some embodiments, the editing region consists of editing nucleosides. In other words, the editing region has no other nucleosides except the editing nucleosides; in such embodiments, the editing nucleosides and the editing region are synonymous.

[0089] In some embodiments, the editing region comprises nucleosides at positions +1, 0, and -1. In some embodiments, the editing region consists of nucleosides at positions +1, 0, and -1. In some embodiments, the editing region comprises an editing triplet consisting of 3 nucleosides, wherein the editing nucleoside is the central nucleoside of the editing triplet. In some embodiments, the editing region consists of an editing triplet, which consists of 3 nucleosides, wherein the editing nucleoside is the central nucleoside of the editing triplet. In some embodiments, the editing triplet is 5′-thymidine-cytidine-inosine-3′ (TCI). Therefore, in such embodiments, the center C is the editing nucleoside, the T nucleoside is adjacent to 5′ and the inosine nucleoside is adjacent to 3′.

[0090] In some embodiments of the oligonucleotides of the present invention, each nucleoside in the editing region comprises the same sugar moiety. In some embodiments, each nucleoside in the editing region is independently selected from the group consisting of DNA, RNA, 2'-O-methyl-RNA, 2'-fluoro-RNA, MOE-RNA, LNA, ANA and FANA nucleosides. The different types of sugar moieties that may be included in the oligonucleotides of the present invention are described elsewhere herein.

[0091] In some embodiments, the editing region comprises one or more DNA nucleosides. In some embodiments, the editing nucleosides are DNA nucleosides. In some embodiments, all nucleosides in the editing region are DNA nucleosides. In some embodiments, the nucleosides at one or more of positions +1, 0 and -1 (such as two or more of positions +1, 0 and -1) are DNA nucleosides. In some embodiments, the nucleosides at position +1 are DNA nucleosides. In some embodiments, the nucleosides at position 0 are DNA nucleosides. In some embodiments, the nucleosides at position -1 are DNA nucleosides. In some embodiments, the nucleosides at each of positions +1, 0 and -1 are DNA nucleosides. In some embodiments, the editing region consists of nucleosides at positions +1, 0 and -1 of an oligonucleotide, wherein the nucleosides at position +1 are thymidine DNA nucleosides, the nucleosides at position 0 are cytidine DNA nucleosides, and the nucleosides at position -1 are inosine DNA nucleosides.

[0092] In some embodiments, the editing nucleoside is a FANA nucleoside. In some embodiments, the nucleoside at position 0 is a FANA nucleoside. In some embodiments, the editing nucleoside is a FANA nucleoside and all other nucleosides in the editing region are DNA nucleosides. In some embodiments, the nucleoside at position 0 is a FANA nucleoside, and (a) the nucleoside at position +1 is a DNA nucleoside, or (b) the nucleoside at position -1 is a DNA nucleoside, or (c) the nucleoside at each of position +1 and -1 is a DNA nucleoside. In some embodiments, the editing region is composed of nucleosides at positions +1, 0 and -1 of an oligonucleotide, wherein the nucleoside at position +1 is a thymidine DNA nucleoside, the nucleoside at position 0 is a cytidine FANA nucleoside, and the nucleoside at position -1 is an inosine DNA nucleoside.

[0093] In some embodiments, the editing region comprises one or more nucleosides comprising a sugar moiety different from the first type of 5' mixed-mer nucleosides. In some embodiments, the editing region comprises one or more nucleosides comprising a sugar moiety different from the second type of 5' mixed-mer nucleosides. In some embodiments, the editing region comprises one or more nucleosides comprising a sugar moiety different from the first type of 5' mixed-mer nucleosides and from the second type of 5' mixed-mer nucleosides. In some embodiments, the editing region comprises one or more nucleosides comprising a sugar moiety different from the first type of 3' mixed-mer nucleosides. In some embodiments, the editing region comprises one or more nucleosides comprising a sugar moiety different from the second type of 3' mixed-mer nucleosides. In some embodiments, the editing region comprises one or more nucleosides comprising a sugar moiety different from the first type of 3' mixed-mer nucleosides and from the second type of 3' mixed-mer nucleosides.

[0094] In some embodiments, the editing region comprises one or more nucleosides comprising a sugar moiety that is different from the sugar moiety of the first type of 5' mixed-mer nucleoside, the second type of 5' mixed-mer nucleoside, the first type of 3' mixed-mer nucleoside, and the second type of 3' mixed-mer nucleoside.

[0095] In some embodiments, each nucleoside of the editing region comprises a sugar moiety that is different from the first type of 5' mixed-mer nucleosides. In some embodiments, each nucleoside of the editing region comprises a sugar moiety that is different from the second type of 5' mixed-mer nucleosides. In some embodiments, each nucleoside of the editing region comprises a sugar moiety that is different from the first type of 3' mixed-mer nucleosides. In some embodiments, each nucleoside of the editing region comprises a sugar moiety that is different from the second type of 3' mixed-mer nucleosides. In some embodiments, each nucleoside of the editing region comprises a sugar moiety that is different from the sugar moiety of the first type of 5' mixed-mer nucleosides, the second type of 5' mixed-mer nucleosides, the first type of 3' mixed-mer nucleosides, and the second type of 3' mixed-mer nucleosides.

[0096] Mixed polymer region

[0097] The oligonucleotides of the invention comprise one or more mixed-mer regions.The oligonucleotides of the invention comprise a 5' mixed-mer region located 5' to the editing region and a 3' mixed-mer region located 3' to the editing region.

[0098] The term "mixed polymer region" refers to two or more consecutive nucleosides (i.e., nucleosides connected by internucleoside bonds) that contain more than one type of sugar moiety. In other words, the mixed polymer region contains nucleosides with different types of sugar modifications. Nucleosides with different types of sugar moieties or sugar modifications may be referred to herein as "nucleosides of different types" or "nucleosides of different types of sugar modifications."

[0099] In some embodiments, the oligonucleotide comprises a mixed polymer region. In some embodiments, the oligonucleotide is a mixed polymer. In some embodiments, the oligonucleotide comprises a mixed polymer region that is divided into two parts by an editing region. In other words, the mixed polymer region includes an editing region. In some embodiments, the editing region divides the mixed polymer region into a 5' mixed polymer region and a 3' mixed polymer region.

[0100] In some embodiments, the 5' mixed-mer region is positioned immediately 5' to the editing region. In other words, there are no additional nucleosides between the 3'-most nucleoside of the 5' mixed-mer region and the 5'-most nucleoside of the editing region; the 3'-most nucleoside of the 5' mixed-mer region and the 5'-most nucleoside of the editing region are linked by an internucleoside bond. In some embodiments, the 3' mixed-mer region is positioned immediately 3' to the editing region. In other words, there are no additional nucleosides between the 5'-most nucleoside of the 3' mixed-mer region and the 3'-most nucleoside of the editing region; the 5'-most nucleoside of the 3' mixed-mer region and the 3'-most nucleoside of the editing region are linked by an internucleoside bond. In some embodiments, the 5' mixed-mer region is positioned immediately 5' to the editing region and the 3' mixed-mer region is positioned immediately 3' to the editing region.

[0101] In some embodiments, the oligonucleotide comprises the following structure:

[0102] X +1 -X 0 -X -1

[0103] in

[0104] X +1 is the 5′ mixed polymer region,

[0105] X 0 is the editing area, and

[0106] X -1 It is the 3′ mixed polymer region.

[0107] Thus, according to the above formula, the 5' mixed-mer region, the editing region and the 3' mixed-mer region are contiguous (ie, connected by an internucleoside bond). The hyphen in the above formula represents an internucleoside bond.

[0108] The mixed polymer region comprises more than one type of sugar-modified nucleosides. The 5′ mixed polymer region comprises more than one type of sugar-modified nucleosides. The 3′ mixed polymer region comprises more than one type of sugar-modified nucleosides. In some embodiments, the mixed polymer region comprises more than one type of sugar-modified nucleosides. In some embodiments, the 5′ mixed polymer region comprises exactly two types of sugar-modified nucleosides. In some embodiments, the 3′ mixed polymer region comprises exactly two types of sugar-modified nucleosides.

[0109] In some embodiments, the mixed polymer region comprises a first type of mixed polymer nucleoside and a second type of mixed polymer nucleoside, wherein the sugar moiety of the first type of mixed polymer nucleoside is different from the sugar moiety of the second type of mixed polymer nucleoside. In other words, the first type of mixed polymer nucleoside and the second type of mixed polymer nucleoside are distinguished by the type of sugar moiety they contain.

[0110] In some embodiments, the 5' mixed-mer region comprises a first type of 5' mixed-mer nucleosides and a second type of 5' mixed-mer nucleosides, wherein the sugar moiety of the first type of 5' mixed-mer nucleosides is different from the sugar moiety of the second type of 5' mixed-mer nucleosides. In other words, the first type of 5' mixed-mer nucleosides and the second type of 5' mixed-mer nucleosides are distinguished by the type of sugar moieties they comprise.

[0111] In some embodiments, the 3' mixed-mer region comprises a first type of 3' mixed-mer nucleosides and a second type of 3' mixed-mer nucleosides, wherein the sugar moiety of the first type of 3' mixed-mer nucleosides is different from the sugar moiety of the second type of 3' mixed-mer nucleosides. In other words, the first type of 3' mixed-mer nucleosides and the second type of 3' mixed-mer nucleosides are distinguished by the type of sugar moieties they comprise.

[0112] Suitable sugar moieties (ie, different types of sugar-modified nucleosides or sugar modifications) are described elsewhere herein.

[0113] In some embodiments, the mixed polymer region comprises a first type of mixed polymer nucleoside and a second type of mixed polymer nucleoside. In some embodiments, the first type of mixed polymer nucleoside is a 2'-O-methyl-RNA nucleoside and the second type of mixed polymer nucleoside is a 2'-fluoro-RNA nucleoside. In some embodiments, the first type of mixed polymer nucleoside is a 2'-fluoro-RNA nucleoside and the second type of mixed polymer nucleoside is a 2'-O-methyl-RNA nucleoside.

[0114] It is worth noting that other features of a given nucleoside of the first type of mixed polymer nucleoside (e.g., nucleobase) may be different from those of a given nucleoside of the second type, but it is the different sugar moieties that determine which type of mixed polymer nucleoside the nucleoside belongs to. For example, two nucleosides may have different nucleobases, but become the same type of mixed polymer nucleoside due to having the same type of sugar moiety; conversely, two nucleosides may have the same nucleobase, but become different types of mixed polymer nucleosides due to their different sugar moieties.

[0115] In some embodiments, the first type of 5' mixed polymer nucleosides and the first type of 3' mixed polymer nucleosides are the same type of sugar-modified nucleosides (i.e., they have the same sugar moiety). In some embodiments, the first type of 5' mixed polymer nucleosides and the first type of 3' mixed polymer nucleosides are the same type of sugar-modified nucleosides and are collectively referred to as "first type of mixed polymer nucleosides". In some embodiments, the second type of 5' mixed polymer nucleosides and the second type of 3' mixed polymer nucleosides are the same type of sugar-modified nucleosides (i.e., they have the same sugar moiety). In some embodiments, the second type of 5' mixed polymer nucleosides and the second type of 3' mixed polymer nucleosides are the same type of sugar-modified nucleosides and are collectively referred to as "second type of mixed polymer nucleosides".

[0116] In some embodiments, the first type of 5' mixed polymer nucleosides and the second type of 5' mixed polymer nucleosides are arranged in an alternating pattern within the 5' mixed polymer region. In other words, a stretch of nucleosides of the first type of 5' mixed polymer nucleosides is followed by a stretch of nucleosides of the second type of 5' mixed polymer nucleosides, which in turn is followed by a stretch of nucleosides of the first type of 5' mixed polymer nucleosides, and so on. In other words, in some embodiments, the 5' mixed polymer region comprises an alternating pattern of 5' mixed polymer nucleosides of the first type and 5' mixed polymer nucleosides of the second type.

[0117] Likewise, in some embodiments, the first type of 3' mixed polymer nucleosides and the second type of 3' mixed polymer nucleosides are arranged in an alternating pattern within the 3' mixed polymer region. In other words, a stretch of nucleosides of the first type of 3' mixed polymer nucleosides is followed by a stretch of nucleosides of the second type of 3' mixed polymer nucleosides, which in turn is followed by a stretch of nucleosides of the first type of 3' mixed polymer nucleosides, and so on. In other words, in some embodiments, the 3' mixed polymer region comprises an alternating pattern of 3' mixed polymer nucleosides of the first type and 3' mixed polymer nucleosides of the second type.

[0118] In each section of the nucleoside of the mixed polymer nucleoside of the first type or the second type, there can be 1 to about 4 nucleosides. In some embodiments, the number of nucleosides in each section of the nucleoside of a given type varies independently. Therefore, in some embodiments, the number of nucleosides in each section varies between nucleoside types (for example, in each section of the first type, there can be a certain number of nucleosides of the first type of nucleosides, and in each section of the second type, there can be a different number of nucleosides of the second type of nucleosides). In some embodiments, the number of nucleosides varies between nucleoside sections of the same type (for example, in a given nucleoside section of the first type, there can be a certain number of nucleosides, but in different nucleoside sections of the first type, there can be a different number of nucleosides).

[0119] In some embodiments, each section of nucleosides of the same type comprises the same number of nucleosides. For example, all sections of nucleosides of the first type can be 2 nucleosides long, and all sections of nucleosides of the second type can be 1 nucleoside long. In some embodiments, each section of nucleosides comprises the same number of nucleosides. For example, all sections of nucleosides of the first and second types can be 2 nucleosides long.

[0120] In some embodiments, each segment of the first type or the second type of nucleoside is a single nucleoside. In other words, in some embodiments, the 5' mixed polymer region comprises a single nucleoside (i.e., 1 nucleoside) of a 5' mixed polymer oligonucleoside of the first type, followed by a single nucleoside of a 5' mixed polymer oligonucleoside of the second type, followed by a single nucleoside of a 5' mixed polymer oligonucleoside of the first type, and so on. In some embodiments, the 5' mixed polymer nucleosides of the first type and the 5' mixed polymer nucleosides of the second type are arranged in an alternating pattern of single nucleosides. In other words, in some embodiments, the 5' mixed polymer region comprises an alternating pattern of single nucleosides of a 5' mixed polymer nucleoside of the first type and a single nucleoside of a 5' mixed polymer nucleoside of the second type.

[0121] Likewise, in some embodiments, the 3' mixed polymer region comprises a single nucleoside (i.e., 1 nucleoside) of a first type of 3' mixed polymer oligonucleoside, followed by a single nucleoside of a second type of 3' mixed polymer oligonucleoside, followed by a single nucleoside of a first type of 3' mixed polymer oligonucleoside, and so on. In some embodiments, the first type of 3' mixed polymer nucleosides and the second type of 3' mixed polymer nucleosides are arranged in an alternating pattern of single nucleosides. In other words, in some embodiments, the 3' mixed polymer region comprises an alternating pattern of single nucleosides of a first type of 3' mixed polymer nucleosides and single nucleosides of a second type of 3' mixed polymer nucleosides.

[0122] In some embodiments, the 5' mixed-mer region comprises

[0123] (a) one or more first 5' mixed-mer sub-regions of one or more nucleosides of a first type of 5' mixed-mer nucleosides, and

[0124] (b) one or more second 5' mixed-mer sub-regions of one or more nucleosides of a second type of 5' mixed-mer nucleosides,

[0125] The first 5' mixed polymer sub-region and the second 5' mixed polymer sub-region are arranged in an alternating pattern. In other words, the first 5' mixed polymer sub-region is followed by the second 5' mixed polymer sub-region, and the second 5' mixed polymer sub-region may be followed by another first 5' mixed polymer sub-region, which is followed by the second 5' mixed polymer sub-region, and so on.

[0126] In some embodiments, the 5' mixed-mer region comprises

[0127] (a) one or more first 5' mixed-mer sub-regions of 1, 2, 3 or 4 nucleosides of a first type of 5' mixed-mer nucleosides, and

[0128] (b) one or more second 5' mixed mer sub-regions of 1, 2, 3 or 4 nucleosides of a second type of 5' mixed mer nucleosides,

[0129] The first 5' mixed polymer sub-region and the second 5' mixed polymer sub-region are arranged in an alternating pattern.

[0130] In some embodiments, the 5' mixed-mer region comprises

[0131] (a) one or more first 5′ of a nucleoside of a first type of 5′ mixed polymer nucleoside

[0132] mixed polymer sub-regions, and

[0133] (b) one or more second 5′ of a nucleoside of a second type of 5′ mixed polymer nucleoside

[0134] A mixed mer sub-region, wherein the first 5' mixed mer sub-region and the second 5' mixed mer sub-region are arranged in an alternating pattern.

[0135] Likewise, in some embodiments, the 3' mixed-mer region comprises

[0136] (a) one or more first 3' mixed-mer sub-regions of one or more nucleosides of a first type of 3' mixed-mer nucleosides, and

[0137] (b) one or more second 3' mixed-mer sub-regions of one or more nucleosides of a second type of 3' mixed-mer nucleosides,

[0138] The first 3' mixed polymer sub-region and the second 3' mixed polymer sub-region are arranged in an alternating pattern. In other words, the first 3' mixed polymer sub-region is followed by the second 3' mixed polymer sub-region, and the second 3' mixed polymer sub-region can be followed by another first 3' mixed polymer sub-region, which is followed by the second 3' mixed polymer sub-region, and so on.

[0139] In some embodiments, the 3' mixed-mer region comprises

[0140] (a) one or more first 3' mixed-mer sub-regions of 1, 2, 3 or 4 nucleosides of a first type of 3' mixed-mer nucleosides, and

[0141] (b) one or more second 3' mixed-mer sub-regions of 1, 2, 3 or 4 nucleosides of a second type of 3' mixed-mer nucleosides,

[0142] The first 3' mixed polymer sub-regions and the second 3' mixed polymer sub-regions are arranged in an alternating pattern.

[0143] In some embodiments, the 3' mixed-mer region comprises

[0144] (a) one or more first 3′ of a nucleoside of a first type of 3′ mixed polymer nucleoside

[0145] mixed polymer sub-regions, and

[0146] (b) one or more second 3′ of a nucleoside of a second type of 3′ mixed polymer nucleoside

[0147] Mixed polymer sub-regions, wherein the first 3' mixed polymer sub-region and the second 3' mixed polymer sub-region are arranged in an alternating pattern.

[0148] In some embodiments, the 5' mixed-mer region includes one or more sub-regions of one or more nucleosides of a first type of 5' mixed-mer nucleosides, wherein each sub-region is separated by one or more nucleosides of a second type of 5' mixed-mer nucleosides. In some embodiments, the 3' mixed-mer region includes one or more sub-regions of one or more nucleosides of a first type of 3' mixed-mer nucleosides, wherein each sub-region is separated by one or more nucleosides of a second type of 3' mixed-mer nucleosides.

[0149] In some embodiments, the 5' mixed-mer region includes one or more sub-regions of 1, 2, 3 or 4 nucleosides of a first type of 5' mixed-mer nucleosides, wherein each sub-region is separated by 1, 2, 3 or 4 nucleosides of a second type of 5' mixed-mer nucleosides. In some embodiments, the 3' mixed-mer region includes one or more sub-regions of 1, 2, 3 or 4 nucleosides of a first type of 3' mixed-mer nucleosides, wherein each sub-region is separated by 1, 2, 3 or 4 nucleosides of a second type of 3' mixed-mer nucleosides.

[0150] In some embodiments, the 5' mixed-mer region includes one or more sub-regions of 1 nucleoside of a first type of 5' mixed-mer nucleoside, wherein each sub-region is separated by 1 nucleoside of a second type of 5' mixed-mer nucleoside. In some embodiments, the 3' mixed-mer region includes one or more sub-regions of 1 nucleoside of a first type of 3' mixed-mer nucleoside, wherein each sub-region is separated by 1 nucleoside of a second type of 3' mixed-mer nucleoside.

[0151] The structure of the mixed polymer region can be represented by the formula. Therefore, in some embodiments, the 5' mixed polymer region comprises the following structure:

[0152] (Y 5 -Z 5 -) m

[0153] in

[0154] Y 5 is one or more nucleosides of a first type of 5' mixed polymer nucleoside,

[0155] Z 5 is one or more nucleosides of a second type of 5' mixed polymer nucleoside, and

[0156] m is a number from 1 to 20.

[0157] In some embodiments, the 3' mixed-mer region comprises the following structure:

[0158] (Y 3 -Z 3 -) n

[0159] in

[0160] Y 3 is one or more nucleosides of a first type of 3' mixed polymer nucleoside,

[0161] Z 3 is one or more nucleosides of a second type of 3' mixed polymer nucleoside, and

[0162] n is a number from 1 to 20.

[0163] The nucleosides in each mixed polymer region are consecutive (i.e., connected by internucleoside bonds). The hyphens in the above formula represent internucleoside bonds. In some embodiments, each Y 5 is independently 1, 2, 3 or 4 nucleosides. 5 is independently 1 nucleoside. In some embodiments, each Z 5 is independently 1, 2, 3 or 4 nucleosides. 5 is independently 1 nucleoside. In some embodiments, each Y 3 is independently 1, 2, 3 or 4 nucleosides. 3 is independently 1 nucleoside. In some embodiments, each Z 3 is independently 1, 2, 3 or 4 nucleosides. 3 Each of the following is independently a nucleoside.

[0164] In some embodiments, each Y 5 Each Z is independently a nucleoside. 5 is independently 1 nucleoside, each Y 3 is independently 1 nucleoside, and each Z 3 Each of the following is independently a nucleoside.

[0165] In some embodiments, m is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20. In some embodiments, m is 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15. In some embodiments, m is 9.

[0166] In some embodiments, n is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20. In some embodiments, n is 3, 4, 5, 6, 7, 8, or 9. In some embodiments, n is 5.

[0167] In other words, the 5′ mixed-mer region can be represented as ∶

[0168] Y 5 -Z 5 -Y 5 -Z 5 -Y 5 -Z 5 -Y 5 -Z 5 -Y 5 -Z 5 -Y 5 -Z 5 …

[0169] Each Y 5 is a stretch of nucleosides of the first type of 5′ mixed polymer nucleosides, and each Z 5 is a stretch of nucleosides of the second type of 5' mixed polymer nucleosides. The nucleoside stretches are connected by internucleoside bonds and thus form a continuous 5' mixed polymer region. Each Y 5 The nucleoside stretch is independently 1, 2, 3 or 4 nucleosides. 5 The nucleoside stretch is independently 1, 2, 3 or 4 nucleosides. 5 and Z 5 There are a maximum of 20 pairs.

[0170] Similarly, the 3′ mixed-mer region can be represented as:

[0171] Y 3 -Z 3 -Y 3 -Z3 -Y 3 -Z 3 -Y 3 -Z 3 -Y 3 -Z 3 -Y 3 -Z 3 …

[0172] Each Y 3 is a stretch of nucleosides of the first type of 3′ mixed polymer nucleosides, and each Z 3 is a stretch of nucleosides of the second type of 3' mixed polymer nucleosides. The nucleoside stretches are connected by internucleoside bonds and thus form a continuous 3' mixed polymer region. Each Y 3 The nucleoside stretch is independently 1, 2, 3 or 4 nucleosides. 3 The nucleoside stretch is independently 1, 2, 3 or 4 nucleosides. 3 and Z 3 There are a maximum of 20 pairs.

[0173] Length of mixed polymer region

[0174] In some embodiments of the oligonucleotide, the 5' mixed-mer region is 15 to 25 nucleosides long. In some embodiments, the 5' mixed-mer region is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleosides long. In some embodiments, the 5' mixed-mer region is 18 nucleosides long.

[0175] In some embodiments of the oligonucleotide, the 3' mixed-mer region is 4 to 12 nucleosides long. In some embodiments, the 3' mixed-mer region is 4, 5, 6, 7, 8, 9, 10, 11 or 12 nucleosides long. In some embodiments, the 3' mixed-mer region is 9 nucleosides long.

[0176] In some embodiments, the 5' mixed polymer region is 24 nucleosides long and the 3' mixed polymer region is 9 nucleosides long. In some embodiments, the 5' mixed polymer region is 24 nucleosides long and the 3' mixed polymer region is 8 nucleosides long. In some embodiments, the 5' mixed polymer region is 24 nucleosides long and the 3' mixed polymer region is 7 nucleosides long. In some embodiments, the 5' mixed polymer region is 24 nucleosides long and the 3' mixed polymer region is 6 nucleosides long. In some embodiments, the 5' mixed polymer region is 23 nucleosides long and the 3' mixed polymer region is 9 nucleosides long. In some embodiments, the 5' mixed polymer region is 23 nucleosides long and the 3' mixed polymer region is 4 nucleosides long. In some embodiments, the 5' mixed polymer region is 22 nucleosides long and the 3' mixed polymer region is 9 nucleosides long. In some embodiments, the 5' mixed polymer region is 22 nucleosides long and the 3' mixed polymer region is 5 nucleosides long. In some embodiments, the 5' mixed polymer region is 21 nucleosides long and the 3' mixed polymer region is 9 nucleosides long. In some embodiments, the 5' mixed polymer region is 21 nucleosides long and the 3' mixed polymer region is 6 nucleosides long. In some embodiments, the 5' mixed polymer region is 20 nucleosides long and the 3' mixed polymer region is 9 nucleosides long. In some embodiments, the 5' mixed polymer region is 20 nucleosides long and the 3' mixed polymer region is 7 nucleosides long. In some embodiments, the 5' mixed polymer region is 19 nucleosides long and the 3' mixed polymer region is 9 nucleosides long. In some embodiments, the 5' mixed polymer region is 19 nucleosides long and the 3' mixed polymer region is 8 nucleosides long. In some embodiments, the 5' mixed-mer region is 19 nucleosides long and the 3' mixed-mer region is 7 nucleosides long. In some embodiments, the 5' mixed-mer region is 19 nucleosides long and the 3' mixed-mer region is 6 nucleosides long. In some embodiments, the 5' mixed-mer region is 18 nucleosides long and the 3' mixed-mer region is 9 nucleosides long. In some embodiments, the 5' mixed-mer region is 17 nucleosides long and the 3' mixed-mer region is 9 nucleosides long.

[0177] In some embodiments, the oligonucleotide is 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 nucleosides long, the 5' mixed-mer region is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleosides long and the 3' mixed-mer region is 5, 6, 7, 8, 9, 10, 11, or 12 nucleosides long. In some embodiments, the oligonucleotide is 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 nucleosides long, the 5' mixed-mer region is 16, 17, 18, 19, 20, 21, 22, or 23 nucleosides long and the 3' mixed-mer region is 8 or 9 nucleosides long. In some embodiments, the oligonucleotide is 40 nucleosides long, the 5' mixed-mer region is 18 nucleosides long and the 3' mixed-mer region is 9 nucleosides long.

[0178] In some embodiments of the oligonucleotides of the invention, the 5' mixed polymer region comprises nucleosides from position +1 to position +10, +11, +12, +13, +14, +15, +16, +17, 18, +19, +20, +21, +22, +23, +24, or +25. In other words, the 5' mixed polymer region comprises nucleosides from position +1 to position +10, or from position +1 to position +11, or from position +1 to position +12, and so on. In some embodiments, the 5' mixed polymer region comprises nucleosides from position +2 to position +10, +11, +12, +13, +14, +15, +16, +17, 18, +19, +20, +21, +22, +23, +24, or +25. In some embodiments, the 5' mixed-mer region comprises nucleosides from position +2 to position +15, +16, +17, +18, +19, +20, +21, +22, +23, or +24. In some embodiments, the 5' mixed-mer region comprises nucleosides from position +2 to position +19, +20, +21, +22, +23, or +24.

[0179] In some embodiments, the 5' mixed-mer region consists of nucleosides from position +1 to position +10, +11, +12, +13, +14, +15, +16, +17, 18, +19, +20, +21, +22, +23, +24, or +25. In some embodiments, the 5' mixed-mer region consists of nucleosides from position +2 to position +10, +11, +12, +13, +14, +15, +16, +17, 18, +19, +20, +21, +22, +23, +24, or +25. In some embodiments, the 5' mixed-mer region consists of nucleosides from position +2 to position +15, +16, +17, +18, +19, +20, +21, +22, +23, or +24. In some embodiments, the 5' mixed-mer region consists of nucleosides from position +2 to position +19, +20, +21, +22, +23, or +24.

[0180] In some embodiments, the 5' mixed-mer region comprises nucleosides at positions +2 to +19. In some embodiments, the 5' mixed-mer region consists of nucleosides at positions +2 to +19.

[0181] In some embodiments of the oligonucleotides of the invention, the 3' mixed-mer region comprises nucleosides from position -1 to position -3, -4, -5, -6, -7, -8, -9, -10, -11, -12, -13, -14, -15, -16, or -17. In other words, the 3' mixed-mer region comprises nucleosides from position -1 to position -3, or from position -1 to position -4, or from position -1 to position -5, and so on.

[0182] In some embodiments, the 3' mixed-mer region comprises nucleosides from position -2 to position -3, -4, -5, -6, -7, -8, -9, -10, -11, -12, -13, -14, -15, -16, or -17. In some embodiments, the 3' mixed-mer region comprises nucleosides from position -2 to position -5, -6, -7, -8, -9, -10, -11, -12, -13, -14, or -15. In some embodiments, the 3' mixed-mer region comprises nucleosides from position -2 to position -5, -6, -7, -8, -9, or -10.

[0183] In some embodiments, the 3' mixed-mer region comprises nucleosides at positions -2 to -10. In some embodiments, the 3' mixed-mer region consists of nucleosides at positions -2 to -10.

[0184] In some embodiments of the oligonucleotides of the invention, the 5' mixed-mer region consists of nucleosides from position +2 to position +15, +16, +17, +18, +19, +20, +21, +22, +23 or +24, and the 3' mixed-mer region consists of nucleosides from position -2 to position -5, -6, -7, -8, -9, -10, -11, -12, -13, -14 or -15. In some embodiments, the 5' mixed-mer region consists of nucleosides from position +2 to position +17, +18, +19, +20, +21, +22, +23 or +24, and the 3' mixed-mer region consists of nucleosides from position -2 to position -7, -8, -9 or -10.

[0185] In some embodiments, the 5′ mixed polymer region consists of nucleosides at position +2 to position +17, +18, +19, +20, +21, +22, +23, or +24, and the 3′ mixed polymer region consists of nucleosides at position -2 to position -10. In some embodiments, the 5′ mixed polymer region consists of nucleosides at position +2 to position +17, and the 3′ mixed polymer region consists of nucleosides at position -2 to position -10. In some embodiments, the 5′ mixed polymer region consists of nucleosides at position +2 to position +18, and the 3′ mixed polymer region consists of nucleosides at position -2 to position -10. In some embodiments, the 5′ mixed polymer region consists of nucleosides at position +2 to position +19, and the 3′ mixed polymer region consists of nucleosides at position -2 to position -10. In some embodiments, the 5′ mixed polymer region consists of nucleosides from position +2 to position +20, and the 3′ mixed polymer region consists of nucleosides from position -2 to position -10. In some embodiments, the 5′ mixed polymer region consists of nucleosides from position +2 to position +21, and the 3′ mixed polymer region consists of nucleosides from position -2 to position -10. In some embodiments, the 5′ mixed polymer region consists of nucleosides from position +2 to position +22, and the 3′ mixed polymer region consists of nucleosides from position -2 to position -10. In some embodiments, the 5′ mixed polymer region consists of nucleosides from position +2 to position +23, and the 3′ mixed polymer region consists of nucleosides from position -2 to position -10. In some embodiments, the 5′ mixed polymer region consists of nucleosides from position +2 to position +24, and the 3′ mixed polymer region consists of nucleosides from position -2 to position -10. In some embodiments, the 5' mixed-mer region consists of nucleosides from position +2 to position +25, and the 3' mixed-mer region consists of nucleosides from position -2 to position -10.

[0186] In some embodiments, the 5′ mixed-mer region consists of nucleosides from position +2 to position +25, and the 3′ mixed-mer region consists of nucleosides from position -2 to position -9. In some embodiments, the 5′ mixed-mer region consists of nucleosides from position +2 to position +25, and the 3′ mixed-mer region consists of nucleosides from position -2 to position -8. In some embodiments, the 5′ mixed-mer region consists of nucleosides from position +2 to position +25, and the 3′ mixed-mer region consists of nucleosides from position -2 to position -7.

[0187] In some embodiments, the 5' mixed-mer region consists of nucleosides from position +2 to position +20, and the 3' mixed-mer region consists of nucleosides from position -2 to position -8. In some embodiments, the 5' mixed-mer region consists of nucleosides from position +2 to position +20, and the 3' mixed-mer region consists of nucleosides from position -2 to position -7.

[0188] In some embodiments, the 5′ mixed polymer region consists of nucleosides at position +2 to position +20, and the 3′ mixed polymer region consists of nucleosides at position -2 to position -9. In some embodiments, the 5′ mixed polymer region consists of nucleosides at position +2 to position +21, and the 3′ mixed polymer region consists of nucleosides at position -2 to position -8. In some embodiments, the 5′ mixed polymer region consists of nucleosides at position +2 to position +22, and the 3′ mixed polymer region consists of nucleosides at position -2 to position -7. In some embodiments, the 5′ mixed polymer region consists of nucleosides at position +2 to position +23, and the 3′ mixed polymer region consists of nucleosides at position -2 to position -6. In some embodiments, the 5′ mixed polymer region consists of nucleosides at position +2 to position +24, and the 3′ mixed polymer region consists of nucleosides at position -2 to position -5.

[0189] In some embodiments, the oligonucleotide is 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 nucleosides in length, the 5' mixed-mer region consists of nucleosides from position +2 to position +15, +16, +17, +18, +19, +20, +21, +22, +23, or +24, and the 3' mixed-mer region consists of nucleosides from position -2 to position -5, -6, -7, -8, -9, -10, -11, -12, -13, -14, or -15. In some embodiments, the oligonucleotide is 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 nucleosides long, the 5' mixed-mer region consists of nucleosides from position +2 to position +17, +18, +19, +20, +21, +22, +23, or +24, and the 3' mixed-mer region consists of nucleosides from position -2 to position -7, -8, -9, or -10. In some embodiments, the oligonucleotide is 40 nucleosides long, the 5' mixed-mer region consists of nucleosides from position +2 to position +17, +18, +19, +20, +21, +22, +23, or +24, and the 3' mixed-mer region consists of nucleosides from position -2 to position -7, -8, -9, or -10. In some embodiments, the oligonucleotide is 40 nucleosides in length, the 5' mixed-mer region consists of nucleosides from position +2 to position +19, and the 3' mixed-mer region consists of nucleosides from position -2 to position -10.

[0190] Mixed polymer region model

[0191] In some embodiments, the nucleosides at one or more of positions +3, +5, +7, +9, +11, +13, +15, +17, and +19 are mixed polymer nucleosides of the first type. In some embodiments, the nucleosides at one or more of positions +3, +5, +7, +9, +11, +13, +15, +17, and +19 are 5' mixed polymer nucleosides of the first type. In some embodiments, the nucleoside at position +3 is a first type of 5' mixed polymer nucleoside, and / or the nucleoside at position +5 is a first type of 5' mixed polymer nucleoside, and / or the nucleoside at position +7 is a first type of 5' mixed polymer nucleoside, and / or the nucleoside at position +9 is a first type of 5' mixed polymer nucleoside, and / or the nucleoside at position +11 is a first type of 5' mixed polymer nucleoside, and / or the nucleoside at position +13 is a first type of 5' mixed polymer nucleoside, and / or the nucleoside at position +15 is a first type of 5' mixed polymer nucleoside, and / or the nucleoside at position +17 is a first type of 5' mixed polymer nucleoside and / or the nucleoside at position +19 is a first type of 5' mixed polymer nucleoside. In some embodiments, the nucleoside at each of positions +3, +5, +7, +9, +11, +13, +15, +17 and +19 is a first type of 5' mixed polymer nucleoside.

[0192] In some embodiments, the nucleoside at one or more of positions -3, -5, -7 and -9 is a first type of mixed polymer nucleoside. In some embodiments, the nucleoside at one or more of positions -3, -5, -7 and -9 is a first type of 3' mixed polymer nucleoside. In some embodiments, the nucleoside at position -3 is a first type of 3' mixed polymer nucleoside, and / or the nucleoside at position -5 is a first type of 3' mixed polymer nucleoside, and / or the nucleoside at position -7 is a first type of 3' mixed polymer nucleoside, and / or the nucleoside at position -9 is a first type of 3' mixed polymer nucleoside. In some embodiments, the nucleoside at each of positions -3, -5, -7 and -9 is a first type of 3' mixed polymer nucleoside.

[0193] In some embodiments, the nucleosides at one or more of positions +2, +4, +6, +8, +10, +12, +14, and +18 are mixed polymer nucleosides of the second type. In some embodiments, the nucleosides at one or more of positions +2, +4, +6, +8, +10, +12, +14, and +18 are 5' mixed polymer nucleosides of the second type. In some embodiments, the nucleoside at position +2 is a 5' mixed polymer nucleoside of the second type, and / or the nucleoside at position +4 is a 5' mixed polymer nucleoside of the second type, and / or the nucleoside at position +6 is a 5' mixed polymer nucleoside of the second type, and / or the nucleoside at position +8 is a 5' mixed polymer nucleoside of the second type, and / or the nucleoside at position +10 is a 5' mixed polymer nucleoside of the second type, and / or the nucleoside at position +12 is a 5' mixed polymer nucleoside of the second type, and / or the nucleoside at position +14 is a 5' mixed polymer nucleoside of the second type, and / or the nucleoside at position +18 is a 5' mixed polymer nucleoside of the second type. In some embodiments, the nucleoside at each of positions +2, +4, +6, +8, +10, +12, +14 and +18 is a 5' mixed polymer nucleoside of the second type.

[0194] In some embodiments, the nucleoside at one or more of positions -2, -4 and -6 is a second type of mixed polymer nucleoside. In some embodiments, the nucleoside at one or more of positions -2, -4 and -6 is a second type of 3' mixed polymer nucleoside. In some embodiments, the nucleoside at position -2 is a second type of 3' mixed polymer nucleoside, and / or the nucleoside at position -4 is a second type of 3' mixed polymer nucleoside, and / or the nucleoside at position -6 is a second type of 3' mixed polymer nucleoside. In some embodiments, the nucleoside at each of positions -2, -4 and -6 is a second type of 3' mixed polymer nucleoside.

[0195] In some embodiments, the nucleosides at one or more of positions +3, +5, +7, +9, +11, +13, +15, +17, +19, +21, and +23 are mixed polymer nucleosides of the first type. In some embodiments, the nucleosides at one or more of positions +3, +5, +7, +9, +11, +13, +15, +17, +19, +21, and +23 are 5' mixed polymer nucleosides of the first type. In some embodiments, the nucleoside at position +3 is a first type of 5' mixed polymer nucleoside, and / or the nucleoside at position +5 is a first type of 5' mixed polymer nucleoside, and / or the nucleoside at position +7 is a first type of 5' mixed polymer nucleoside, and / or the nucleoside at position +9 is a first type of 5' mixed polymer nucleoside, and / or the nucleoside at position +11 is a first type of 5' mixed polymer nucleoside, and / or the nucleoside at position +13 is a first type of 5' mixed polymer nucleoside, and / or the nucleoside at position +15 is a first type of 5' mixed polymer nucleoside, and / or the nucleoside at position +17 is a first type of 5' mixed polymer nucleoside, and / or the nucleoside at position +19 is a first type of 5' mixed polymer nucleoside, and / or the nucleoside at position +21 is a first type of 5' mixed polymer nucleoside, and / or the nucleoside at position +23 is a first type of 5' mixed polymer nucleoside. In some embodiments, the nucleosides at each of positions +3, +5, +7, +9, +11, +13, +15, +17, +19, +21, and +23 are 5' mixed-mer nucleosides of the first type.

[0196] In some embodiments, the nucleoside at one or more of positions -3, -5, -7, -9, -11, -13 and -15 is a first type of mixed polymer nucleoside. In some embodiments, the nucleoside at one or more of positions -3, -5, -7, -9, -11, -13 and -15 is a first type of 3' mixed polymer nucleoside. In some embodiments, the nucleoside at position -3 is a first type of 3' mixed polymer nucleoside, and / or the nucleoside at position -5 is a first type of 3' mixed polymer nucleoside, and / or the nucleoside at position -7 is a first type of 3' mixed polymer nucleoside, and / or the nucleoside at position -9 is a first type of 3' mixed polymer nucleoside, and / or the nucleoside at position -11 is a first type of 3' mixed polymer nucleoside, and / or the nucleoside at position -13 is a first type of 3' mixed polymer nucleoside, and / or the nucleoside at position -15 is a first type of 3' mixed polymer nucleoside. In some embodiments, the nucleoside at each of positions -3, -5, -7, -9, -11, -13, and -15 is a first type of 3' mixed-mer nucleoside.

[0197] In some embodiments, the nucleosides at one or more of positions +2, +4, +6, +8, +10, +12, +14, +18, +20, +22, and +24 are mixed polymer nucleosides of the second type. In some embodiments, the nucleosides at one or more of positions +2, +4, +6, +8, +10, +12, +14, +18, +20, +22, and +24 are 5' mixed polymer nucleosides of the second type. In some embodiments, the nucleoside at position +2 is a 5' mixed polymer nucleoside of the second type, and / or the nucleoside at position +4 is a 5' mixed polymer nucleoside of the second type, and / or the nucleoside at position +6 is a 5' mixed polymer nucleoside of the second type, and / or the nucleoside at position +8 is a 5' mixed polymer nucleoside of the second type, and / or the nucleoside at position +10 is a 5' mixed polymer nucleoside of the second type, and / or the nucleoside at position +12 is a 5' mixed polymer nucleoside of the second type, and / or the nucleoside at position +14 is a 5' mixed polymer nucleoside of the second type, and / or the nucleoside at position +18 is a 5' mixed polymer nucleoside of the second type, and / or the nucleoside at position +20 is a 5' mixed polymer nucleoside of the second type, and / or the nucleoside at position +22 is a 5' mixed polymer nucleoside of the second type, and / or the nucleoside at position +24 is a 5' mixed polymer nucleoside of the second type. In some embodiments, the nucleosides at each of positions +2, +4, +6, +8, +10, +12, +14, +18, +20, +22, and +24 are 5' mixed-mer nucleosides of the second type.

[0198] In some embodiments, the nucleoside at one or more of positions -2, -4, -6, -10, -12 and -14 is a second type of mixed polymer nucleoside. In some embodiments, the nucleoside at one or more of positions -2, -4, -6, -10, -12 and -14 is a second type of 3' mixed polymer nucleoside. In some embodiments, the nucleoside at position -2 is a second type of 3' mixed polymer nucleoside, and / or the nucleoside at position -4 is a second type of 3' mixed polymer nucleoside, and / or the nucleoside at position -6 is a second type of 3' mixed polymer nucleoside, and / or the nucleoside at position -10 is a second type of 3' mixed polymer nucleoside, and / or the nucleoside at position -12 is a second type of 3' mixed polymer nucleoside, and / or the nucleoside at position -14 is a second type of 3' mixed polymer nucleoside. In some embodiments, the nucleoside at each of positions -2, -4, -6, -10, -12, and -14 is a 3' mixed-mer nucleoside of the second type.

[0199] In some embodiments of the oligonucleotides of the present invention, the nucleosides at positions +2 to +19 are a 5' mixed polymer region, the nucleosides at each of positions +3, +5, +7, +9, +11, +13, +15, +17 and +19 are 5' mixed polymer nucleosides of the first type, and the nucleosides at each of positions +2, +4, +6, +8, +10, +12, +14, +16 and +18 are 5' mixed polymer nucleosides of the second type.

[0200] In some embodiments, the nucleoside at position +16 is a 3' mixed-mer nucleoside of the second type. In some embodiments, the nucleoside at position -8 is a 3' mixed-mer nucleoside of the second type.

[0201] In some embodiments of the oligonucleotides of the present invention, the nucleosides at positions -2 to -10 are a 3' mixed polymer region, the nucleosides at each of positions -3, -5, -7 and -9 are 3' mixed polymer nucleosides of the first type, and the nucleosides at each of positions -2, -4, -6, -8 and -10 are 3' mixed polymer nucleosides of the second type.

[0202] In some embodiments of the oligonucleotides of the invention, the nucleosides at position +2 to position +24 are a 5' mixed polymer region, the nucleosides at each of positions +3, +5, +7, +9, +11, +13, +15, +17, +19, +21 and +23 are 5' mixed polymer nucleosides of the first type, and the nucleosides at each of positions +2, +4, +6, +8, +10, +12, +14, +16, +18, +20, +22 and +24 are 5' mixed polymer nucleosides of the second type.

[0203] In some embodiments of the oligonucleotides of the present invention, the nucleosides at positions -2 to -15 are a 3' mixed polymer region, the nucleosides at each of positions -3, -5, -7, -9, -11, -13 and -15 are 3' mixed polymer nucleosides of the first type, and the nucleosides at each of positions -2, -4, -6, -8, -10, -12 and -14 are 3' mixed polymer nucleosides of the second type.

[0204] Types of mixed nucleosides

[0205] In some embodiments of the oligonucleotides of the invention, the mixedmer region comprises a first type of mixedmer nucleosides and a second type of mixedmer nucleosides, wherein the sugar moiety of the first type of mixedmer nucleosides is different from the sugar moiety of the second type of mixedmer nucleosides.

[0206] In some embodiments, the first type of mixed polymer nucleoside is selected from the group consisting of DNA, RNA, 2'-O-methyl-RNA, 2'-O-methoxyethyl-RNA (MOE-RNA), 2'-fluoro-RNA, linking nucleic acid (LNA), arabino nucleic acid (ANA), and 2'-fluoroarabino nucleic acid (FANA) nucleosides. In some embodiments, the first type of mixed polymer nucleoside is selected from the group consisting of RNA, 2'-O-methyl-RNA, and 2'-fluoro-RNA nucleosides. In some embodiments, the first type of mixed polymer nucleoside is a 2'-fluoro-RNA nucleoside or a 2'-O-methyl-RNA nucleoside. In some embodiments, the first type of mixed polymer nucleoside is a 2'-fluoro-RNA nucleoside.

[0207] In some embodiments, the second type of mixed polymer nucleoside is selected from the group consisting of DNA, RNA, 2'-O-methyl-RNA, MOE-RNA, 2'-fluoro-RNA, LNA, ANA and FANA nucleosides. In some embodiments, the second type of mixed polymer nucleoside is selected from the group consisting of RNA, 2'-O-methyl-RNA and 2'-fluoro-RNA nucleosides. In some embodiments, the second type of mixed polymer nucleoside is a 2'-fluoro-RNA nucleoside or a 2'-O-methyl-RNA nucleoside. In some embodiments, the second type of mixed polymer nucleoside is a 2'-O-methyl-RNA nucleoside.

[0208] In some embodiments, the first type of 5' mixed polymer nucleoside is selected from the group consisting of DNA, RNA, 2'-O-methyl-RNA, MOE-RNA, 2'-fluoro-RNA, LNA, ANA and FANA nucleosides. In some embodiments, the first type of 5' mixed polymer nucleoside is selected from the group consisting of RNA, 2'-O-methyl-RNA and 2'-fluoro-RNA nucleosides. In some embodiments, the first type of 5' mixed polymer nucleoside is a 2'-fluoro-RNA nucleoside or a 2'-O-methyl-RNA nucleoside. In some embodiments, the first type of 5' mixed polymer nucleoside is a 2'-fluoro-RNA nucleoside.

[0209] In some embodiments, the second type of 5' mixed polymer nucleoside is selected from the group consisting of DNA, RNA, 2'-O-methyl-RNA, MOE-RNA, 2'-fluoro-RNA, LNA, ANA and FANA nucleosides. In some embodiments, the second type of 5' mixed polymer nucleoside is selected from the group consisting of RNA, 2'-O-methyl-RNA and 2'-fluoro-RNA nucleosides. In some embodiments, the second type of 5' mixed polymer nucleoside is a 2'-fluoro-RNA nucleoside or a 2'-O-methyl-RNA nucleoside. In some embodiments, the second type of 5' mixed polymer nucleoside is a 2'-O-methyl-RNA nucleoside.

[0210] In some embodiments, the first type of 3' mixed polymer nucleoside is selected from the group consisting of DNA, RNA, 2'-O-methyl-RNA, MOE-RNA, 2'-fluoro-RNA, LNA, ANA and FANA nucleosides. In some embodiments, the first type of 3' mixed polymer nucleoside is selected from the group consisting of RNA, 2'-O-methyl-RNA and 2'-fluoro-RNA nucleosides. In some embodiments, the first type of 3' mixed polymer nucleoside is a 2'-fluoro-RNA nucleoside or a 2'-O-methyl-RNA nucleoside. In some embodiments, the first type of 3' mixed polymer nucleoside is a 2'-fluoro-RNA nucleoside.

[0211] In some embodiments, the second type of 3' mixed polymer nucleoside is selected from the group consisting of DNA, RNA, 2'-O-methyl-RNA, MOE-RNA, 2'-fluoro-RNA, LNA, ANA and FANA nucleosides. In some embodiments, the second type of 3' mixed polymer nucleoside is selected from the group consisting of RNA, 2'-O-methyl-RNA and 2'-fluoro-RNA nucleosides. In some embodiments, the second type of 3' mixed polymer nucleoside is a 2'-fluoro-RNA nucleoside or a 2'-O-methyl-RNA nucleoside. In some embodiments, the second type of 3' mixed polymer nucleoside is a 2'-O-methyl-RNA nucleoside.

[0212] In some embodiments:

[0213] (a) the first type of 5′ mixed polymer nucleosides is selected from the group consisting of DNA, RNA, 2′-O-methyl-RNA, MOE-RNA, 2′-fluoro-RNA, LNA, ANA and FANA nucleosides; and / or

[0214] (b) the second type of 5′ mixed polymer nucleoside is selected from the group consisting of DNA, RNA, 2′-O-methyl-RNA, MOE-RNA, 2′-fluoro-RNA, LNA, ANA and FANA nucleosides; and / or

[0215] (c) the first type of 3′ mixed polymer nucleosides is selected from the group consisting of DNA, RNA, 2′-O-methyl-RNA, MOE-RNA, 2′-fluoro-RNA, LNA, ANA and FANA nucleosides; and / or

[0216] (d) The second type of 3' mixed-mer nucleosides is selected from the group consisting of DNA, RNA, 2'-O-methyl-RNA, MOE-RNA, 2'-fluoro-RNA, LNA, ANA and FANA nucleosides.

[0217] In some embodiments, the first type of 5′ mixed polymer nucleoside is a 2′-fluoro-RNA nucleoside, and / or the second type of 5′ mixed polymer nucleoside is a 2′-O-methyl-RNA nucleoside, and / or the first type of 3′ mixed polymer nucleoside is a 2′-fluoro-RNA nucleoside, and / or the second type of 3′ mixed polymer nucleoside is a 2′-O-methyl-RNA nucleoside.

[0218] In some embodiments, the first type of mixed polymer nucleoside is a 2'-fluoro-RNA nucleoside and the second type of mixed polymer nucleoside is a 2'-O-methyl-RNA nucleoside. In some embodiments, the first type of mixed polymer nucleoside is a 2'-O-methyl-RNA nucleoside and the second type of mixed polymer nucleoside is a 2'-fluoro-RNA nucleoside. In some embodiments, the first type of 5' mixed polymer nucleoside is a 2'-fluoro-RNA nucleoside, the second type of 5' mixed polymer nucleoside is a 2'-O-methyl-RNA nucleoside, the first type of 3' mixed polymer nucleoside is a 2'-fluoro-RNA nucleoside, and the second type of 3' mixed polymer nucleoside is a 2'-O-methyl-RNA nucleoside.

[0219] The different types of sugar-modified nucleosides listed above are described in detail elsewhere herein.

[0220] 2′-Fluoro-RNA and 2′-O-methyl-RNA mixed polymer region

[0221] In some embodiments, the mixed polymer region comprises 2'-fluoro-RNA nucleosides and 2'-O-methyl-RNA nucleosides. In some embodiments, the mixed polymer region consists of 2'-fluoro-RNA nucleosides and 2'-O-methyl-RNA nucleosides. In some embodiments, each nucleoside in the mixed polymer region is a 2'-fluoro-RNA nucleoside or a 2'-O-methyl-RNA nucleoside. In some embodiments, the mixed polymer region comprises alternating 2'-fluoro-RNA nucleosides and 2'-O-methyl-RNA nucleosides. In some embodiments, the mixed polymer region consists of alternating 2'-fluoro-RNA nucleosides and 2'-O-methyl-RNA nucleosides.

[0222] In some embodiments, the 5' mixed polymer region comprises 2'-fluoro-RNA nucleosides and 2'-O-methyl-RNA nucleosides. In some embodiments, the 5' mixed polymer region consists of 2'-fluoro-RNA nucleosides and 2'-O-methyl-RNA nucleosides. In some embodiments, each nucleoside in the 5' mixed polymer region is a 2'-fluoro-RNA nucleoside or a 2'-O-methyl-RNA nucleoside. In some embodiments, the 5' mixed polymer region comprises alternating 2'-fluoro-RNA nucleosides and 2'-O-methyl-RNA nucleosides. In some embodiments, the 5' mixed polymer region consists of alternating 2'-fluoro-RNA nucleosides and 2'-O-methyl-RNA nucleosides.

[0223] In some embodiments, the 3' mixed polymer region comprises 2'-fluoro-RNA nucleosides and 2'-O-methyl-RNA nucleosides. In some embodiments, each nucleoside in the 3' mixed polymer region is a 2'-fluoro-RNA nucleoside or a 2'-O-methyl-RNA nucleoside. In some embodiments, the 3' mixed polymer region comprises alternating 2'-fluoro-RNA nucleosides and 2'-O-methyl-RNA nucleosides. In some embodiments, the 3' mixed polymer region consists of alternating 2'-fluoro-RNA nucleosides and 2'-O-methyl-RNA nucleosides.

[0224] In some embodiments, each nucleoside at position +2 to +19 is a 2′-fluoro-RNA nucleoside or a 2′-O-methyl-RNA nucleoside. In some embodiments, the nucleoside at position +2 is a 2′-fluoro-RNA nucleoside or a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +3 is a 2′-fluoro-RNA nucleoside or a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +4 is a 2′-fluoro-RNA nucleoside or a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +5 is a 2′-fluoro-RNA nucleoside or a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +6 is a 2′-fluoro-RNA nucleoside or a 2′-O-methyl-RNA nucleoside. -RNA nucleoside or 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +7 is a 2′-fluoro-RNA nucleoside or 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +8 is a 2′-fluoro-RNA nucleoside or 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +9 is a 2′-fluoro-RNA nucleoside or 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +10 is a 2′-fluoro-RNA nucleoside or 2′-O-methyl-RNA nucleoside, and and / or the nucleoside at position +11 is a 2′-fluoro-RNA nucleoside or a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +12 is a 2′-fluoro-RNA nucleoside or a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +13 is a 2′-fluoro-RNA nucleoside or a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +14 is a 2′-fluoro-RNA nucleoside or a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +15 is a 2′-fluoro-RNA nucleoside or a 2′-O-methyl-RNA nucleoside. NA nucleoside or 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +16 is a 2′-fluoro-RNA nucleoside or 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +17 is a 2′-fluoro-RNA nucleoside or 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +18 is a 2′-fluoro-RNA nucleoside or 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +19 is a 2′-fluoro-RNA nucleoside or 2′-O-methyl-RNA nucleoside.

[0225] In some embodiments, each nucleoside at positions -2 to -9 is a 2'-fluoro-RNA nucleoside or a 2'-O-methyl-RNA nucleoside. In some embodiments, the nucleoside at position-2 is a 2′-fluoro-RNA nucleoside or a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position-3 is a 2′-fluoro-RNA nucleoside or a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position-4 is a 2′-fluoro-RNA nucleoside or a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position-5 is a 2′-fluoro-RNA nucleoside or a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position-6 is a 2′-fluoro-RNA nucleoside or a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position-7 is a 2′-fluoro-RNA nucleoside or a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position-8 is a 2′-fluoro-RNA nucleoside or a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position-9 is a 2′-fluoro-RNA nucleoside or a 2′-O-methyl-RNA nucleoside.

[0226] In some embodiments, each nucleoside at position +2 to +24 is a 2′-fluoro-RNA nucleoside or a 2′-O-methyl-RNA nucleoside. In some embodiments, the nucleoside at position +2 is a 2′-fluoro-RNA nucleoside or a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +3 is a 2′-fluoro-RNA nucleoside or a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +4 is a 2′-fluoro-RNA nucleoside or a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +5 is a 2′-fluoro-RNA nucleoside or a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +6 is a 2′-fluoro-RNA nucleoside or a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +7 is a 2′-fluoro-RNA nucleoside or a 2′-O -methyl-RNA nucleoside, and / or the nucleoside at position +8 is a 2′-fluoro-RNA nucleoside or a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +9 is a 2′-fluoro-RNA nucleoside or a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +10 is a 2′-fluoro-RNA nucleoside or a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +11 is a 2′-fluoro-RNA nucleoside or a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +12 is a 2′-fluoro-RNA nucleoside or a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +13 is a 2′-fluoro-RNA nucleoside. A nucleoside or 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +14 is a 2′-fluoro-RNA nucleoside or 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +15 is a 2′-fluoro-RNA nucleoside or 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +16 is a 2′-fluoro-RNA nucleoside or 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +17 is a 2′-fluoro-RNA nucleoside or 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +18 is a 2′-fluoro-RNA nucleoside or 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +19 is a 2′-fluoro-RNA nucleoside or 2′-O-methyl-RNA nucleoside. The nucleoside is a 2′-fluoro-RNA nucleoside or a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +20 is a 2′-fluoro-RNA nucleoside or a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +21 is a 2′-fluoro-RNA nucleoside or a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +22 is a 2′-fluoro-RNA nucleoside or a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +23 is a 2′-fluoro-RNA nucleoside or a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +24 is a 2′-fluoro-RNA nucleoside or a 2′-O-methyl-RNA nucleoside.

[0227] In some embodiments, each nucleoside at positions -2 to -15 is a 2'-O-methyl-RNA nucleoside or a 2'-fluoro-RNA nucleoside. In some embodiments, the nucleoside at position-2 is a 2′-fluoro-RNA nucleoside or a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position-3 is a 2′-fluoro-RNA nucleoside or a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position-4 is a 2′-fluoro-RNA nucleoside or a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position-5 is a 2′-fluoro-RNA nucleoside or a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position-6 is a 2′-fluoro-RNA nucleoside or a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position-7 is a 2′-fluoro-RNA nucleoside or a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position-8 is a 2′-fluoro-RNA nucleoside or a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position-9 is a 2′-fluoro-RNA nucleoside or a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position-10 is a 2′-fluoro-RNA nucleoside or a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position-11 is a 2′-fluoro-RNA nucleoside or a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position-12 is a 2′-fluoro-RNA nucleoside or a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position-13 is a 2′-fluoro-RNA nucleoside or a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position-14 is a 2′-fluoro-RNA nucleoside or a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position-15 is a 2′-fluoro-RNA nucleoside or a 2′-O-methyl-RNA nucleoside.

[0228] 2'-Fluoro-RNA nucleosides or 2'-O-methyl-RNA nucleosides at specific positions improve editing efficiency. Therefore, in some embodiments, the nucleoside at position -2 is a 2'-O-methyl-RNA nucleoside. In some embodiments, the nucleoside at position -3 is a 2'-fluoro-RNA nucleoside. In some embodiments, the nucleoside at position -8 is a 2'-fluoro-RNA nucleoside. In some embodiments, the nucleoside at position +16 is a 2'-fluoro-RNA nucleoside. In some embodiments, the nucleoside at position +17 is a 2'-fluoro-RNA nucleoside.

[0229] In some embodiments, the nucleoside at one or more of positions +3, +5, +7, +9, +11, +13, +15, +17, and +19 is a 2′-fluoro-RNA nucleoside. In some embodiments, the nucleoside at position +3 is a 2′-fluoro-RNA nucleoside, and / or the nucleoside at position +5 is a 2′-fluoro-RNA nucleoside, and / or the nucleoside at position +7 is a 2′-fluoro-RNA nucleoside, and / or the nucleoside at position +9 is a 2′-fluoro-RNA nucleoside, and / or the nucleoside at position +11 is a 2′-fluoro-RNA nucleoside, and / or the nucleoside at position +13 is a 2′-fluoro-RNA nucleoside, and / or the nucleoside at position +15 is a 2′-fluoro-RNA nucleoside, and / or the nucleoside at position +17 is a 2′-fluoro-RNA nucleoside, and / or the nucleoside at position +19 is a 2′-fluoro-RNA nucleoside. In some embodiments, the nucleoside at each of positions +3, +5, +7, +9, +11, +13, +15, +17, and +19 is a 2'-fluoro-RNA nucleoside.

[0230] In some embodiments, the nucleoside at one or more of positions -3, -5, -7 and -9 is a 2'-fluoro-RNA nucleoside. In some embodiments, the nucleoside at position -3 is a 2'-fluoro-RNA nucleoside, and / or the nucleoside at position -5 is a 2'-fluoro-RNA nucleoside, and / or the nucleoside at position -7 is a 2'-fluoro-RNA nucleoside, and / or the nucleoside at position -9 is a 2'-fluoro-RNA nucleoside. In some embodiments, the nucleoside at each of positions -3, -5, -7 and -9 is a 2'-fluoro-RNA nucleoside.

[0231] In some embodiments, the nucleoside at one or more of positions +2, +4, +6, +8, +10, +12, +14, and +18 is a 2′-O-methyl-RNA nucleoside. In some embodiments, the nucleoside at position +2 is a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +4 is a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +6 is a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +8 is a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +10 is a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +12 is a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +14 is a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +18 is a 2′-O-methyl-RNA nucleoside. In some embodiments, the nucleoside at each of positions +2, +4, +6, +8, +10, +12, +14, and +18 is a 2'-O-methyl-RNA nucleoside.

[0232] In some embodiments, the nucleoside at one or more of positions -2, -4 and -6 is a 2'-O-methyl-RNA nucleoside. In some embodiments, the nucleoside at position -2 is a 2'-O-methyl-RNA nucleoside, and / or the nucleoside at position -4 is a 2'-O-methyl-RNA nucleoside, and / or the nucleoside at position -6 is a 2'-O-methyl-RNA nucleoside. In some embodiments, the nucleoside at each of positions -2, -4 and -6 is a 2'-O-methyl-RNA nucleoside.

[0233] In some embodiments, the nucleosides at one or more of positions +3, +5, +7, +9, +11, +13, +15, +17, +19, +21, and +23 are 2'-fluoro-RNA nucleosides. In some embodiments, the nucleoside at position +3 is a 2′-fluoro-RNA nucleoside, and / or the nucleoside at position +5 is a 2′-fluoro-RNA nucleoside, and / or the nucleoside at position +7 is a 2′-fluoro-RNA nucleoside, and / or the nucleoside at position +9 is a 2′-fluoro-RNA nucleoside, and / or the nucleoside at position +11 is a 2′-fluoro-RNA nucleoside, and / or the nucleoside at position +13 is a 2′-fluoro-RNA nucleoside, and / or the nucleoside at position +15 is a 2′-fluoro-RNA nucleoside, and / or the nucleoside at position +17 is a 2′-fluoro-RNA nucleoside, and / or the nucleoside at position +19 is a 2′-fluoro-RNA nucleoside, and / or the nucleoside at position +21 is a 2′-fluoro-RNA nucleoside, and / or the nucleoside at position +23 is a 2′-fluoro-RNA nucleoside. In some embodiments, the nucleoside at each of positions +3, +5, +7, +9, +11, +13, +15, +17, +19, +21, and +23 is a 2'-fluoro-RNA nucleoside.

[0234] In some embodiments, the nucleoside at one or more of positions -3, -5, -7, -9, -11, -13 and -15 is a 2'-fluoro-RNA nucleoside. In some embodiments, the nucleoside at position -3 is a 2'-fluoro-RNA nucleoside, and / or the nucleoside at position -5 is a 2'-fluoro-RNA nucleoside, and / or the nucleoside at position -7 is a 2'-fluoro-RNA nucleoside, and / or the nucleoside at position -9 is a 2'-fluoro-RNA nucleoside, and / or the nucleoside at position -11 is a 2'-fluoro-RNA nucleoside, and / or the nucleoside at position -13 is a 2'-fluoro-RNA nucleoside, and / or the nucleoside at position -15 is a 2'-fluoro-RNA nucleoside. In some embodiments, the nucleoside at each of positions -3, -5, -7, -9, -11, -13 and -15 is a 2'-fluoro-RNA nucleoside.

[0235] In some embodiments, the nucleosides at one or more of positions +2, +4, +6, +8, +10, +12, +14, +18, +20, +22, and +24 are 2'-O-methyl-RNA nucleosides. In some embodiments, the nucleoside at position +2 is a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +4 is a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +6 is a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +8 is a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +10 is a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +12 is a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +14 is a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +18 is a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +20 is a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +22 is a 2′-O-methyl-RNA nucleoside, and / or the nucleoside at position +24 is a 2′-O-methyl-RNA nucleoside. In some embodiments, the nucleoside at each of positions +2, +4, +6, +8, +10, +12, +14, +18, +20, +22, and +24 is a 2'-O-methyl-RNA nucleoside.

[0236] In some embodiments, the nucleoside at one or more of positions -2, -4, -6, -10, -12 and -14 is a 2'-O-methyl-RNA nucleoside. In some embodiments, the nucleoside at position -2 is a 2'-O-methyl-RNA nucleoside, and / or the nucleoside at position -4 is a 2'-O-methyl-RNA nucleoside, and / or the nucleoside at position -6 is a 2'-O-methyl-RNA nucleoside, and / or the nucleoside at position -10 is a 2'-O-methyl-RNA nucleoside, and / or the nucleoside at position -12 is a 2'-O-methyl-RNA nucleoside, and / or the nucleoside at position -14 is a 2'-O-methyl-RNA nucleoside. In some embodiments, the nucleoside at each of positions -2, -4, -6, -10, -12 and -14 is a 2'-O-methyl-RNA nucleoside.

[0237] In some embodiments, the nucleoside at position -8 is a 2'-O-methyl-RNA nucleoside. In some embodiments, the nucleoside at position +16 is a 2'-O-methyl-RNA nucleoside.

[0238] Sugar-modified nucleosides

[0239] In some embodiments, the oligonucleotides of the present invention comprise one or more sugar-modified nucleosides. In other words, the oligonucleotides of the present invention may comprise one or more nucleosides with modified sugar moieties, i.e., modifications of sugar moieties when compared to ribose moieties found in DNA and RNA. In particular, as described herein, the mixed polymer regions of the oligonucleotides of the present invention comprise sugar-modified nucleosides.

[0240] A number of modified nucleosides having a ribose moiety have been developed, primarily with the goal of improving certain properties of oligonucleotides, such as affinity and / or nuclease resistance.

[0241] These modifications include such modifications, wherein the ribose ring structure is modified, such as substituted with a hexose ring (HNA) or a bicyclo, which is usually a bicyclo with a diradicle bridge (biradicle bridge) between the C2 and C4 carbon atoms on the ribose ring (LNA), or usually lacks a non-connected ribose ring (such as UNA) of a key between the C2 and C3 carbon atoms. Other sugar-modified nucleosides include, for example, bicyclohexose nucleic acids (WO 2011 / 017521) or tricyclic nucleic acids (WO 2013 / 154798). Modified nucleosides also include nucleosides in which the sugar moiety is substituted with a non-sugar moiety, such as with respect to peptide nucleic acids (PNA) or morpholino nucleic acids.

[0242] Sugar modifications also include modifications by changing the substituent groups on the ribose ring to groups other than the hydrogen or 2'-OH groups naturally found in DNA and RNA nucleosides. The substituents may be introduced, for example, at the 2', 3', 4' or 5' position.

[0243] 2′ sugar-modified nucleosides

[0244] In some embodiments, the oligonucleotides of the invention comprise one or more 2' sugar modified nucleosides. A 2' sugar modified nucleoside is a nucleoside having a substituent other than -H or -OH at the 2' position (a 2' substituted nucleoside) or comprising a 2' linked diradical capable of forming a bridge between the 2' carbon and the second carbon atom in the ribose ring, such as an LNA (2'-4' diradical bridged) nucleoside.

[0245] More specifically, the development of 2' sugar modified nucleosides has attracted much attention, and many 2' substituted nucleosides have been found to have beneficial properties when incorporated into oligonucleotides. For example, 2' modified sugars can enhance the binding affinity of the oligonucleotide and / or increase the nuclease resistance of the oligonucleotide. Examples of 2' substituted modified nucleosides are '-O-alkyl-RNA, 2'-O-methyl-RNA (2'OMe), 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-RNA and 2'-F-ANA nucleosides. For further examples, see, for example, Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development 2000, 3(2), 203-213 and Deleavey and Damha, Chemistry and Biology 2012, 19, 937. Below are schematic representations of some 2' substituted modified nucleosides.

[0246]

[0247] Locked Nucleoside Nucleosides (LNA Nucleosides)

[0248] In some embodiments, the oligonucleotide comprises one or more LNA nucleosides.

[0249] "LNA nucleosides" are 2'-modified nucleosides that contain a double radical connecting the C2' and C4' of the ribose ring of the nucleoside (also called a "2'-4' bridge"), which restricts or locks the conformation of the ribose ring. These nucleosides are also referred to in the literature as bridged nucleic acids or bicyclic nucleic acids (BNA). When LNAs are incorporated into oligonucleotides for complementary RNA or DNA molecules, locking the conformation of the ribose is associated with improved hybridization affinity (duplex stabilization). This can be routinely determined by measuring the melting temperature of the oligonucleotide / complementary duplex.

[0250] Without limitation, exemplary LNA nucleosides are disclosed in the following documents: WO 99 / 014226; WO 00 / 66604; WO 98 / 039352; WO 2004 / 046160; WO 00 / 047599; WO 2007 / 134181; WO 2010 / 077578; WO 2010 / 036698; WO 2007 / 090071; WO 2009 / 006478; WO 2011 / 156202; WO 2008 / 154401; WO 2009 / 067647; WO 2008 / 150729; Morita et al., Bioorganic & Med. Chem. 12, 73-76, Seth et al. J. Org. Chem., 2010, Vol. 75(5), pp. 1569-81, Mitsuoka et al., Nucleic Acids Research, 2009, 37(4), 1225-1238 and Wan and Seth, J. Medical Chemistry, 2016, 59, 9645-9667.

[0251] By way of further non-limiting illustration, exemplary LNA nucleosides are disclosed in Scheme 1.

[0252] Scenario 1:

[0253]

[0254] Specific LNA nucleosides are β-D-oxy-LNA, 6'-methyl-β-D-oxy-LNA, such as (S)-6'-methyl-β-D-oxy-LNA (ScET), and ENA.

[0255] In some embodiments, the oligonucleotide comprises one or more LNA β-D-oxy-LNA nucleosides.

[0256] Oligonucleotide length

[0257] In some embodiments, the oligonucleotides of the invention are 30 to 61 nucleosides long. In some embodiments, the oligonucleotides are 30 to 50 nucleosides long. In some embodiments, the oligonucleotides are 35 to 45 nucleosides long.

[0258] In some embodiments, the oligonucleotide is 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleosides long. In some embodiments, the oligonucleotide is 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 nucleosides long. In some embodiments, the oligonucleotide is 40 nucleosides long.

[0259] Oligonucleotide symmetry

[0260] The term "symmetry" refers to the number of nucleosides on either side of the editing nucleoside in an oligonucleotide. In other words, the symmetry of an oligonucleotide describes the number of nucleosides at 5' of the editing nucleoside and the number of nucleosides at 3' of the editing nucleoside. The symmetry of an oligonucleotide of the present invention can be described herein using the formula "X-1-Y", where "X" is the number of nucleosides at 5' of the editing nucleoside, "1" represents the editing nucleoside, and "Y" is the number of nucleosides at 3' of the editing nucleoside. For example, an oligonucleotide with a 24-1-15 symmetry is 40 nucleosides long, with exactly 24 nucleosides at 5' of the editing nucleoside and exactly 15 nucleosides at 3' of the editing nucleoside.

[0261] In some embodiments, the oligonucleotide comprises 20 to 30 nucleosides at 5′ of the editing nucleoside. In some embodiments, the oligonucleotide comprises 22 to 29 nucleosides at 5′ of the editing nucleoside. In some embodiments, the oligonucleotide comprises 24 to 27 nucleosides at 5′ of the editing nucleoside. In some embodiments, the oligonucleotide comprises 24 nucleosides at 5′ of the editing nucleoside.

[0262] In some embodiments, the oligonucleotide comprises exactly 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleosides 5' to the editing nucleoside. In some embodiments, the oligonucleotide comprises exactly 22, 23, 24, 25, 26, 27, 28, or 29 nucleosides 5' to the editing nucleoside. In some embodiments, the oligonucleotide comprises exactly 24, 25, 26, or 27 nucleosides 5' to the editing nucleoside. In some embodiments, the oligonucleotide comprises exactly 24 nucleosides 5' to the editing nucleoside.

[0263] In some embodiments, the oligonucleotide comprises 4 to 20 nucleosides 3' to the editing nucleoside. In some embodiments, the oligonucleotide comprises 12 to 15 nucleosides 3' to the editing nucleoside. In some embodiments, the oligonucleotide comprises 15 nucleosides 3' to the editing nucleoside.

[0264] In some embodiments, the oligonucleotide comprises exactly 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleosides 3' to the editing nucleoside. In some embodiments, the oligonucleotide comprises exactly 12, 13, 14, or 15 nucleosides 3' to the editing nucleoside. In some embodiments, the oligonucleotide comprises exactly 15 nucleosides 3' to the editing nucleoside.

[0265] In some embodiments, the oligonucleotide comprises exactly 22 to 29 nucleosides 5' to the edited nucleoside and 12 to 15 nucleosides 3' to the edited nucleoside. In some embodiments, the oligonucleotide comprises 24 to 27 nucleosides 5' to the edited nucleoside and 14 or 15 nucleosides 3' to the edited nucleoside.

[0266] In some embodiments, the oligonucleotide comprises exactly 22, 23, 24, 25, 26, 27, 28, or 29 nucleosides 5' to the editing nucleoside and exactly 12, 13, 14, or 15 nucleosides 3' to the editing nucleoside. In some embodiments, the oligonucleotide comprises exactly 24, 25, 26, or 27 nucleosides 5' to the editing nucleoside and exactly 14 or 15 nucleosides 3' to the editing nucleoside.

[0267] In some embodiments, the oligonucleotide comprises 21 to 30 nucleosides at 5' of the editing nucleoside and 15 nucleosides at 3' of the editing nucleoside. In some embodiments, the oligonucleotide comprises exactly 22 to 27 nucleosides at 5' of the editing nucleoside and 15 nucleosides at 3' of the editing nucleoside. In some embodiments, the oligonucleotide comprises 24 nucleosides at 5' of the editing nucleoside and 15 nucleosides at 3' of the editing nucleoside.

[0268] In some embodiments, the oligonucleotide comprises exactly 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleosides at 5' of the editing nucleoside and exactly 15 nucleosides at 3' of the editing nucleoside. In some embodiments, the oligonucleotide comprises exactly 22, 23, 24, 25, 26, or 27 nucleosides at 5' of the editing nucleoside and exactly 15 nucleosides at 3' of the editing nucleoside. In some embodiments, the oligonucleotide comprises exactly 24 nucleosides at 5' of the editing nucleoside and exactly 15 nucleosides at 3' of the editing nucleoside.

[0269] In some embodiments, the oligonucleotide comprises exactly 25 nucleosides at 5′ of the edited nucleoside and exactly 14 nucleosides at 3′ of the edited nucleoside. In some embodiments, the oligonucleotide comprises exactly 26 nucleosides at 5′ of the edited nucleoside and exactly 13 nucleosides at 3′ of the edited nucleoside. In some embodiments, the oligonucleotide comprises exactly 27 nucleosides at 5′ of the edited nucleoside and exactly 12 nucleosides at 3′ of the edited nucleoside. In some embodiments, the oligonucleotide comprises exactly 28 nucleosides at 5′ of the edited nucleoside and exactly 11 nucleosides at 3′ of the edited nucleoside. In some embodiments, the oligonucleotide comprises exactly 29 nucleosides at 5′ of the edited nucleoside and exactly 10 nucleosides at 3′ of the edited nucleoside.

[0270] Flanking area

[0271] In some embodiments, the oligonucleotides of the present invention comprise one or more flanking regions. The term "flanking region" refers to a stretch of nucleosides in an oligonucleotide that is located at a flanking position relative to the editing nucleosides and the mixed polymer region. In other words, the flanking region is located outside both the editing region and the mixed polymer region in the oligonucleotide. In other words, the flanking region is located 5' or 3' to both the editing region and the mixed polymer region.

[0272] In some embodiments, the oligonucleotide comprises a 5′ flanking region located 5′ to the 5′ mixed-mer region. In some embodiments, the oligonucleotide comprises a 3′ flanking region located 3′ to the 3′ mixed-mer region. In some embodiments, the oligonucleotide comprises a 5′ flanking region located 5′ to the 5′ mixed-mer region and a 3′ flanking region located 3′ to the 3′ mixed-mer region.

[0273] In some embodiments, the 5' flanking region is positioned at 5' in close proximity to the 5' mixed polymer region. In other words, there is no additional nucleoside between the 3'-most nucleoside of the 5' flanking region and the 5'-most nucleoside of the 5' mixed polymer region; the 3'-most nucleoside of the 5' flanking region and the 5'-most nucleoside of the 5' mixed polymer region are connected by an internucleoside bond. In some embodiments, the 3' flanking region is positioned at 3' in close proximity to the 3' mixed polymer region. In other words, there is no additional nucleoside between the 5'-most nucleoside of the 3' flanking region and the 3'-most nucleoside of the 3' mixed polymer region; the 5'-most nucleoside of the 3' flanking region and the 3'-most nucleoside of the 3' mixed polymer region are connected by an internucleoside bond. In some embodiments, the 5' flanking region is positioned at 5' in close proximity to the 5' mixed polymer region and the 3' flanking region is positioned at 3' in close proximity to the 3' mixed polymer region.

[0274] In some embodiments, the oligonucleotide comprises the following structure:

[0275] X +2 -X +1 -X 0 -X -1 -X -2

[0276] in

[0277] X +2 is the 5′ flanking region,

[0278] X +1 is the 5′ mixed polymer region,

[0279] X 0 is the editing area,

[0280] X -1 is the 3′ mixed-mer region, and

[0281] X -2 is the 3′ flanking region.

[0282] In other words, in some embodiments, the 5' flanking region is immediately adjacent to the 5' position of the 5' mixed-mer region, which is immediately adjacent to the 5' position of the editing nucleoside, which is immediately adjacent to the 5' position of the 3' mixed-mer region, which is immediately adjacent to the 5' position of the 3' flanking region. Thus, the 5' flanking region, the 5' mixed-mer region, the editing region, the 3' mixed-mer region, and the 3' flanking region are contiguous (i.e., connected by internucleoside bonds).

[0283] In some embodiments, the 5' wing region is 1, 2, 3, 4, or 5 nucleosides long. In some embodiments, the 5' wing region is 5 nucleosides long. In some embodiments, the 3' wing region is 1, 2, 3, 4, or 5 nucleosides long. In some embodiments, the 3' wing region is 5 nucleosides long. In some embodiments, both the 5' wing region and the 3' wing region are each 5 nucleosides long.

[0284] In some embodiments, the flanking region is the end of an oligonucleotide. In some embodiments, the 5' flanking region is the 5' end of an oligonucleotide. In other words, in some embodiments, the most 5' end nucleoside of an oligonucleotide is the 5' flanking region. In some embodiments, the 3' flanking region is the 3' end of an oligonucleotide. In other words, in some embodiments, the most 3' end nucleoside of an oligonucleotide is the 3' flanking region. In some embodiments, the 5' flanking region consists of 1, 2, 3, 4 or 5 nucleosides at the 5' end of an oligonucleotide. In some embodiments, the 5' flanking region consists of 5 nucleosides at the 5' end of an oligonucleotide. In some embodiments, the 3' flanking region consists of 1, 2, 3, 4 or 5 nucleosides at the 3' end of an oligonucleotide. In some embodiments, the 3' flanking region consists of 5 nucleosides at the 3' end of an oligonucleotide.

[0285] In some embodiments, the 5' wing region comprises one or more sugar-modified nucleosides. In some embodiments, the 3' wing region comprises one or more sugar-modified nucleosides. In some embodiments, each of the 5' wing region and the 3' wing region comprises one or more sugar-modified nucleosides. In some embodiments, the one or more sugar-modified nucleosides in the 5' wing region or the 3' wing region are independently selected from the group consisting of 2'-O-methyl-RNA, 2'-fluoro-RNA, 2'-O-methoxyethyl-RNA (MOE-RNA) and LNA nucleosides.

[0286] In some embodiments, all nucleosides in the 5' wing region are sugar-modified nucleosides. In some embodiments, all nucleosides in the 3' wing region are sugar-modified nucleosides. In some embodiments, all nucleosides in both the 5' wing region and the 3' wing region are sugar-modified nucleosides. In some embodiments, all nucleosides in the 5' wing region are 2'-O-methyl-RNA nucleosides. In some embodiments, all nucleosides in the 3' wing region are 2'-O-methyl-RNA nucleosides. In some embodiments, all nucleosides in both the 5' wing region and the 3' wing region are 2'-O-methyl-RNA nucleosides.

[0287] In some embodiments, the 5' flanking region consists of five 2'-O-methyl-RNA nucleosides. In some embodiments, the 3' flanking region consists of five 2'-O-methyl-RNA nucleosides. In some embodiments, the 5' flanking region consists of five 2'-O-methyl-RNA nucleosides and the 3' flanking region consists of five 2'-O-methyl-RNA nucleosides.

[0288] In some embodiments, the 5' wing region consists of five 2'-O-methyl-RNA nucleosides at the 5' end of the oligonucleotide. In some embodiments, the 3' wing region consists of five 2'-O-methyl-RNA nucleosides at the 3' end of the oligonucleotide. In some embodiments, the 5' wing region consists of five 2'-O-methyl-RNA nucleosides at the 5' end of the oligonucleotide, and the 3' wing region consists of five 2'-O-methyl-RNA nucleosides at the 3' end of the oligonucleotide.

[0289] In some embodiments, the 5' flanking region comprises nucleosides at positions +20 to +24 (i.e., positions +20, +21, +22, +23, and +24). In some embodiments, the nucleosides at positions +20 to +24 are 2'-O-methyl-RNA nucleosides. In some embodiments, the 3' flanking region comprises nucleosides at positions -11 to -15 (i.e., positions -11, -12, -13, -14, and -15). In some embodiments, the nucleosides at positions -11 to -15 are 2'-O-methyl-RNA nucleosides.

[0290] Modified internucleoside bonds

[0291] In some embodiments, oligonucleotides of the invention may comprise one or more modified internucleoside linkages.

[0292] As is generally understood by those skilled in the art, the term "modified internucleoside linkage" is defined as a linkage other than a phosphodiester (PO) linkage that can covalently link two nucleosides together.

[0293] In some embodiments, all internucleoside linkages in an oligonucleotide are modified internucleoside linkages.

[0294] In some embodiments, each modified internucleoside bond is independently selected from the group consisting of: phosphorothioate internucleoside bonds and dithiophosphate internucleoside bonds. In some embodiments, the oligonucleotide comprises one or more thiophosphate internucleoside bonds. In some embodiments, all internucleoside bonds of the oligonucleotide are thiophosphate internucleoside bonds.

[0295] Phosphorothioate internucleoside bonds and phosphorodithioate internucleoside bonds are useful because they can make oligonucleotides more resistant to degradation by nucleases. In a phosphorothioate internucleoside bond, one of the oxygen atoms in the phosphate group that is not bonded to the carbon of the nucleoside sugar moiety is replaced with a sulfur atom relative to a naturally occurring phosphodiester internucleoside bond. In a phosphorodithioate internucleoside bond, each oxygen atom in the two oxygen atoms in the phosphate group that is not bonded to the carbon of the nucleoside sugar moiety is replaced with a sulfur atom. Therefore, in the case where a phosphodiester bond can be represented by the formula -OP(O)2-O-, a phosphorothioate internucleoside bond can be represented by the formula -OP(O,S)-O-, and a phosphorodithioate internucleoside bond can be represented by the formula -OP(S)2-O-.

[0296] Phosphorothioate internucleoside bonds are chiral (see, e.g., Jahns et al. 2022 Nucleic Acids Research Vol. 50, No. 3, 1221-1240), with right-handed (Rp) and left-handed (Sp) isomers. The Rp diastereomer may be referred to as an R-PS internucleoside bond or an srP internucleoside bond. The Sp diastereomer may be referred to as an S-PS internucleoside bond or an ssP internucleoside bond. In some embodiments, the oligonucleotide comprises one or more srP internucleoside bonds. In some embodiments, the oligonucleotide comprises one or more ssP internucleoside bonds. When the chirality of the phosphorothioate internucleoside bond is not specified, the phosphorothioate internucleoside bond may be an srP bond or an ssP bond. The structures of srP and ssP bonds are shown below:

[0297]

[0298] Specific types of internucleoside bonds between specific nucleosides can increase the editing efficiency of oligonucleotides.

[0299] In some embodiments, the internucleoside bond between the nucleosides at positions +1 and 0 is a phosphodiester internucleoside bond. In some embodiments, the internucleoside bond between the nucleosides at positions +1 and 0 is a phosphodiester internucleoside bond, and all other internucleoside bonds are phosphorothioate internucleoside bonds.

[0300] In some embodiments, the internucleoside bond between the nucleosides at positions 0 and -1 is a phosphodiester internucleoside bond. In some embodiments, the internucleoside bond between the nucleosides at positions 0 and -1 is a phosphodiester internucleoside bond, and all other internucleoside bonds are phosphorothioate internucleoside bonds.

[0301] In some embodiments, the internucleoside linkage between the nucleosides at positions -1 and -2 is a phosphorothioate internucleoside linkage.

[0302] In some embodiments, the internucleoside bond between the nucleosides at positions -2 and -3 is a phosphodiester internucleoside bond. In some embodiments, the internucleoside bond between the nucleosides at positions -2 and -3 is a phosphodiester internucleoside bond, and all other internucleoside bonds are phosphorothioate internucleoside bonds.

[0303] In some embodiments, all internucleoside linkages in an oligonucleotide are phosphorothioate internucleoside linkages, except for the following:

[0304] the internucleoside bond between the nucleosides at positions +1 and 0 is a phosphodiester internucleoside bond; and / or

[0305] the internucleoside linkage between the nucleosides at positions 0 and -1 is a phosphodiester internucleoside linkage; and / or

[0306] The internucleoside linkage between the nucleosides at positions -2 and -3 is a phosphodiester internucleoside linkage.

[0307] Complementarity

[0308] In some embodiments, the oligonucleotides of the present invention are complementary to the target nucleic acid. In some embodiments, the oligonucleotides of the present invention comprise or consist of a sequence complementary to the target nucleic acid. In some embodiments, the target nucleic acid is SERPINA1 mRNA. Therefore, in some embodiments, the oligonucleotides of the present invention are complementary to SERPINA1 mRNA. In some embodiments, the oligonucleotides of the present invention comprise or consist of a sequence complementary to SERPINA1 mRNA.

[0309] The term "complementarity" describes the Watson-Crick base pairing ability of nucleosides / nucleotides. Watson-Crick base pairs are cytosine-guanine (CG) and adenine-thymine / uracil (AT / U). It should be understood that oligonucleotides may include nucleosides with modified nucleobases. For example, 5-methylcytosine (E) can be used to replace cytosine, and 7-deaza-8-azaguanine (F) can be used to replace guanine. The term complementarity encompasses Watson-Crick base pairing between unmodified and modified nucleobases (see, e.g., Hirao et al., 2012, Accounts of Chemical Research, 45, 2055 and Bergstrom, 2009, Curr. Protoc. Nucleic Acid Chem., 37, 1.4.1). In particular, Watson-Crick base pairing encompasses EG, CF and EF base pairs. Therefore, the oligonucleotide complementary to the target nucleic acid forms a base pair with the target nucleic acid, thereby binding to the target nucleic acid. The oligonucleotide complementary to SERPINA1 mRNA forms a base pair with SERPINA1 mRNA, thereby binding to SERPINA1 mRNA.

[0310] "Complementarity" does not require that the oligonucleotide is complementary to the target nucleic acid across the entire length of the target nucleic acid. Oligonucleotides are typically shorter than target nucleic acids. In contrast, "complementarity" refers to the ratio of nucleobases / nucleotides of the oligonucleotide that forms base pairs with the target nucleic acid. In some embodiments, the oligonucleotide is complementary to a portion of the target nucleic acid. In other words, the oligonucleotide is complementary to a sequence in the target nucleic acid. In some embodiments, the oligonucleotide is complementary to a portion of the target nucleic acid around the target adenosine. In some embodiments, the oligonucleotide is complementary to a portion of the SERPINA1 mRNA. In other words, the oligonucleotide is complementary to a sequence in the SERPINA1 mRNA. In some embodiments, the oligonucleotide is complementary to a portion of the SERPINA1 mRNA around the target adenosine.

[0311] As described herein, A1AD is associated with a single base pair substitution resulting in a mutation of glutamic acid (E) 342 to lysine (K) in A1AT (E342K mutation). Thus, in some embodiments, the oligonucleotide is complementary to a portion of the SERPINA1 mRNA surrounding the mutant AAG codon encoding lysine. In other words, in some embodiments, the oligonucleotide is complementary to a portion of the SERPINA1 mRNA surrounding the target adenosine, which is the first nucleoside of the mutant AAG codon encoding lysine.

[0312] "Complementarity" does not require that the oligonucleotide be complementary to a continuous sequence within the target nucleic acid. There may be a mismatch between the oligonucleotide and the target nucleic acid. Therefore, the complementarity between the oligonucleotide of the present invention and the target nucleic acid can be expressed as a percentage. In addition, it should be understood that the target adenosine on the target nucleic acid and the editing nucleoside on the oligonucleotide do not form a base pair. In other words, the target adenosine and the editing nucleoside form a mismatch.

[0313] Thus, in some embodiments, the sequence of an oligonucleotide of the invention comprises or consists of a sequence having at least 80% complementarity to a sequence in a target nucleic acid, wherein any match or mismatch between the editing nucleoside and the target adenosine is not included when determining the percent complementarity. In some embodiments, the sequence of an oligonucleotide of the invention comprises or consists of a sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% complementarity to a sequence in a target nucleic acid, wherein any match or mismatch between the editing nucleoside and the target adenosine is not included when determining the percent complementarity.

[0314] In some embodiments, the sequence of the oligonucleotide of the invention comprises or consists of a sequence having at least 80% complementarity to a sequence in SERPINA1 mRNA, wherein any match or mismatch between the editing nucleoside and the target adenosine is not included when determining the percentage of complementarity. In some embodiments, the sequence of the oligonucleotide of the invention comprises or consists of a sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% complementarity to a sequence in SERPINA1 mRNA, wherein any match or mismatch between the editing nucleoside and the target adenosine is not included when determining the percentage of complementarity.

[0315] As used herein, the term "complementary %" refers to the ratio (in percentage) of nucleotides that are complementary to the sequences in the oligonucleotide of the present invention and the target nucleic acid (such as SERPINA1mRNA), excluding any base pairing (or lack of base pairing) between the editing nucleoside and the target adenosine. In other words, when determining the complementarity percentage, any match or mismatch between the editing nucleoside and the target adenosine is not included. The percentage of complementarity is therefore calculated by the following: calculate the number of aligned nucleobases that are complementary (i.e., forming Watson-Crick base pairs) between the two sequences other than the editing nucleoside and the target adenosine, divide the number by the total number of nucleotides in the oligonucleotide (except the editing nucleoside), and multiply by 100. In such comparisons, the nucleobase / nucleotide that is not aligned (forming base pairs) is called a mismatch. Insertions and deletions are not allowed in the calculation of the % complementarity of continuous nucleotide sequences. It will be appreciated that chemical modifications of the nucleobases are not considered when determining complementarity as long as the function of the nucleobases to form Watson-Crick base pairing is retained (e.g., 5′-methylcytosine is considered the same as cytosine, and 7-deaza-8-azaguanine is considered the same as guanine for purposes of calculating % complementarity).

[0316] The term "complementary" (such as in the phrase "oligonucleotide is complementary to a sequence in SERPINA1 mRNA") does not require 100% complementarity. On the contrary, in the present invention, the term "complementary" requires that the oligonucleotide is at least 75% complementary to the target nucleic acid. In some embodiments, the term "complementary" requires that the oligonucleotide is at least 75% complementary to the SERPINA1 mRNA. In some embodiments, the oligonucleotide is at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% complementary or 100% complementary to the target nucleic acid. In some embodiments, the oligonucleotide is at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% complementary, or 100% complementary to SERPINA1 mRNA.

[0317] The term "fully complementary" refers to 100% complementarity. In some embodiments, the oligonucleotide is fully complementary to a sequence in a target nucleic acid. In other words, each nucleobase in the oligonucleotide, except the nucleobase of the editing nucleoside, forms a base pair with a nucleobase of the target nucleic acid. In some embodiments, the oligonucleotide is fully complementary to a sequence in SERPINA1 mRNA. In other words, each nucleobase in the oligonucleotide, except the nucleobase of the editing nucleoside, forms a base pair with a nucleobase of SERPINA1 mRNA.

[0318] In some embodiments, the oligonucleotides of the invention are complementary to any one of the SERPINA1 mRNA transcripts listed herein in Table 2. In some embodiments, the oligonucleotides of the invention are complementary to SEQ ID NO 186 (SERPINA1 mRNA transcript variant 11 (NM_001127707.2) comprising an E342K mutation).

[0319] The editing oligonucleotide compounds exemplified herein bind to SEQ ID NO 186 at positions 986 to 1062. Thus, in some embodiments, the sequence of the oligonucleotide of the invention comprises or consists of a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementarity to the sequence within positions 986 to 1062 of SEQ ID NO 186, wherein any match or mismatch between the editing nucleoside and the target adenosine is not included when determining the percentage of complementarity. Positions 986 to 1062 of SEQ ID NO 186 are represented below as SEQ ID NO 187. The AAG codon encoding K342 is underlined and the target adenosine is shown in bold. The target adenosine is A39 of SEQ ID NO 187.

[0320]

[0321] In some embodiments, the sequence of the oligonucleotide of the invention comprises or consists of a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% complementary to SEQ ID NO 187, wherein any matches or mismatches between the editing nucleoside and the target adenosine are not included when determining the percentage of complementarity. The oligonucleotide can form complementary base pairs with any stretch of nucleosides within the sequence of SEQ ID NO 187.

[0322] sequence

[0323] As used herein, the term "sequence" refers to the order of nucleobases in a nucleic acid (such as an oligonucleotide). When used to refer to an oligonucleotide or oligonucleotide conjugate of the present invention, the term "sequence" does not limit the form of the sugar moiety of the nucleic acid and does not limit the form of the internucleoside bond of the nucleic acid. Therefore, a given sequence of an oligonucleotide or oligonucleotide conjugate may include any type of nucleoside sugar moiety (e.g., RNA, DNA, LNA, 2'-O-methyl-RNA, MOE-RNA, as described herein) in any combination, and may include any type of internucleoside bond (e.g., phosphodiester, phosphorothioate, phosphorodithioate, as described herein). Each reference to SEQ ID NO herein refers to the sequence represented by the SEQ ID NO. Unless otherwise indicated, all sequences herein are presented in a 5' to 3' direction, as is conventional in the art.

[0324] In some embodiments of the oligonucleotides of the invention, the sequence of the oligonucleotide comprises a sequence from:

[0325] CUCUAAAAACAUGGCCCCAGCAGCUUCAGUCCCUUUC TCI UCGAUGGUCAGCACAGCCUUAUGCACGGCCUUGGUGU (SEQ ID NO87), or 30 to 61 consecutive nucleosides from a variant of SEQ ID NO87 or consisting thereof, the variant comprising exactly 1, exactly 2 or exactly 3 single nucleoside substitutions, wherein I is inosine, and wherein the oligonucleotide comprises positions 38, 39 and 40 of SEQ ID NO87. Positions 38, 39 and 40 of SEQ ID NO87 (underlined above) are editing triplets. Position 39 of SEQ ID NO87 is an editing triplet. The sequence of an oligonucleotide "comprising positions 38, 39 and 40" means that the sequence must contain nucleosides corresponding to these positions. For example, a sequence containing only the following nucleosides: nucleosides corresponding to 5' to position 38 (e.g., positions 1 to 37) or 3' to position 40 (e.g., positions 41 to 61) is not allowed. However, it is not required that the nucleosides at positions 38, 39 and 40 have the sequence TCI. The nucleosides at these positions can be substituted with nucleosides of different types (within a limit of exactly 3 nucleoside substitutions across the entire sequence); but there must be nucleosides corresponding to these positions in the sequence.

[0326] In some embodiments, the sequence of the oligonucleotide comprises or consists of 30 to 50 consecutive nucleosides from SEQ ID NO 87 or a variant thereof. In some embodiments, the sequence comprises or consists of 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 consecutive nucleosides from SEQ ID NO 87 or a variant thereof. In some embodiments, the sequence comprises or consists of 35, 36, 37, 38, 39, 40, 41, 42, 43, 44 or 45 consecutive nucleosides from SEQ ID NO 87 or a variant thereof. In some embodiments, the sequence comprises or consists of 40 consecutive nucleosides from SEQ ID NO 87 or a variant thereof.

[0327] In some embodiments, variants of SEQ ID NO 87 comprise exactly 1 single nucleoside substitution. In some embodiments, variants of SEQ ID NO 87 comprise nucleoside substitutions at positions 38, 39 and / or 40 of SEQ ID NO 87. In some embodiments, variants of SEQ ID NO 87 comprise nucleoside substitutions at position 39 of SEQ ID NO 87.

[0328] Sequences of Exemplary Compounds

[0329] In some embodiments, the sequence of the oligonucleotide of the invention comprises a sequence having at least 80% identity to any one of SEQ ID NOs 1 to 86 (as shown in Table 3 in Example 1 herein). In some embodiments, the sequence of the oligonucleotide comprises a sequence having at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity to any one of SEQ ID NOs 1 to 86. In some embodiments, the sequence of the oligonucleotide comprises the sequence of any one of SEQ ID NOs 1 to 86.

[0330] In some embodiments, the sequence of an oligonucleotide of the invention consists of a sequence having at least 80% identity to any one of SEQ ID NOs 1 to 86. In some embodiments, the sequence of an oligonucleotide consists of a sequence having at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity to any one of SEQ ID NOs 1 to 86. In some embodiments, the sequence of an oligonucleotide consists of the sequence of any one of SEQ ID NOs 1 to 86.

[0331] In some embodiments, the sequence of the oligonucleotide of the invention comprises the same as SEQ ID NO 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 8, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, and 86. In some embodiments, the sequence of the oligonucleotide comprises a sequence that is at least 80% identical to any one of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58 , 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, and 86 have a sequence that is at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, or 100% identical. In some embodiments, the sequence of the oligonucleotide comprises SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46 , 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85 and 86.

[0332] In some embodiments, the sequence of the oligonucleotide of the invention consists of SEQ ID NO 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48 , 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, and 86. In some embodiments, the sequence of the oligonucleotide consists of a sequence that is at least 80% identical to any one of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, and 86 have a sequence that is at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, or 100% identical. In some embodiments, the sequence of the oligonucleotide consists of SEQ ID NO1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46 , 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85 and 86.

[0333] In some embodiments, the sequence of the oligonucleotide of the invention comprises a sequence that is at least 80% identical to any one of SEQ ID NOs: 3, 7, 8, 9, 10, 19, 20, 21, 22, 23, 26, 29, 30, 31, 32, 33, 34, 35, 36, 41, 42, 43, 45, 60, 61, 62, and 63. In some embodiments, the sequence of the oligonucleotide comprises a sequence having at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity to any one of SEQ ID NOs 3, 7, 8, 9, 10, 19, 20, 21, 22, 23, 26, 29, 30, 31, 32, 33, 34, 35, 36, 41, 42, 43, 45, 60, 61, 62, and 63. In some embodiments, the sequence of the oligonucleotide comprises a sequence having at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity to any one of SEQ ID NOs 2, 3, 7, 8, 9, 10, 19, 20, 21, 22, 23, 26, 29, 30, 31, 32, 33, 34, 35, 36, 41, 42, 43, 45, 60, 61, 62, and 63.

[0334] In some embodiments, the sequence of the oligonucleotide of the invention consists of a sequence that is at least 80% identical to any one of SEQ ID NOs 3, 7, 8, 9, 10, 19, 20, 21, 22, 23, 26, 29, 30, 31, 32, 33, 34, 35, 36, 41, 42, 43, 45, 60, 61, 62, and 63. In some embodiments, the sequence of the oligonucleotide consists of a sequence that is at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, or 100% identical to any one of SEQ ID NOs 3, 7, 8, 9, 10, 19, 20, 21, 22, 23, 26, 29, 30, 31, 32, 33, 34, 35, 36, 41, 42, 43, 45, 60, 61, 62, and 63. In some embodiments, the sequence of the oligonucleotide consists of the sequence of any one of SEQ ID NOs 3, 7, 8, 9, 10, 19, 20, 21, 22, 23, 26, 29, 30, 31, 32, 33, 34, 35, 36, 41, 42, 43, 45, 60, 61, 62, and 63.

[0335] In some embodiments, the sequence of an oligonucleotide of the invention comprises a sequence having at least 80% identity to any one of SEQ ID NOs 3, 7, 8, 9, 19, 20, 21, 22, 29, 30, 31, 32, 33, 34, 42, 43, 62, and 63. In some embodiments, the sequence of an oligonucleotide comprises a sequence having at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity to any one of SEQ ID NOs 3, 7, 8, 9, 19, 20, 21, 22, 29, 30, 31, 32, 33, 34, 42, 43, 62, and 63. In some embodiments, the sequence of the oligonucleotide comprises the sequence of any one of SEQ ID NOs 3, 7, 8, 9, 19, 20, 21, 22, 29, 30, 31, 32, 33, 34, 42, 43, 62, and 63.

[0336] In some embodiments, the sequence of the oligonucleotide of the invention consists of a sequence having at least 80% identity to any one of SEQ ID NOs 3, 7, 8, 9, 19, 20, 21, 22, 29, 30, 31, 32, 33, 34, 42, 43, 62, and 63. In some embodiments, the sequence of the oligonucleotide consists of a sequence having at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity to any one of SEQ ID NOs 3, 7, 8, 9, 19, 20, 21, 22, 29, 30, 31, 32, 33, 34, 42, 43, 62, and 63. In some embodiments, the sequence of the oligonucleotide consists of the sequence of any one of SEQ ID NOs 3, 7, 8, 9, 19, 20, 21, 22, 29, 30, 31, 32, 33, 34, 42, 43, 62, and 63.

[0337] In some embodiments, the sequence of an oligonucleotide of the invention comprises a sequence having at least 80% identity to SEQ ID NO 32. In some embodiments, the sequence of an oligonucleotide comprises a sequence having at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity to SEQ ID NO 32. In some embodiments, the sequence of an oligonucleotide comprises the sequence of SEQ ID NO 32. In some embodiments, the sequence of an oligonucleotide consists of a sequence having at least 80% identity to SEQ ID NO 32. In some embodiments, the sequence of an oligonucleotide consists of a sequence having at least 85% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity to SEQ ID NO 32. In some embodiments, the sequence of an oligonucleotide consists of the sequence of SEQ ID NO 32.

[0338] Identity

[0339] As used herein, the term "identity" refers to the proportion (expressed as a percentage) of nucleotides in a nucleic acid molecule (e.g., an oligonucleotide, such as an oligonucleotide of the invention) that are identical across a nucleotide sequence when compared to a reference sequence. In the context of determining sequence identity, a nucleotide sequence compared to a reference sequence may be referred to herein as a "query sequence."

[0340] In order to determine sequence identity, sequence comparison can be performed by any method known in the art. Suitably, sequence comparison can be performed by the naked eye, or more generally, by means of readily available sequence comparison programs. These open and commercially available computer programs can calculate the sequence identity between two or more sequences.

[0341] Sequence identity can be calculated over contiguous sequences by aligning one sequence to the other and directly comparing each nucleotide in one sequence to the corresponding nucleotide in the other sequence, one nucleotide at a time. This is called a "non-gap" alignment. Typically, such non-gap alignments are performed only over a relatively short number of nucleotides (e.g., less than 50 contiguous nucleotides).

[0342] Although this is a very simple and consistent approach, it does not take into account that, for example, an insertion or deletion in an otherwise identical pair of sequences will cause subsequent nucleotides to not align, which can result in a large reduction in the percent identity when a global alignment is performed. Therefore, most sequence comparison methods aim to produce an optimal alignment that takes into account possible insertions and deletions without unduly compromising overall identity. This is achieved by inserting "gaps" in the sequence alignment in an attempt to maximize local identity.

[0343] In some embodiments, the present invention relates to the comparison of the sequence alignment of the present invention. For example, the comparison of the sequence alignment of the present invention is carried out by using the method of the present invention. However, these more complicated methods assign "gap penalty" to each gap occurring in the comparison, so that for the same number of identical nucleotides, the sequence alignment with as few gaps as possible (reflecting the higher correlation between the two comparison sequences) will obtain a higher score than the score with many gaps. Usually "affine gap cost" is used, which charges a relatively high cost to the existence of the gap, and charges a smaller penalty to each subsequent nucleotide in the gap. This is the most commonly used gap scoring system. High gap penalty will certainly produce an optimized comparison with less gaps. Most comparison programs allow modification of gap penalty. However, when using this type of software to carry out sequence comparison, it is preferred to use default values.

[0344] Therefore, calculating the maximum percentage sequence identity first requires producing the best alignment, taking into account gap penalties. A suitable computer program for performing such an alignment is the GCG Wisconsin Bestfit software package (University of Wisconsin, USA; Devereux et al. 1984 Nucleic Acids Research 12: 387). Examples of other software that can perform sequence comparisons include, but are not limited to, the BLAST software package (see Ausubel et al. 1999 supra-Chapter 18), FASTA (Atschul et al. 1990, J. Mol. Biol., 403-410) and the GENEWORKS comparison tool suite. Both BLAST and FASTA can be used for offline and online searches (see Ausubel et al. 1999 supra, pp. 7-58 to 7-60). However, it is preferred to use the GCG Bestfit program.

[0345] Suitably, sequence identity may be determined across the entire sequence.Suitably, sequence identity may be determined across the entire query sequence compared to the reference sequence.

[0346] Although the final sequence identity can be measured according to identity, the alignment process itself is usually not based on an all-or-nothing pairwise comparison. On the contrary, a scaled similarity scoring matrix is ​​usually used to assign scores to each paired comparison based on chemical similarity or evolutionary distance. An example of such a matrix commonly used is the BLOSUM62 matrix (the default matrix for the BLAST program suite). The GCG Wisconsin program usually uses public default values ​​or a custom symbol comparison table (if provided) (for more details, see the user manual). Preferably, the public default values ​​for the GCG software package are used, or a default matrix, such as BLOSUM62, is used in the case of other software.

[0347] Once the software has produced an optimal alignment, the percent sequence identity can be calculated. The software typically does this as part of the sequence comparison and generates a numerical result.

[0348] In some embodiments, the percentage of identity is calculated by counting the number of aligned nucleobases that are identical (matched) between the query sequence and the reference sequence, dividing that number by the total number of nucleotides in the reference sequence, and multiplying by 100. Thus, percentage of identity = (matches x 100) / length of reference sequence).

[0349] Thus, in embodiments in which an oligonucleotide of the invention or a sequence of an oligonucleotide of the invention is stated as having at least some identity with another sequence, the oligonucleotide of the invention or a sequence of an oligonucleotide of the invention is a query sequence, and the other sequence is a reference sequence. In embodiments in which an oligonucleotide of the invention or a sequence of an oligonucleotide of the invention is stated as having at least some identity with a SEQ ID NO (i.e., a sequence indicated by a SEQ ID NO), the oligonucleotide of the invention or a sequence of an oligonucleotide of the invention is a query sequence, and the SEQ ID NO is a reference sequence.

[0350] For example, where an oligonucleotide of the invention has at least 80% identity to SEQ ID NO 32, the oligonucleotide of the invention is the query sequence and SEQ ID NO 32 (i.e., the sequence indicated by SEQ ID NO) is the reference sequence. Where the sequence of an oligonucleotide of the invention has at least 80% identity to SEQ ID NO 32, the sequence of an oligonucleotide of the invention is the query sequence and SEQ ID NO 32 is the reference sequence.

[0351] Suitably, insertions and deletions may not be allowed when calculating the percentage of identity of a nucleotide sequence. It should be understood that chemical modifications of the nucleobases may not be considered when determining identity as long as the function of the nucleobases to form Watson-Crick base pairing is retained (e.g., for the purpose of calculating % identity, 5-methylcytosine is considered to be identical to cytosine, and 7-deaza-8-azaguanine is considered to be identical to guanine).

[0352] Compound

[0353] The term "compound" is used herein to refer to the combination of sequence (i.e., the order of core bases), sugar moiety, and internucleoside bond in the oligonucleotide of the present invention. For a given compound, the type of core base, sugar moiety, and internucleoside bond of each nucleotide are all specified. Therefore, the order of sugar moiety and internucleoside bond is also specified in a given compound. However, unless otherwise indicated, the compound may include other elements except the specified sequence, sugar moiety, and internucleoside bond.

[0354] In some embodiments, the term "oligonucleotide" is interchangeable with the term "compound." In other words, in some embodiments, an oligonucleotide of the invention is a compound of the invention, and vice versa.

[0355] A compound identification number (CMP ID NO) of the form X_Y is used herein to refer to a specific compound, where X and Y are each a number. For each CMP ID NO, X is the number of the SEQ ID NO corresponding to the sequence of the compound. For example, a compound designated as CMP ID NO 2_1 has the same nucleobase sequence as SEQ ID NO 2.

[0356] The structures of the compounds referred to herein are presented in Table 4 of Example 1 herein using HELM strings. Another section of this article explains how to read the HELM string. For the sake of brevity, the HELM string is no longer written out herein, but it is understood that each reference to a CMPID NO herein refers to the compound represented by the HELM string of that CMP ID NO, as shown in Table 4. The CMP ID NO and the HELM string corresponding to that CMP ID NO in Table 4 are interchangeable.

[0357] In some embodiments, the oligonucleotides of the invention comprise any of the following: CMP ID NO 1_1、2_1、3_1、3_2、3_3、4_1、5_1、6_1、7_1、8_1、9_1、10_1、11_1、12_1、13_1、14_1、15_1、16_1、17_1、18_1、19_1、20_1、21_1、22_1、23_1、24_1、25_1、26_1、26_2、26_3、26_4、26_5、26_6、26_7、26_8、26_9、27_1、28_1、29_1、30_1、31_1、32_1、32_2、32_3、32_4、32_5、32_6、32_7、32_8、32_9、3 2_10, 32_11, 32_12, 32_13, 32_14, 32_15, 32_16, 32_17, 32_18, 32_19, 32_20, 32_21, 32_22, 32_23, 32_24, 32_25, 32_26, 32_27, 32_28, 32_29, 32_30, 32_31, 32_32, 32_33, 32_34, 32_35, 32_36, 32_37, 32_38, 32_39, 32_40, 32_41, 32_42, 32_43, 32_44, 32_45, 32_46, 32_47, 32_48, 32_49, 32_50 2_50、32_51、32_52、32_53、32_54、32_55、32_56、32_57、32_58、32_59、32_60、32_61、32_62、32_63、32_64、32_65、32_66、32_67、32_68、32_69、32_70、32_71、32_72、32_73、32_74、32_75、32_76、32_77、32_78、32_79、32_80、32_81、32_82、32_83、33_1、34_1、35_1、36_1、37_1、38_1、39_1、40 _1, 40_2, 40_3, 40_4, 40_5, 40_6, 40_7, 40_8, 40_9, 40_10, 41_1, 41_2, 41_3, 41_4, 41_5, 41_6, 41_7, 41_8, 41_9, 41_10, 42_1, 42_2, 42_3, 42_4, 42_5, 42_6, 43_1, 43_2, 43_3, 44_1, 45_1, 46_1, 47_1, 47_2, 48_1, 49_1, 50_1, 51_1, 52_1, 53_1, 54_1, 55_1, 56_1, 57_1, 58_1, 59_1, 60_1, 61_1,62_1, 63_1, 64_1, 65_1, 66_1, 67_1, 68_1, 69_1, 70_1, 71_1, 72_1, 73_1, 74_1, 75_1, 76_1, 77_1, 78_1, 79_1, 80_1, 81_1, 82_1, 83_1, 84_1, 85_1, and 86_1. In some embodiments, the antisense oligonucleotide consists of any of the following: CMP ID NO 1_1、2_1、3_1、3_2、3_3、4_1、5_1、6_1、7_1、8_1、9_1、10_1、11_1、12_1、13_1、14_1、15_1、16_1、17_1、18_1、19_1、20_1、21_1、22_1、23_1、24_1、25_1、26_1、26_2、26_3、26_4、26_5、26_6、26_7、26_8、26_9、27_1、28_1、29_1、30_1、31_1、32_1、32_2、32_3、3 2_4、32_5、32_6、32_7、32_8、32_9、32_10、32_11、32_12、32_13、32_14、32_15、32_16、32_17、32_18、32_19、32_20、32_21、32_22、32_23、32_24、32_25、32_26、32_27、32_28、32_29、32_30、32_31、32_32、32_33、32_34、32_35、32_36、32_37、32_38、32_39、3 2_40、32_41、32_42、32_43、32_44、32_45、32_46、32_47、32_48、32_49、32_50、32_51、32_52、32_53、32_54、32_55、32_56、32_57、32_58、32_59、32_60、32_61、32_62、32_63、32_64、32_65、32_66、32_67、32_68、32_69、32_70、32_71、32_72、32_73、32_74、3 2_75, 32_76, 32_77, 32_78, 32_79, 32_80, 32_81, 32_82, 32_83, 33_1, 34_1, 35_1, 36_1, 37_1, 38_1, 39_1, 40_1, 40_2, 40_3, 40 _4, 40_5, 40_6, 40_7, 40_8, 40_9, 40_1_O, 41_1, 41_2, 41_3, 41_4, 41_5, 41_6, 41_7, 41_8, 41_9, 41_10, 42_1, 42_2, 42_3, 42_4,42_5、42_6、43_1、43_2、43_3、44_1、45_1、46_1、47_1、47_2、48_1、49_1、50_1、5_1_1、52_1、53_1、54_1、55_1、56_1、57_1、58_1、59_1、60_1、61_1、62 _1, 63_1, 64_1, 65_1, 66_1, 67_1, 68_1, 69_1, 70_1, 71_1, 72_1, 73_1, 74_1, 75_1, 76_1, 77_1, 78_1, 79_1, 80_1, 81_1, 82_1, 83_1, 84_1, 85_1 and 86_1.

[0358] In some embodiments, the oligonucleotide of the invention comprises any of the following: CMP ID NO 3_3, 7_1, 8_1, 9_1, 10_1, 19_1, 20_1, 21_1, 22_1, 23_1, 26_8, 29_1, 30_1, 31_1, 32_1, 32_2, 32_4, 32_5, 32_6, 32_7, 32_8, 32_9, 32_10, 32_11, 32_12, 32_13, 32_14, 32_16, 32_17, 32_18, 32_19, 32_20, 32_21, 32_22, 32_23, 32_29, 32_33, 32_34, 32_47, 32_48, 32_49, 32_50, 32_51, 32_52, 32_53, 32_54, 32_55, 32_56, 32_57, 32_58, 32_59, 32_60, 32_61, 32_62, 32_63, 32_64, 32_65, 33_1, 34_1, 35_1, 36_1, 41_8, 42_6, 43_1, 43_3, 45_1, 60_1, 61_1, 62_1, and 63_1. In some embodiments, the oligonucleotide of the invention consists of any one of: CMP ID NO 3_3、7_1、8_1、9_1、10_1、19_1、20_1、21_1、22_1、23_1、26_8、29_1、30_1、31_1、32_1、32_2、32_4、32_5、32_6、32_7、32_8、32_9、32_10、32_11、32_12、32_13、32_14、32_16、32_17、32_18、32_19、32_20、32_21、32_22、32_23、32_2 9, 32_33, 32_34, 32_47, 32_48, 32_49, 32_50, 32_5_1, 32_52, 32_53, 32_54, 32_55, 32_56, 32_57, 32_58, 32_60, 32_61, 32_62, 32_63, 32_64, 32_65, 33_1, 34_1, 35_1, 36_1, 41_8, 42_6, 43_1, 43_3, 45_1, 60_1, 61_1, 62_1 and 63_1.

[0359] In some embodiments, the oligonucleotide of the invention comprises any of the following: CMP ID NO7_1, 8_1, 9_1, 19_1, 20_1, 21_1, 22_1, 29_1, 30_1, 31_1, 19_1, 32_1, 32_4, 32_5, 32_6, 32_7, 32_8, 32_9, 32_10, 32_11, 32_12, 32_13, 32_14, 32_16, 32_17, 32_18, 32_19, 32_20, 32_21, 32_22, 32_23, 32_33, 32_47, 32_48, 32_49, 32_50, 32_51, 32_52, 32_53, 32_54, 32_55, 32_56, 32_57, 32_58, 32_60, 32_61, 32_62, 32_63, 32_64, 32_65, 33_1, 34_1, 42_6, 43_1, 62_1, and 63_1. In some embodiments, the oligonucleotide of the invention consists of any one of: CMP ID NO 7_1、8_1、9_1、19_1、20_1、21_1、22_1、29_1、30_1、31_1、19_1、32_1、32_4、32_5、32_6、32_7、32_8、32_9、32_10、32_11、32_12、32_13、32_14、32_16、32_17、32_18、32_19、32_20、32_21、3 2_22, 32_23, 32_33, 32_47, 32_48, 32_49, 32_50, 32_51, 32_52, 32_53, 32_54, 32_55, 32_56, 32_57, 32_58, 32_60, 32_61, 32_62, 32_63, 32_64, 32_65, 33_1, 34_1, 42_6, 43_1, 62_1 and 63_1.

[0360] In some embodiments, the oligonucleotides of the invention comprise any of the following: CMP ID NO 32_1、32_2、32_3、32_4、32_5、32_6、32_7、32_8、32_9、32_10、32_11、32_12、32_13、32_14、32_15、32_16、32_17、32_18、32_19、32_20、32_21、32_22、32_23、32_24、32_25、32_26、32_27、32_28、32_29、32_30、32_31、32_32、32_33、32_34、32_35、32_36、32_37、32_38、32_39、32_40、32_41、32_42、3 2_43、32_44、32_45、32_46、32_47、32_48、32_49、32_50、32_51、32_52、32_53、32_54、32_55、32_56、32_57、32_58、32_59、32_60、32_61、32_62、32_ 63, 32_64, 32_65, 32_66, 32_67, 32_68, 32_69, 32_70, 32_71, 32_72, 32_73, 32_74, 32_75, 32_76, 32_77, 32_78, 32_79, 32_80, 32_81, 32_82 and 32_83.In some embodiments, the oligonucleotides of the invention consist of any of the following: CMP ID NO 32_1、32_2、32_3、32_4、32_5、32_6、32_7、32_8、32_9、32_10、32_11、32_12、32_13、32_14、32_15、32_16、32_17、32_18、32_19、32_20、32_21、32_22、32_23、32_24、32_25、32_26、32_27、32_28、32_29、32_30、32_31、32_32、32_33、32_34、32_35、32_36、32_37、32_38、32_39、32_40、32_41、32_42、3 2_43、32_44、32_45、32_46、32_47、32_48、32_49、32_50、32_51、32_52、32_53、32_54、32_55、32_56、32_57、32_58、32_59、32_60、32_61、32_62、32_ 63, 32_64, 32_65, 32_66, 32_67, 32_68, 32_69, 32_70, 32_71, 32_72, 32_73, 32_74, 32_75, 32_76, 32_77, 32_78, 32_79, 32_80, 32_81, 32_82 and 32_83.

[0361] In some embodiments, the oligonucleotide of the invention comprises any one of the following: CMP ID NO 32_1, 32_4, 32_5, 32_6, 32_7, 32_8, 32_9, 32_10, 32_11, 32_12, 32_13, 32_14, 32_16, 32_17, 32_18, 32_19, 32_20, 32_21, 32_22, 32_23, 32_33, 32_47, 32_48, 32_49, 32_50, 32_51, 32_52, 32_53, 32_54, 32_55, 32_56, 32_57, 32_58, 32_60, 32_61, 32_62, 32_63, 32_64, and 32_65. In some embodiments, the oligonucleotide of the invention consists of any one of the following: CMP ID NO 32_1, 32_4, 32_5, 32_6, 32_7, 32_8, 32_9, 32_10, 32_11, 32_12, 32_13, 32_14, 32_16, 32_17, 32_18, 32_19, 32_20, 32_21, 32_22, 32_23, 32_33, 32_47, 32_48, 32_49, 32_50, 32_51, 32_52, 32_53, 32_54, 32_55, 32_56, 32_57, 32_58, 32_60, 32_61, 32_62, 32_63, 32_64, and 32_65.

[0362] In some embodiments, the oligonucleotide of the invention comprises CMP ID NO 32_1. In some embodiments, the oligonucleotide of the invention consists of CMP ID NO 32_1. In some embodiments, the oligonucleotide of the invention is CMP ID NO 32_1. In some embodiments, the oligonucleotide of the invention is Fig.29 The compounds depicted in .

[0363] Conjugate

[0364] The present invention provides an oligonucleotide conjugate comprising an oligonucleotide of the present invention covalently attached to at least one conjugate moiety. In other words, the present invention provides an oligonucleotide covalently attached to at least one conjugate moiety.

[0365] The term "oligonucleotide conjugate" is used interchangeably herein with the terms "conjugate" and "conjugate of the invention". The term "conjugate moiety" refers to a non-nucleotide portion that can be covalently attached to an oligonucleotide of the invention. Thus, as used herein, the term "conjugate" refers to an oligonucleotide of the invention covalently attached to a non-nucleotide portion (conjugate moiety).

[0366] Oligonucleotide conjugates and their synthesis have been reported in Manoharan in Antisense Drug Technology, Principles, Strategies, and Applications, ST Crooke, ed., Chapter 16, Marcel Dekker, Inc., 2001 and in a comprehensive review by Manoharan, Antisense and Nucleic Acid Drug Development, 2002, 12, 103.

[0367] The term "conjugate" may be used herein to refer to a combination of a sequence (i.e., the order of nucleobases), a sugar moiety, an internucleoside bond, and a conjugate moiety in a given oligonucleotide conjugate of the present invention. For a given conjugate, the nucleobases in the oligonucleotide of the conjugate, the type of sugar moiety, and the internucleoside bond of each nucleotide are specified. Therefore, the order of sugar moieties and internucleoside bonds is also specified in a given conjugate. However, unless otherwise indicated, a conjugate may contain other elements in addition to the specified sequence, sugar moiety, internucleoside bond, and conjugate moiety.

[0368] A conjugate identification number (CNJ ID NO) of the form X_Y_Z is used herein to refer to a specific conjugate, wherein X, Y, and Z are each a number. For each CNJ ID NO, X_Y is the CMP ID NO of the oligonucleotide compound of the conjugate (recall that X is the SEQ ID NO of the nucleobase sequence of the compound). For example, the conjugate designated as CNJ ID NO 126_2_1 contains an oligonucleotide compound CMP ID NO 126_2 having a nucleobase sequence of SEQ ID NO 126.

[0369] In some embodiments, at least one conjugate moiety is covalently attached to the 5' end of the oligonucleotide. In some embodiments, at least one conjugate moiety is covalently attached to the 3' end of the oligonucleotide.

[0370] Conjugate part

[0371] In some embodiments, the conjugate moiety (i.e., the non-nucleotide moiety) is selected from the group consisting of a carbohydrate (e.g., GalNAc), a cell surface receptor ligand, a drug substance, a hormone, a lipophilic substance, a polymer, a protein, a peptide, a toxin (e.g., a bacterial toxin), a vitamin, a viral protein (e.g., a capsid), or a combination thereof.

[0372] In some embodiments, the conjugate moiety is capable of binding to an asialoglycoprotein receptor, such as human asialoglycoprotein receptor (ASGPR). For example, the conjugate moiety may comprise at least one asialoglycoprotein receptor targeting moiety selected from the group consisting of galactose, galactosamine, N-formyl-galactosamine, N-acetylgalactosamine, N-propionyl-galactosamine, N-n-butyryl-galactosamine, and N-isobutyrylgalactosamine.

[0373] In some embodiments, the asialoglycoprotein receptor targeting moiety is N-acetylgalactosamine (GalNAc). In some embodiments, the conjugate moiety is an N-acetylgalactosamine (GalNAc) conjugate moiety. Thus, the oligonucleotides of the invention can be conjugated to at least one conjugate moiety comprising at least one N-acetylgalactosamine (GalNAc) moiety, such as conjugated to at least one conjugate moiety comprising at least one N-acetylgalactosamine (GalNAc) moiety as described below.

[0374] In some embodiments, the conjugate moiety is at least divalent (such as divalent, trivalent or tetravalent) GalNAc. In a preferred embodiment, the conjugate moiety is trivalent GalNAc. The trivalent N-acetylgalactosamine conjugate moiety is suitable for binding to ASGPR, see, for example, WO 2014 / 076196, WO 2014 / 207232 and WO 2014 / 179620. Such conjugate moieties are used to enhance the uptake of oligonucleotides by the liver. As used herein, the term "trivalent GalNAc" refers to a residue comprising three N-acetylgalactosamine moieties, i.e., preferably three moieties of the following formula:

[0375]

[0376] In some embodiments, the GalNAc conjugate moiety is aminohexyl-conjugated tris(N-acetyl-galactosamine), as depicted below.

[0377]

[0378] The trivalent N-acetylgalactosamine (GalNAc) shown above is also referred to herein as "5gn2c6".

[0379] “Aminohexyl conjugated tri(N-acetyl-galactosamine)” may also be referred to as “-hexylidene-NH-tri(N-acetyl-galactosamine)”.

[0380] In some embodiments, the conjugate moiety is covalently attached to the oligonucleotide via a phosphodiester bond. In some embodiments, the conjugate moiety is covalently attached to the linker via a phosphodiester bond.

[0381] Connectors

[0382] In some embodiments of the oligonucleotide conjugates of the present invention, the conjugate moiety is covalently attached to the oligonucleotide via a linker. Thus, in some embodiments, the conjugate comprises a linker. In some embodiments, the conjugate comprises a linker positioned between the oligonucleotide and the conjugate moiety.

[0383] In some embodiments of the oligonucleotide conjugates of the invention, the conjugate moiety is covalently attached to the oligonucleotide via a linker nucleoside sequence.

[0384] In certain embodiments, the joint nucleoside sequence comprises or is composed of: 1 to 10 connected nucleosides, such as 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 connected nucleosides, such as 2 and 6 connected nucleosides, such as 2 and 5 connected nucleosides, such as 2 and 4 connected nucleosides. In certain embodiments, the length of the joint nucleoside sequence is 2 nucleosides. In certain embodiments, the joint comprises two connected nucleosides. In certain embodiments, the joint consists of two connected nucleosides.

[0385] In certain embodiments, the joint nucleoside sequence comprises DNA nucleosides. In certain embodiments, the joint nucleoside sequence consists of DNA nucleosides. In other words, in certain embodiments, all nucleosides in the joint nucleoside sequence are DNA nucleosides.

[0386] In some embodiments, the nucleosides of the linker nucleoside sequence are connected via a phosphodiester internucleoside bond. In some embodiments, the linker is connected to the oligonucleotide via a phosphodiester internucleoside bond. In some embodiments, the linker is connected to the conjugate portion via a phosphodiester bond.

[0387] As used herein, the terms "phosphodiester internucleoside linkage" and "phosphodiester bond" refer to the same chemical structure known in the art, in which a first chemical entity is linked to a second chemical entity via an intermediate phosphate group. The term "phosphodiester internucleoside linkage" is particularly used in the case where the first and second chemical entities that are linked are nucleosides, such as nucleosides of the oligonucleotides of the present invention. As known in the art, phosphodiester internucleoside linkages are naturally occurring internucleosides in nucleic acids such as genomic DNA. The term "phosphodiester bond" is particularly used in the context of the present invention to refer to the covalent attachment of a conjugate moiety to an oligonucleotide of the present invention or to a linker (such as a nucleoside linker sequence), because the conjugate moiety is not a nucleoside, so the term "phosphodiester internucleoside linkage" is not appropriate.

[0388] In some embodiments, the linker comprises or consists of a DNA dinucleotide having a sequence selected from the group consisting of AA, AT, AC, AG, TA, TT, TC, TG, CA, CT, CC, CG, GA, GT, GC, or GG, wherein there is a phosphodiester bond between the two DNA nucleosides and at least one additional phosphodiester at the 5' or 3' end of the dinucleotide to which the oligonucleotide is attached or to which the conjugate moiety is attached. For example, the linker can be a CA dinucleotide. In some embodiments, the linker comprises or consists of a DNA trinucleotide of the sequence AAA, AAT, AAC, AAG, ATA, ATT, ATC, ATG, ACA, ACT, ACC, ACG, AGA, AGT, AGC, AGG, TAA, TAT, TAC, TAG, TTA, TTT, TTC, TAG, TCA, TCT, TCC, TCG, TGA, TGT, TGC, TGG, CAA, CAT, CAC, CAG, CTA, CTG, CTC, CTT, CCA, CCT, CCC, CCG, CGA, CGT, CGC, CGG, GAA, GAT, GAC, CAG, GTA, GTT, GTC, GTG, GCA, GCT, GCC, GCG, GGA, GGT, GGC, or GGG wherein there are phosphodiester bonds between the DNA nucleosides and there may be additional phosphodiester bonds at the 5′ or 3′ end of the trinucleotide.

[0389] In some embodiments, the linker nucleoside sequence is CA. In other words, in some embodiments, the sequence of the linker nucleoside sequence is CA. In some embodiments, the linker nucleotide sequence is 5′-CA-3′. In some embodiments, the linker nucleoside sequence is a dinucleotide CA, wherein the C nucleoside is linked to the conjugate portion via a phosphodiester bond, the C nucleoside is linked to the A nucleoside via a phosphodiester internucleoside bond, and the A nucleoside is linked to the 5′ nucleoside of the antisense oligonucleotide of the present invention via a phosphodiester internucleoside bond.

[0390] In some embodiments, the joint is a bio-cleavable joint. The bio-cleavable joint comprises or is composed of a physiologically unstable bond, which is cleavable under conditions normally encountered or similar to those encountered in mammals. The conditions under which the physiologically unstable joint undergoes chemical transformation (e.g., cleavage) include chemical conditions, such as pH, temperature, oxidation or reduction conditions or agents, and salt concentrations found in mammalian cells or similar to those encountered in mammalian cells. Conditions in mammalian cells also include the presence of enzyme activities (such as from proteolytic enzymes or hydrolytic enzymes or nucleases) that are usually present in mammalian cells. In one embodiment, the bio-cleavable joint is susceptible to S1 nuclease cleavage. In some embodiments, the nuclease-sensitive joint comprises 1 to 5 nucleosides, such as one or more DNA nucleosides comprising at least two continuous phosphodiester bonds. The bio-cleavable joint containing phosphodiester is described in more detail in WO 2014 / 076195 (incorporated herein by reference). When compared to a standard, in a conjugate with a biocleavable linker, at least about 50% of the conjugate portion is cleaved from the oligonucleotide, such as at least about 60% is cleaved, such as at least about 70% is cleaved, such as at least about 80% is cleaved, such as at least about 85% is cleaved, such as at least about 90% is cleaved, such as at least about 95% of the conjugate portion is cleaved from the cleaved oligonucleotide.

[0391] Medicinal salt

[0392] In some embodiments, the oligonucleotide or oligonucleotide conjugate of the present invention is in the form of a pharmaceutically acceptable salt. In some embodiments, the oligonucleotide is in the form of a pharmaceutically acceptable salt. In some embodiments, the oligonucleotide conjugate is in the form of a pharmaceutically acceptable salt.

[0393] As used herein, the term "salt" is consistent with its commonly known meaning, ie, an ionic assembly of an anion and a cation.

[0394] The term "pharmaceutical salt" refers to a salt that retains biological effectiveness and the properties of a free alkali or free acid, which is not biologically or otherwise undesirable. The salt is formed with an inorganic acid, such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, particularly hydrochloric acid, and with an organic acid, such as acetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzylformic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, salicylic acid, N-acetylcysteine. In addition, these salts can be prepared by adding an inorganic base or an organic base to the free acid. The salt derived from an inorganic base includes but is not limited to sodium salts, potassium salts, lithium salts, ammonium salts, calcium salts, magnesium salts. Salts derived from organic bases include, but are not limited to, salts of primary, secondary and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines and basic ion exchange resins such as isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, lysine, arginine, N-ethylpiperidine, piperidine, polyamine resins. The compounds of the present invention may also exist in the form of zwitterions. Particularly preferred pharmaceutically acceptable salts of the oligonucleotides or oligonucleotide conjugates of the present invention are salts of hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid and methanesulfonic acid.

[0395] In some embodiments, the pharmaceutically acceptable salt is a sodium salt or a potassium salt. In some embodiments, the oligonucleotides or oligonucleotide conjugates of the present invention are in the form of a sodium salt. In some embodiments, the oligonucleotides of the present invention are in the form of a sodium salt. In some embodiments, the oligonucleotide conjugates of the present invention are in the form of a sodium salt. In some embodiments, the oligonucleotides of the present invention or oligonucleotide conjugates are in the form of a potassium salt. In some embodiments, the oligonucleotides of the present invention are in the form of a potassium salt. In some embodiments, the oligonucleotide conjugates of the present invention are in the form of a potassium salt.

[0396] Delivery of antisense oligonucleotides

[0397] In some embodiments, the oligonucleotide or oligonucleotide conjugate of the invention is encapsulated in a lipid-based delivery vehicle, covalently linked to or encapsulated in a dendrimer, or conjugated to an aptamer. This may be to deliver the oligonucleotide of the invention to a target cell and / or to improve the pharmacokinetics of the oligonucleotide. Examples of lipid-based delivery vehicles include oil-in-water emulsions, micelles, liposomes, and lipid nanoparticles.

[0398] In some embodiments, the oligonucleotide is encapsulated in a lipid-based delivery vehicle. In some embodiments, the oligonucleotide is covalently linked to a dendrimer. In some embodiments, the oligonucleotide is encapsulated in a dendrimer. In some embodiments, the oligonucleotide is conjugated to an aptamer.

[0399] In some embodiments, the oligonucleotide conjugate is encapsulated in a lipid-based delivery vehicle. In some embodiments, the oligonucleotide conjugate is covalently attached to a dendrimer. In some embodiments, the oligonucleotide conjugate is encapsulated in a dendrimer. In some embodiments, the oligonucleotide conjugate is conjugated to an aptamer.

[0400] Pharmaceutical composition

[0401] The present invention provides a pharmaceutical composition comprising an oligonucleotide or oligonucleotide conjugate of the present invention and a medicinal diluent, solvent, carrier, salt and / or adjuvant. In some embodiments, the pharmaceutical composition comprises an aqueous diluent or solvent. In some embodiments, the aqueous diluent or solvent is phosphate buffered saline. In some embodiments, the aqueous diluent or solvent is sterile.

[0402] The present invention provides a pharmaceutical composition comprising an oligonucleotide of the present invention and a pharmaceutically acceptable salt. In some embodiments, the salt comprises a metal cation. In some embodiments, the pharmaceutically acceptable salt is selected from the group consisting of sodium salts, potassium salts and ammonium salts.

[0403] The present invention also provides a pharmaceutical solution of the oligonucleotide of the present invention or its conjugate, wherein the pharmaceutical solution comprises the oligonucleotide of the present invention or its conjugate, and a pharmaceutically acceptable solvent, such as saline.

[0404] The invention also provides an oligonucleotide of the invention or a conjugate thereof in the form of a solid powder, such as in the form of a lyophilized powder.

[0405] Methods for editing target nucleic acids

[0406] The present invention provides an in vitro method for editing a target nucleic acid in a target cell, the method comprising administering an effective amount of the oligonucleotide or oligonucleotide conjugate of the present invention or the pharmaceutical composition of the present invention to the target cell.

[0407] The present invention also provides an in vivo method for editing a target nucleic acid in a target cell, the method comprising administering an effective amount of the oligonucleotide or oligonucleotide conjugate of the present invention or the pharmaceutical composition of the present invention to the target cell.

[0408] The target nucleic acid comprises a target adenosine. The oligonucleotide or oligonucleotide conjugate binds to the target nucleic acid through complementary base pairing. The oligonucleotide or oligonucleotide conjugate recruits ADAR to the target nucleic acid. In some embodiments, ADAR is ADAR1 or ADAR2. In some embodiments of the method of the present invention, the target adenosine (A) is converted to inosine (I).

[0409] In some embodiments of the methods of the present invention, the target nucleic acid is RNA. In some embodiments, the target nucleic acid is RNA. In some embodiments, the target nucleic acid encodes a protein. In some embodiments, the target nucleic acid is mRNA. In some embodiments, the target nucleic acid encodes alpha-1 antitrypsin (A1AT). In some embodiments, the target nucleic acid is SERPINA1mRNA.

[0410] In some embodiments of the methods of the present invention, the oligonucleotide or oligonucleotide conjugate is capable of achieving conversion of the AAA codon encoding lysine on the target nucleic acid to the IAA codon encoding glutamate. In some embodiments of the methods of the present invention, the oligonucleotide or oligonucleotide conjugate is capable of achieving conversion of the AAG codon encoding lysine on the target nucleic acid to the 1AG codon encoding glutamate.

[0411] In some embodiments of the methods of the invention, the target adenosine corresponds to A1024 of SEQ ID NO 186. In some embodiments, the target nucleic acid comprises or consists of a sequence according to SEQ ID NO 186.

[0412] In some embodiments of the methods of the invention, the target cell is a mammalian cell. In some embodiments, the target cell is a human cell. In some embodiments of the method, the target cell is a lung cell or a liver cell.

[0413] In some embodiments of the methods of the present invention, the amount of the edited target nucleic acid is increased by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% compared to the control. In some embodiments, the control is a cell that has not been exposed to an oligonucleotide or oligonucleotide conjugate. The amount of the edited target nucleic acid can be determined by techniques known in the art. For example, PCR can be used to amplify the target nucleic acid, and then the ratio of the edited target nucleic acid can be determined by sequencing. Examples of methods for determining the amount of edited target nucleic acids are described in the following documents: Example 3 herein; Merkle et al. 2019 Nature Biotechnology, Vol 37, 133-138; and Qu et al. 2019 Nature Biotechnology, Vol 37, 1059-1069.

[0414] Treatment, prevention and medical applications

[0415] The present invention provides a method for treating or preventing a disease, which comprises administering a therapeutically or preventively effective amount of the oligonucleotide or oligonucleotide conjugate of the present invention or the pharmaceutical composition of the present invention to a subject suffering from or susceptible to the disease.

[0416] The present invention provides an oligonucleotide or oligonucleotide conjugate of the present invention or a pharmaceutical composition of the present invention for use in treating or preventing a disease in a subject. The present invention provides an oligonucleotide of the present invention, an oligonucleotide conjugate of the present invention or a pharmaceutical composition of the present invention for use as a medicament. The present invention provides an oligonucleotide of the present invention, an oligonucleotide conjugate of the present invention or a pharmaceutical composition of the present invention for use in therapy.

[0417] The present invention provides the use of the oligonucleotide or oligonucleotide conjugate of the present invention or the pharmaceutical composition of the present invention for preparing a drug for treating or preventing a disease in a subject. The present invention provides the oligonucleotide of the present invention, the oligonucleotide conjugate of the present invention or the pharmaceutical composition of the present invention for preparing a drug.

[0418] As used herein, the terms "treating", "treatment" and "treats" refer to treating an existing disease (e.g., a disease or disorder mentioned herein), or preventing or treating a disease, i.e., prevention. It should therefore be appreciated that in some embodiments, the treatments referred to herein may be preventive. Prevention may be understood as prevention of A1AD.

[0419] In the present context, the term "preventing, prevention or prevents" relates to prophylactic treatment, i.e. measures or procedures whose purpose is to prevent rather than cure a disease. Prevention means obtaining a desired pharmacological and / or physiological effect which is preventive in terms of completely or partially preventing a disease or its symptoms.

[0420] As used herein, the term "disease" refers to a state of dysfunction of the body. The term disease is used herein synonymously with similar terms such as "disorder" or "illness."

[0421] Many diseases are associated with mutations. It will be appreciated by those skilled in the art that the oligonucleotides provided herein promote the correction of G to A mutations and can be used to treat many such diseases associated with mutations, particularly G to A mutations. In some embodiments, the disease is associated with the mutation of a G nucleotide (i.e., guanosine) to an A nucleotide (i.e., adenosine). In some embodiments, the disease is caused by the mutation of a G nucleotide to an A nucleotide. In some embodiments, the disease is caused by the mutation of a G nucleotide to an A nucleotide in the subject's genome.

[0422] Alpha-1 antitrypsin deficiency (A1AD)

[0423] In some embodiments of the method of the invention, the oligonucleotide used, the oligonucleotide conjugate used or the pharmaceutical composition used, or the use of the invention for treating or preventing a disease, the disease is a disease associated with a mutation in the SERPINA1 gene.

[0424] Alpha-1 antitrypsin (A1AT) deficiency (A1AD) is a disease associated with mutations in the SERPINA1 gene. SERPINA1 encodes A1AT, a serine protease inhibitor synthesized in the liver that is released to other tissues to protect them from endogenous inflammatory serine proteases (such as neutrophil elastase). Subjects suffering from A1AD express reduced levels of A1AT, which can lead to excessive breakdown of elastin in the lungs and thereby reduce lung elasticity and related health problems, such as emphysema. Accumulation of misfolded A1AT in the liver may also lead to liver-related problems such as cirrhosis and jaundice.

[0425] In some embodiments of the method of the invention, the oligonucleotide used, the oligonucleotide conjugate used or the pharmaceutical composition used, or the use of the invention for treating or preventing a disease, the disease is alpha 1 antitrypsin deficiency (A1AD).

[0426] Therefore, the present invention provides a method for treating or preventing A1AD, which comprises administering a therapeutically or prophylactically effective amount of the oligonucleotide or oligonucleotide conjugate of the present invention or the pharmaceutical composition of the present invention to a subject suffering from or susceptible to A1AD.

[0427] The present invention provides an oligonucleotide or oligonucleotide conjugate of the present invention or a pharmaceutical composition of the present invention for use in treating or preventing A1AD in a subject.

[0428] The present invention provides use of the oligonucleotide or oligonucleotide conjugate of the present invention or the pharmaceutical composition of the present invention for preparing a medicament for treating or preventing A1AD in a subject.

[0429] As used herein, "preventing A1AD" includes preventing A1AD from occurring in a subject, as well as preventing symptoms of A1AD from occurring in a subject.

[0430] In some embodiments, treating or preventing comprises treating or preventing one or more symptoms of A1AD selected from liver damage, liver failure, cirrhosis, jaundice, elastin breakdown in the lungs, emphysema, and chronic obstructive pulmonary disease (COPD).

[0431] Subjects

[0432] For the purposes of the present invention, a "subject" or "patient" may be a vertebrate. In the context of the present invention, the term "subject" includes both humans and other animals, particularly mammals, as well as other organisms. Therefore, the means and methods provided herein are suitable for both human therapy and veterinary applications. Accordingly, the subject herein may be an animal, such as a mouse, rat, hamster, rabbit, guinea pig, ferret, cat, dog, chicken, sheep, bovine species, horse, camel or primate. Preferably, the subject is a mammal. More preferably, the subject is a human. In some embodiments, the subject suffers from a disease as mentioned herein, such as A1AD. In some embodiments, the subject is susceptible to the disease.

[0433] Sequence Listing

[0434] The sequence listing filed with this application is hereby incorporated by reference. In the event of any inconsistency between the sequence listing and the specification or figures, the information disclosed in the specification (including the figures) shall be deemed correct.

[0435] Each reference to a SEQ ID NO herein refers to the sequence represented by that SEQ ID NO. Each reference to a CMP ID NO herein refers to the compound represented by that CMP ID NO. Each reference to a CNJ ID NO herein refers to the conjugate represented by that CNJ ID NO.

[0436] HELM symbol

[0437] Oligonucleotides of the invention (compounds) and oligonucleotide conjugates of the invention (conjugates) are depicted herein using the Hierarchical Editing Language for Macromolecules (HELM) notation.

[0438] HELM is a notation format designed for depicting the structures of macromolecules. Full details of the HELM notation can be found at www.pistoiaalliance.org / helm-tools / , in Zhang et al. J. Chem. Inf. Model. 2012, 52, 2796-2806 (which originally described the HELM notation) and in Milton et al. J. Chem Inf. Model. 2017, 57, 1233-1239 (which describes the HELM 2.0 version).

[0439] In short, macromolecules are depicted as "HELM strings" that are divided into parts. The first part of the HELM string lists the molecules contained in the macromolecule. The second part lists the connections between molecules within the macromolecule. The third, fourth, and fifth parts (which can be used in HELM strings for more complex macromolecules) are not used in HELM strings herein. One or more currency symbols $ mark the end of a part of the HELM string.

[0440] The compounds of the invention are represented by a HELM string consisting of a single first portion defining an oligonucleotide.

[0441] The conjugates of the invention are represented by a HELM string consisting of two parts: a first part defining the oligonucleotide (which may include a nucleotide linker sequence) and the conjugate part; and a second part defining the connection between the oligonucleotide and the conjugate part.

[0442] Each molecule listed in the first part of the HELM string is given an identifier (e.g., "RNA1" for nucleic acids, "PEPTIDE1" for amino acid sequences, "CHEM1" for chemical structures), and the structure of the molecule is defined by the symbols in curly brackets {} immediately following the identifier. "RNA1" is an identifier for the oligonucleotide portion of the compound or conjugate; the oligonucleotide is defined in curly brackets {} after the first instance of "RNA1"; the second instance of "RNA1" in each conjugate string defines the location of the connection between the oligonucleotide and the conjugate portion. "CHEM1" is an identifier for the conjugate portion of the conjugate; the conjugate portion is defined in curly brackets {} after the first instance of "CHEM1"; the second instance of "CHEM1" in each conjugate string defines the location of the connection between the oligonucleotide and the conjugate portion. "V2.0" indicates that HELM version 2.0 is used.

[0443] The HELM symbols for the structure of each molecule in the curly brackets {} in the first part of the HELM string defining the compounds and conjugates of the invention are as follows:

[0444] .Divide nucleosides,

[0445] R(A) is RNA adenine nucleoside,

[0446] R(C) is RNA cytosine nucleoside,

[0447] R(G) is RNA guanosine nucleoside,

[0448] R([In]) is RNA inosine,

[0449] R(U) is RNA uridine nucleoside,

[0450] [dR] is a DNA nucleoside lacking a nucleobase (abasic),

[0451] [dR](A) is DNA adenine nucleoside,

[0452] [dR](C) is DNA cytosine nucleoside,

[0453] [dR](G) is DNA guanosine nucleoside,

[0454] [dR]([In]) is DNA inosine,

[0455] [dR](T) is DNA thymidine nucleoside,

[0456] [dR]([2AP]) is DNA 2-aminopurine nucleoside,

[0457] [dR]([apC]) is DNA aminoethylphenoxazine nucleoside,

[0458] [dR]([5BrC]) is DNA 5-bromocytidine,

[0459] [dR]([prpC]) is DNA 5-propynylcytidine,

[0460] [dR]([PyrC]) is DNA pyrrolocytidine nucleoside,

[0461] [dR]([PPG]) is DNA 7-deaza-8-azaguanosine nucleoside,

[0462] [dR](Z) is a DNA nucleoside containing a Benner base,

[0463] [mR](A) is 2′-O-methyl RNA adenine nucleoside,

[0464] [mR](C) is 2′-O-methyl RNA cytosine nucleoside,

[0465] [mR](G) is 2′-O-methyl RNA guanosine,

[0466] [mR]([In]) is 2′-O-methyl RNA inosine,

[0467] [mR](U) is 2′-O-methyl RNA uridine nucleoside,

[0468] [fR](A) is 2′-fluoro RNA adenine nucleoside,

[0469] [fR](C) is 2′-fluoro RNA cytidine,

[0470] [fR](G) is 2′-fluoro RNA guanosine,

[0471] [fR]([In]) is 2′-fluoro RNA inosine,

[0472] [fR](U) is 2′-fluoro RNA uridine nucleoside,

[0473] [FANA] (A) is FANA adenine nucleoside,

[0474] [FANA](G) is FANA guanosine nucleoside,

[0475] [FANA](C) is FANA cytosine nucleoside,

[0476] [LR] (A) is β-D-oxy-LNA adenine nucleoside,

[0477] [LR](G) is β-D-oxy-LNA guanosine,

[0478] [LR]([5meC]) is β-D-oxy-LNA 5-methylcytidine nucleoside,

[0479] [MOE] is a 2′-MOE RNA nucleoside lacking a nucleobase (abasic),

[0480] [MOE](A) is 2′-MOE RNA adenine nucleoside,

[0481] [MOE](G) is 2′-MOE RNA guanosine nucleoside,

[0482] [MOE](T) is 2′-MOE RNA thymidine,

[0483] [MOE]([5meC]) is 2′-MOE RNA 5-methylcytosine nucleoside,

[0484] [idR](A) is iDNA adenine nucleoside,

[0485] [idR](C) is iDNA cytosine nucleoside,

[0486] [idR](G) is iDNA guanosine nucleoside,

[0487] [ScEt](G) is ScET guanosine,

[0488] [SNA] (A) is SNA adenine nucleoside,

[0489] [SNA](G) is SNA guanosine nucleoside,

[0490] [SNA]([5meC]) is SNA 5-methylcytosine nucleoside,

[0491] [TNA] (A) is TNA adenine nucleoside,

[0492] [TNA](G) is TNA guanosine,

[0493] [TNA]([5meC]) is TNA 5-methylcytosine nucleoside,

[0494] [P] is a phosphodiester internucleoside bond,

[0495] [sP] is a phosphorothioate internucleoside bond,

[0496] [ssP] is the left-handed stereoisomer (Sp) of the phosphorothioate internucleoside bond,

[0497] [srP] is the right-handed stereoisomer (Rp) of the phosphorothioate internucleoside linkage, and

[0498] [PS2] is a phosphorodithioate internucleoside linkage.

[0499] As mentioned above, in the context of the present invention, the second part is only used in HELM strings representing conjugates of the present invention. The second part lists the connections between the molecules listed in the first part. Each pair of connected molecules is defined by listing the identifiers of the molecules, and then defining the attachment point between them (i.e., the point where a covalent bond exists between the molecules).

[0500] In the HELM strings representing the conjugates of the invention, there is a single connection (between the conjugate moiety and the oligonucleotide). This single connection is represented in all HELM strings herein as follows:

[0501] CHEM1, RNA1, 1: R2-1: R1.

[0502] This indicates that the conjugate moiety (CHEM1) is attached to the oligonucleotide (RNA1) through a covalent bond between the R2 attachment point (indicated by "1:R2") of the first monomer of CHEM1 (which is the entire conjugate moiety) and the R1 attachment point (indicated by "1:R1") of the first monomer of RNA1.

[0503] As mentioned above, "RNA1" represents that the molecule is a nucleic acid, and curly brackets {} define the part of the HELM string involving nucleic acid molecules (oligonucleotides), "$$$$" represents the end of the molecule, and "V2.0" represents the use of HELM version 2.0. In the HELM string relating to the oligonucleotides (i.e., compounds) of the present invention, these characters are therefore unnecessary because they do not provide any further information that is not obvious from the molecule as an oligonucleotide. Therefore, the simplified form of any HELM string herein can be formed by removing RNA1, {}, $$$$$ and V2.0 from the HELM string. The HELM string simplified in this way is referred to as "simplified HELM string" in this article. The simplified HELM string refers to the molecule identical with the corresponding complete HELM string. The simplified HELM string may be a more readable way to present a HELM string.

[0504] Therefore, any HELM string related to the oligonucleotides (ie compounds) of the invention herein may alternatively be described using a simplified HELM string. In other words, a simplified HELM string for a given compound may be interchangeable with a complete HELM string for that compound.

[0505] Examples of HELM symbols

[0506] For example, CMP ID NO 32_1 is represented by the following HELM string (as depicted in Table 4):

[0507] RNAl{[mR](C)[sP].[mR](C)[sP].[mR](C)[sP].[mR](C)[sP].[mR](A)[ sP].[fR](G)[sP].[mR](C)[sP].[fR](A)[sP].[mR](G)[sP].[fR](C)[sP ].[mR](U)[sP].[fR](U)[sP].[mR](C)[sP].[fR](A)[sP].[mR](G)[sP] .[fR](U)[sP].[mR](C)[sP].[fR](C)[sP].[mR](C)[sP].[fR](U)[sP].[ mR](U)[sP].[fR](U)[sP].[mR](C)[sP].[dR](T)[sP].[dR](C)[sP].[d R]([In])[sP].[mR](U)[sP].[fR](C)[sP].[mR](G)[sP].[fR](A)[sP].[ mR](U)[sP].[fR](G)[sP].[mR](G)[sP].[fR](U)[sP].[mR](C)[sP].[m R](A)[sP].[mR](G)[sP].[mR](C)[sP].[mR](A)[sP].[mR](C)}$$$$V2.0

[0508] This HELM string consists of a single part, listing the oligonucleotide of CMP ID NO 32_1. The initial "RNA1" indicates that the molecule is a nucleic acid (oligonucleotide). The structure of the oligonucleotide is represented using HELM symbols in the curly brackets {} after RNA1. "$$$$" marks the end of this part and the end of the entire HELM string. "V2.0" means that HELM version 2.0 is used. A simplified HELM string (where RNA1, {}, $$$$$ and V2.0 are removed) referring to the same molecule is as follows:

[0509] [mR](C)[sP].[mR](C)[sP].[mR](C)[sP].[mR](C)[sP].[mR](A)[sP].[fR](G)[sP]. [mR](C)[sP].[fR](A)[sP].[mR](G)[sP].[fR](C)[sP].[mR](U)[sP].[fR](U)[sP].[ mR](C)[sP].[fR](A)[sP].[mR](G)[sP].[fR](U)[sP].[mR](C)[sP].[fR](C)[sP].[ mR](C)[sP].[fR](U)[sP].[mR](U)[sP].[fR](U)[sP].[mR](C)[sP].[dR](T)[sP].[d R](C)[sP].[dR]([In])[sP].[mR](U)[sP].[fR](C)[sP].[mR](G)[sP].[fR](A)[sP].[mR](U)[sP].[fR](G)[s P].[mR](G)[sP].[fR](U)[sP].[mR](C)[sP].[mR](A)[sP].[mR](G)[sP].[mR](C)[sP].[mR](A)[sP].[mR](C)

[0510] All publications mentioned in the above description are incorporated herein by reference. Various modifications and variations of the methods and systems described in the present invention will be apparent to those skilled in the art without departing from the scope and spirit of the present invention. Although the present invention has been described in conjunction with specific preferred embodiments, it should be understood that the claimed invention should not be overly limited to such specific embodiments. In fact, for those skilled in the art of molecular biology, biochemistry, cell biology, virology or related fields, various modifications of the described modes for implementing the present invention are apparent and are intended to fall within the scope of the following claims.

[0511] Numbered paragraphs

[0512] Specific embodiments of the invention are defined in the following numbered paragraphs.

[0513] 1. An oligonucleotide comprising

[0514] an editing region comprising an editing nucleoside,

[0515] a 5′ mixed-mer region, which is located 5′ to the editing region, and

[0516] The 3' mixed-mer region is located 3' to the editing region.

[0517] 2. An oligonucleotide comprising an editing region, wherein the editing region comprises an editing nucleoside.

[0518] 3. An oligonucleotide according to paragraph 1 or paragraph 2, wherein

[0519] The editing nucleoside is assigned position 0,

[0520] Each nucleoside 5′ to the edited nucleoside is designated as position+x, where x is the number of nucleosides 5′ to, and including, the edited nucleoside at that position, and

[0521] Each nucleoside 3' to the edited nucleoside is designated as position-y, where y is the number of nucleosides 3' to, and including, the edited nucleoside at that position.

[0522] 4. An oligonucleotide according to any one of the preceding paragraphs, wherein the oligonucleotide comprises the following structure:

[0523] X +1 -X 0 -X -1

[0524] in

[0525] X +1 is the 5′ mixed polymer region,

[0526] X 0 is the editing area, and

[0527] X -1 It is the 3′ mixed polymer region.

[0528] 5. An oligonucleotide according to any of the preceding paragraphs, wherein the 5' mixed-mer region comprises a first type of 5' mixed-mer nucleosides and a second type of 5' mixed-mer nucleosides, wherein the sugar moiety of the first type of 5' mixed-mer nucleosides is different from the sugar moiety of the second type of 5' mixed-mer nucleosides.

[0529] 6. An oligonucleotide according to any of the preceding paragraphs, wherein the 3' mixed-mer region comprises a first type of 3' mixed-mer nucleosides and a second type of 3' mixed-mer nucleosides, wherein the sugar moiety of the first type of 3' mixed-mer nucleosides is different from the sugar moiety of the second type of 3' mixed-mer nucleosides.

[0530] 7. The oligonucleotide according to any of the preceding paragraphs, wherein the 5' mixed-mer region comprises an alternating pattern of a first type of 5' mixed-mer nucleosides and a second type of 5' mixed-mer nucleosides.

[0531] 8. The oligonucleotide according to paragraph 7, wherein the 5' mixed-mer region comprises an alternating pattern of single nucleosides of a first type of 5' mixed-mer nucleosides and single nucleosides of a second type of 5' mixed-mer nucleosides.

[0532] 9. The oligonucleotide according to any of the preceding paragraphs, wherein the 3' mixed-mer region comprises an alternating pattern of a first type of 3' mixed-mer nucleosides and a second type of 3' mixed-mer nucleosides.

[0533] 10. The oligonucleotide of paragraph 9, wherein the 3' mixed-mer region comprises an alternating pattern of single nucleosides of a first type of 3' mixed-mer nucleosides and single nucleosides of a second type of 3' mixed-mer nucleosides.

[0534] 11. An oligonucleotide according to any one of the preceding paragraphs, wherein the 5' mixed-mer region comprises the following structure:

[0535] (Y 5 -Z 5 -) m

[0536] in

[0537] Y 5 is one or more nucleosides of a first type of 5' mixed polymer nucleoside,

[0538] Z 5 is one or more nucleosides of a second type of 5' mixed polymer nucleoside, and

[0539] m is a number from 1 to 20.

[0540] 12. An oligonucleotide according to any one of the preceding paragraphs, wherein the 3' mixed-mer region comprises the following structure:

[0541] (Y 3 -Z 3 -) n

[0542] in

[0543] Y 3 is one or more nucleosides of a first type of 3' mixed polymer nucleoside,

[0544] Z 3 is one or more nucleosides of a second type of 3' mixed polymer nucleoside, and

[0545] n is a number from 1 to 20.

[0546] 13. The oligonucleotide according to paragraph 12, wherein

[0547] Each Y 5independently 1, 2, 3 or 4 nucleosides, preferably 1 nucleoside;

[0548] Each Z 5 independently 1, 2, 3 or 4 nucleosides, preferably 1 nucleoside;

[0549] Each Y 3 are independently 1, 2, 3 or 4 nucleosides, preferably 1 nucleoside; and / or

[0550] Each Z 3 Independently 1, 2, 3 or 4 nucleosides, preferably 1 nucleoside.

[0551] 14. An oligonucleotide according to paragraph 12 or paragraph 13, wherein

[0552] m is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20, preferably 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15, more preferably 9; and / or

[0553] n is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20, preferably 3, 4, 5, 6, 7, 8 or 9, more preferably 4.

[0554] 15. The oligonucleotide according to any of the preceding paragraphs, wherein the 5' mixed-mer region is 15 to 25 nucleosides in length.

[0555] 16. An oligonucleotide according to any of the preceding paragraphs, wherein the 5' mixed-mer region is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleosides long, preferably 18 nucleosides long.

[0556] 17. The oligonucleotide according to any of the preceding paragraphs, wherein the 3' mixed-mer region is 4 to 12 nucleosides in length.

[0557] 18. An oligonucleotide according to any of the preceding paragraphs, wherein the 3' mixed-mer region is 4, 5, 6, 7, 8, 9, 10, 11 or 12 nucleosides long, preferably 9 nucleosides long.

[0558] 19. An oligonucleotide according to any one of paragraphs 3 to 18, wherein the 5' mixed-mer region comprises from position +1 to position +10, +11, +12, +13, +14, +15, +16, +17, +18, +19, +20, +21, +22, +23, +24 or +25, preferably from position +2 to position +10, +11, +12, +13, +14, + +15, +16, +17, +18, +19, +20, +21, +22, +23, +24 or +25, more preferably from position +2 to position +15, +16, +17, +18, +19, +20, +21, +22, +23 or +24, more preferably from position +2 to position +19, +20, +21, +22, +23 or +24.

[0559] 20. The oligonucleotide of paragraph 19, wherein the 5' mixed-mer region comprises or consists of nucleosides at positions +2 to +19.

[0560] 21. The oligonucleotide according to any of paragraphs 3 to 20, wherein the 3' mixed-mer region comprises or consists of nucleosides from position -1 to position -3, -4, -5, -6, -7, -8, -9, -10, -11, -12, -13, -14, -15, -16 or -17, preferably from position -2 to position -3, -4, -5, -6, -7, -8, -9, -10, -11, -12, -13, -14, -15, -16 or -17, more preferably from position -2 to position -5, -6, -7, -8, -9, -10, -11, -12, -13, -14, -15, -16 or -17, more preferably from position -2 to position -5, -6, -7, -8, -9 or -10.

[0561] 22. The oligonucleotide according to paragraph 21, wherein the 3' mixed-mer region comprises or consists of nucleosides at positions -2 to -10.

[0562] 23. An oligonucleotide according to any one of paragraphs 3 to 22, wherein

[0563] the 5′ mixed-mer region consists of nucleosides from position +2 to position +15, +16, +17, +18, +19, +20, +21, +22, +23 or +24, preferably from position +2 to position +17, +18, +19, +20, +21, +22, +23 or +24; and

[0564] The 3' mixed polymer region consists of nucleosides from position -2 to position -5, -6, -7, -8, -9, -10, -11, -12, -13, -14 or -15, more preferably from position -2 to position -5, -6, -7, -8, -9 or -10.

[0565] 24. The oligonucleotide according to paragraph 23, wherein

[0566] The 5' mixed-mer region consists of nucleosides at positions +2 to +19; and

[0567] The 3' mixed-mer region consists of nucleosides at positions -2 to -10.

[0568] 25. An oligonucleotide according to any one of paragraphs 5 to 24, wherein

[0569] (a) the first type of 5′ mixed polymer nucleoside is selected from the group consisting of DNA, RNA, 2′-O-methyl-RNA, 2′-O-methoxyethyl-RNA (MOE-RNA), 2′-fluoro-RNA, linker nucleic acid (LNA), arabino nucleic acid (ANA) and 2′-fluoroarabino nucleic acid (FANA) nucleosides, preferably wherein the first type of 5′ mixed polymer nucleoside is a 2′-O-methyl-RNA nucleoside or a 2′-fluoro-RNA nucleoside, more preferably a 2′-fluoro-RNA nucleoside; and / or

[0570] (b) the second type of 5′ mixed polymer nucleoside is selected from the group consisting of DNA, RNA, 2′-O-methyl-RNA, MOE-RNA, 2′-fluoro-RNA, LNA, ANA and FANA nucleosides, preferably wherein the second type of 5′ mixed polymer nucleoside is a 2′-O-methyl-RNA nucleoside or a 2′-fluoro-RNA nucleoside, more preferably a 2′-O-methyl-RNA nucleoside; and / or

[0571] (c) the first type of 3′ mixed polymer nucleoside is selected from the group consisting of DNA, RNA, 2′-O-methyl-RNA, MOE-RNA, 2′-fluoro-RNA, LNA, ANA and FANA nucleosides, preferably wherein the first type of 3′ mixed polymer nucleoside is a 2′-O-methyl-RNA nucleoside or a 2′-fluoro-RNA nucleoside, more preferably a 2′-O-methyl-RNA nucleoside; and / or

[0572] (d) The second type of 3′ mixed polymer nucleoside is selected from the group consisting of DNA, RNA, 2′-O-methyl-RNA, MOE-RNA, 2′-fluoro-RNA, LNA, ANA and FANA nucleosides, preferably wherein the second type of 3′ mixed polymer nucleoside is a 2′-O-methyl-RNA nucleoside or a 2′-fluoro-RNA nucleoside, more preferably a 2′-fluoro-RNA nucleoside.

[0573] 26. The oligonucleotide according to paragraph 25, wherein

[0574] The first type of 5' mixed polymer nucleosides are 2'-fluoro-RNA nucleosides, and / or

[0575] The second type of 5' mixed polymer nucleosides are 2'-O-methyl-RNA nucleosides, and / or

[0576] The first type of 3' mixed polymer nucleosides are 2'-fluoro-RNA nucleosides, and / or

[0577] The second type of 3' mixed polymer nucleosides are 2'-O-methyl-RNA nucleosides.

[0578] 27. The oligonucleotide according to paragraph 26, wherein

[0579] The first type of 5′ mixed polymer nucleosides are 2′-fluoro-RNA nucleosides,

[0580] The second type of 5′ mixed polymer nucleosides are 2′-O-methyl-RNA nucleosides,

[0581] The first type of 3' mixed polymer nucleosides are 2'-fluoro-RNA nucleosides, and

[0582] The second type of 3' mixed polymer nucleosides are 2'-O-methyl-RNA nucleosides.

[0583] 28. The oligonucleotide according to any of the preceding paragraphs, wherein the 5' mixed-mer region comprises or consists of 2'-fluoro-RNA nucleosides and 2'-O-methyl-RNA nucleosides.

[0584] 29. The oligonucleotide according to any of the preceding paragraphs, wherein the 5' mixed-mer region comprises or consists of alternating 2'-fluoro-RNA nucleosides and 2'-O-methyl-RNA nucleosides, preferably alternating single 2'-fluoro-RNA nucleosides and single 2'-O-methyl-RNA nucleosides.

[0585] 30. The oligonucleotide according to any of the preceding paragraphs, wherein the 3' mixed-mer region comprises or consists of 2'-fluoro-RNA nucleosides and 2'-O-methyl-RNA nucleosides.

[0586] 31. The oligonucleotide according to any of the preceding paragraphs, wherein the 3' mixed-mer region comprises or consists of alternating 2'-fluoro-RNA nucleosides and 2'-O-methyl-RNA nucleosides, preferably alternating single 2'-fluoro-RNA nucleosides and single 2'-O-methyl-RNA nucleosides.

[0587] 32. The oligonucleotide of any one of paragraphs 3 to 31, wherein each nucleoside at positions +2 to +19 is a 2'-fluoro-RNA nucleoside or a 2'-O-methyl-RNA nucleoside.

[0588] 33. The oligonucleotide according to any one of paragraphs 3 to 32, wherein each nucleoside at positions -2 to -10 is a 2'-fluoro-RNA nucleoside or a 2'-O-methyl-RNA nucleoside.

[0589] 34. The oligonucleotide of any one of paragraphs 3 to 33, wherein each nucleoside at positions +2 to +24 is a 2'-fluoro-RNA nucleoside or a 2'-O-methyl-RNA nucleoside.

[0590] 35. The oligonucleotide according to any one of paragraphs 3 to 34, wherein each nucleoside at positions -2 to -15 is a 2'-fluoro-RNA nucleoside or a 2'-O-methyl-RNA nucleoside.

[0591] 36. The oligonucleotide according to any one of paragraphs 3 to 35, wherein the nucleoside at one or more of positions +3, +5, +7, +9, +11, +13, +15, +17 and +19 is a 2'-fluoro-RNA nucleoside, preferably wherein the nucleoside at each of positions +3, +5, +7, +9, +11, +13, +15, +17 and +19 is a 2'-fluoro-RNA nucleoside.

[0592] 37. The oligonucleotide according to any one of paragraphs 3 to 36, wherein the nucleoside at one or more of positions -3, -5, -7 and -9 is a 2'-fluoro-RNA nucleoside, preferably wherein the nucleoside at each of positions -3, -5, -7 and -9 is a 2'-fluoro-RNA nucleoside.

[0593] 38. The oligonucleotide according to any one of paragraphs 3 to 37, wherein the nucleoside at one or more of positions +2, +4, +6, +8, +10, +12, +14 and +18 is a 2'-O-methyl-RNA nucleoside, preferably wherein the nucleoside at each of positions +2, +4, +6, +8, +10, +12, +14 and +18 is a 2'-O-methyl-RNA nucleoside.

[0594] 39. The oligonucleotide according to any one of paragraphs 3 to 38, wherein the nucleoside at one or more of positions -2, -4 and -6 is a 2'-O-methyl-RNA nucleoside, preferably wherein the nucleoside at each of positions -2, -4 and -6 is a 2'-O-methyl-RNA nucleoside.

[0595] 40. The oligonucleotide according to any one of paragraphs 3 to 39, wherein the nucleoside at one or more of positions +3, +5, +7, +9, +11, +13, +15, +17, +19, +21 and +23 is a 2'-fluoro-RNA nucleoside, preferably wherein the nucleoside at each of positions +3, +5, +7, +9, +11, +13, +15, +17, +19, +21 and +23 is a 2'-fluoro-RNA nucleoside.

[0596] 41. The oligonucleotide according to any one of paragraphs 3 to 40, wherein the nucleoside at one or more of positions -3, -5, -7, -9, -11, -13 and -15 is a 2'-fluoro-RNA nucleoside, preferably wherein the nucleoside at each of positions -3, -5, -7, -9, -11, -13 and -15 is a 2'-fluoro-RNA nucleoside.

[0597] 42. The oligonucleotide according to any one of paragraphs 3 to 41, wherein the nucleoside at one or more of positions +2, +4, +6, +8, +10, +12, +14, +18, +20, +22 and +24 is a 2'-O-methyl-RNA nucleoside, preferably wherein the nucleoside at each of positions +2, +4, +6, +8, +10, +12, +14, +18, +20, +22 and +24 is a 2'-O-methyl-RNA nucleoside.

[0598] 43. The oligonucleotide according to any one of paragraphs 3 to 42, wherein the nucleoside at one or more of positions -2, -4, -6, -10, -12 and -14 is a 2'-O-methyl-RNA nucleoside, preferably wherein the nucleoside at each of positions -2, -4, -6, -10, -12 and -14 is a 2'-O-methyl-RNA nucleoside.

[0599] 44. The oligonucleotide according to any one of paragraphs 3 to 43, wherein the nucleoside at position -2 is a 2'-O-methyl-RNA nucleoside.

[0600] 45. The oligonucleotide according to any one of paragraphs 3 to 44, wherein the nucleoside at position -3 is a 2'-fluoro-RNA nucleoside.

[0601] 46. ​​The oligonucleotide according to any one of paragraphs 3 to 45, wherein the nucleoside at position -8 is a 2'-fluoro-RNA nucleoside.

[0602] 47. The oligonucleotide according to any one of paragraphs 3 to 46, wherein the nucleoside at position +16 is a 2'-fluoro-RNA nucleoside.

[0603] 48. The oligonucleotide according to any one of paragraphs 3 to 47, wherein the nucleoside at position +17 is a 2'-fluoro-RNA nucleoside.

[0604] 49. The oligonucleotide according to any one of paragraphs 3 to 45, 47 or 48, wherein the nucleoside at position -8 is a 2'-O-methyl-RNA nucleoside.

[0605] 50. The oligonucleotide of any one of paragraphs 3 to 46, 48 or 49, wherein the nucleoside at position +16 is a 2'-O-methyl-RNA nucleoside.

[0606] 51. An oligonucleotide according to any of the preceding paragraphs, wherein the oligonucleotide is used to edit a target nucleic acid.

[0607] 52. The oligonucleotide of paragraph 51, wherein the target nucleic acid comprises a target adenosine.

[0608] 53. The oligonucleotide according to paragraph 51 or paragraph 52, wherein the oligonucleotide is capable of binding to the target nucleic acid through complementary base pairing.

[0609] 54. An oligonucleotide according to any one of the preceding paragraphs, wherein the oligonucleotide is a guide oligonucleotide for adenosine deaminase acting on RNA (ADAR).

[0610] 55. An oligonucleotide according to any of the preceding paragraphs, wherein the oligonucleotide is capable of recruiting ADAR to a target nucleic acid.

[0611] 56. The oligonucleotide of paragraph 54 or paragraph 55, wherein ADAR is ADAR1 or ADAR2.

[0612] 57. The oligonucleotide according to any one of paragraphs 52 to 56, wherein the oligonucleotide is capable of effecting conversion of the target adenosine (A) to inosine (I).

[0613] 58. The oligonucleotide of any one of paragraphs 51 to 57, wherein the target nucleic acid is RNA.

[0614] 59. The oligonucleotide according to any one of paragraphs 51 to 58, wherein the target nucleic acid encodes a protein.

[0615] 60. The oligonucleotide of any one of paragraphs 51 to 59, wherein the target nucleic acid is mRNA.

[0616] 61. The oligonucleotide of any one of paragraphs 51 to 60, wherein the target nucleic acid encodes alpha-1 antitrypsin (A1AT).

[0617] 62. The oligonucleotide according to any one of paragraphs 51 to 61, wherein the target nucleic acid is SERPINA1 mRNA.

[0618] 63. The oligonucleotide according to any one of paragraphs 51 to 62, wherein the oligonucleotide is capable of effecting conversion of an AAA codon encoding lysine to an IAA codon encoding glutamate on the target nucleic acid.

[0619] 64. The oligonucleotide according to any one of paragraphs 51 to 63, wherein the oligonucleotide is capable of effecting conversion of an AAG codon encoding lysine to an IAG codon encoding glutamate on the target nucleic acid.

[0620] 65. The oligonucleotide according to any one of paragraphs 52 to 64, wherein the target adenosine corresponds to A1024 of SEQ ID NO 186.

[0621] 66. The oligonucleotide according to any one of paragraphs 51 to 65, wherein the target nucleic acid comprises or consists of a sequence according to SEQ ID NO 186.

[0622] 67. The oligonucleotide of any one of paragraphs 51 to 66, wherein the editing nucleoside is not complementary to the target adenosine.

[0623] 68. The oligonucleotide according to any of the preceding paragraphs, wherein the nucleobase of the editing nucleoside is selected from the group consisting of cytosine, 5-methylcytosine, guanine and hypoxanthine.

[0624] 69. The oligonucleotide of any of the preceding paragraphs, wherein the editing nucleoside is cytidine (C).

[0625] 70. The oligonucleotide of any of the preceding paragraphs, wherein the editing region consists of editing nucleosides.

[0626] 71. The oligonucleotide of any one of paragraphs 3 to 70, wherein the editing region comprises or consists of nucleosides at positions +1, 0 and -1.

[0627] 72. The oligonucleotide according to any of the preceding paragraphs, wherein the editing region comprises or consists of an editing triplet consisting of 3 nucleosides, wherein the editing nucleoside is the central nucleoside of the editing triplet.

[0628] 73. The oligonucleotide of paragraph 72, wherein the editing triplet is 5'-thymidine-cytidine-inosine-3' (TCI).

[0629] 74. An oligonucleotide according to any one of paragraphs 5 to 73, wherein the editing region comprises one or more nucleosides comprising a sugar moiety different from the sugar moiety of the first type of 5' mixed-mer nucleoside, the second type of 5' mixed-mer nucleoside, the first type of 3' mixed-mer nucleoside and / or the second type of 3' mixed-mer nucleoside.

[0630] 75. The oligonucleotide of paragraph 74, wherein each nucleoside of the editing region comprises a sugar moiety that is different from the sugar moieties of the first type of 5' mixed-mer nucleoside, the second type of 5' mixed-mer nucleoside, the first type of 3' mixed-mer nucleoside, and the second type of 3' mixed-mer nucleoside.

[0631] 76. An oligonucleotide according to any of the preceding paragraphs, wherein each nucleoside of the editing region comprises the same sugar moiety.

[0632] 77. The oligonucleotide according to any of the preceding paragraphs, wherein each nucleoside of the editing region is independently selected from the group consisting of DNA, RNA, 2′-O-methyl-RNA, 2′-fluoro-RNA, MOE-RNA, LNA, ANA and FANA nucleosides.

[0633] 78. An oligonucleotide according to any of the preceding paragraphs, wherein the editing region comprises one or more DNA nucleosides.

[0634] 79. An oligonucleotide according to any of the preceding paragraphs, wherein the editing nucleoside is a DNA nucleoside.

[0635] 80. The oligonucleotide of any of the preceding paragraphs, wherein all nucleosides of the editing region are DNA nucleosides.

[0636] 81. The oligonucleotide according to any one of paragraphs 3 to 80, wherein the nucleoside at one or more of positions +1, 0 and -1 is a DNA nucleoside, preferably wherein the nucleoside at each of positions +1, 0 and -1 is a DNA nucleoside.

[0637] 82. An oligonucleotide according to paragraph 81, wherein the editing region consists of nucleosides at positions +1, 0 and -1 of the oligonucleotide, wherein the nucleoside at position +1 is a thymidine DNA nucleoside, the nucleoside at position 0 is a cytidine DNA nucleoside, and the nucleoside at position -1 is an inosine DNA nucleoside.

[0638] 83. The oligonucleotide of any one of paragraphs 1 to 78, wherein the editing nucleoside is a FANA nucleoside.

[0639] 84. The oligonucleotide of paragraph 83, wherein the editing nucleoside is a FANA nucleoside and all other nucleosides in the editing region are DNA nucleosides.

[0640] 85. The oligonucleotide of any one of paragraphs 3 to 78, wherein the nucleoside at position 0 is a FANA nucleoside.

[0641] 86. An oligonucleotide according to paragraph 85, wherein

[0642] (a) the nucleoside at position +1 is a DNA nucleoside, or

[0643] (b) the nucleoside at position -1 is a DNA nucleoside, or

[0644] (c) The nucleoside at each of positions +1 and -1 is a DNA nucleoside.

[0645] 87. An oligonucleotide according to paragraph 86, wherein the editing region consists of nucleosides at positions +1, 0 and -1 of the oligonucleotide, wherein the nucleoside at position +1 is a thymidine DNA nucleoside, the nucleoside at position 0 is a cytidine FANA nucleoside, and the nucleoside at position -1 is an inosine DNA nucleoside.

[0646] 88. The oligonucleotide according to any one of the preceding paragraphs, wherein the oligonucleotide is 30 to 61 nucleosides long, preferably 30 to 50 nucleosides long, more preferably 35 to 45 nucleosides long.

[0647] 89. The oligonucleotide of any one of the preceding paragraphs, wherein the oligonucleotide is 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleosides long, preferably 35, 36, 37, 38, 39, 40, 41, 42, 43, 44 or 45 nucleosides long, more preferably 40 nucleosides long.

[0648] 90. An oligonucleotide according to any of the preceding paragraphs, wherein the oligonucleotide comprises exactly 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleosides 5′ of the editing nucleoside, preferably 24, 25, 26 or 27 nucleosides 5′ of the editing nucleoside, more preferably exactly 24 nucleosides 5′ of the editing nucleoside.

[0649] 91. An oligonucleotide according to any of the preceding paragraphs, wherein the oligonucleotide comprises exactly 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleotides 3′ of the editing nucleoside, preferably exactly 12, 13, 14 or 15 nucleotides 3′ of the editing nucleoside, more preferably exactly 15 nucleotides 3′ of the editing nucleoside.

[0650] 92. The oligonucleotide according to any of the preceding paragraphs, wherein the oligonucleotide comprises exactly 24 nucleotides 5' to the edited nucleoside and exactly 15 nucleotides 3' to the edited nucleoside.

[0651] 93. An oligonucleotide according to any one of the preceding paragraphs, wherein the oligonucleotide comprises one or more phosphorothioate internucleoside linkages.

[0652] 94. The oligonucleotide according to any one of paragraphs 3 to 93, wherein the internucleoside linkage between the nucleosides at positions +1 and 0 is a phosphodiester internucleoside linkage.

[0653] 95. The oligonucleotide according to any one of paragraphs 3 to 94, wherein the internucleoside linkage between the nucleosides at positions 0 and -1 is a phosphodiester internucleoside linkage.

[0654] 96. The oligonucleotide according to any one of paragraphs 3 to 95, wherein the internucleoside linkage between the nucleosides at positions -1 and -2 is a phosphorothioate internucleoside linkage.

[0655] 97. The oligonucleotide according to any one of paragraphs 3 to 96, wherein the internucleoside linkage between the nucleosides at positions -2 and -3 is a phosphodiester internucleoside linkage.

[0656] 98. The oligonucleotide of any one of paragraphs 94 to 97, wherein all other internucleoside linkages are phosphorothioate internucleoside linkages.

[0657] 99. The oligonucleotide according to any one of paragraphs 1 to 93, wherein all internucleoside linkages of the oligonucleotide are phosphorothioate internucleoside linkages.

[0658] 100. The oligonucleotide according to any of the preceding paragraphs, wherein the oligonucleotide comprises a 5' flanking region located 5' to the 5' mixed-mer region.

[0659] 101. The oligonucleotide according to any of the preceding paragraphs, wherein the oligonucleotide comprises a 3' flanking region located 3' to the 3' mixed-mer region.

[0660] 102. The oligonucleotide according to paragraph 102, wherein the oligonucleotide comprises the following structure:

[0661] X +2 -X +1 -X 0 -X -1 -X -2

[0662] in

[0663] X +2 is the 5′ flanking region,

[0664] X +1 is the 5′ mixed polymer region,

[0665] X 0 is the editing area,

[0666] X -1 is the 3′ mixed-mer region, and

[0667] X- 2 is the 3′ flanking region.

[0668] 103. The oligonucleotide according to any of paragraphs 100 to 102, wherein the 5' flanking region is 1, 2, 3, 4 or 5 nucleosides in length, preferably 5 nucleosides in length.

[0669] 104. The oligonucleotide according to any of paragraphs 101 to 103, wherein the 3' flanking region is 1, 2, 3, 4 or 5 nucleosides in length, preferably 5 nucleosides in length.

[0670] 105. The oligonucleotide according to any of paragraphs 100 to 104, wherein the 5' flanking region consists of 1, 2, 3, 4 or 5 nucleosides at the 5' end of the oligonucleotide, preferably 5 nucleosides at the 5' end of the oligonucleotide.

[0671] 106. The oligonucleotide according to any of paragraphs 101 to 105, wherein the 3' flanking region consists of 1, 2, 3, 4 or 5 nucleosides at the 3' end of the oligonucleotide, preferably 5 nucleosides at the 3' end of the oligonucleotide.

[0672] 107. The oligonucleotide of any of paragraphs 100 to 106, wherein the 5' flanking region comprises one or more sugar modified nucleosides.

[0673] 108. The oligonucleotide of any of paragraphs 101 to 107, wherein the 3' flanking region comprises one or more sugar modified nucleosides.

[0674] 109. The oligonucleotide according to paragraph 107 or paragraph 108, wherein the one or more sugar modified nucleosides are independently selected from the group consisting of 2'-O-methyl-RNA, 2'-fluoro-RNA, 2'-O-methoxyethyl-RNA (MOE-RNA) and LNA nucleosides.

[0675] 110. The oligonucleotide of any of paragraphs 100 to 109, wherein all nucleosides in the 5' flanking region are sugar-modified nucleosides.

[0676] 111. The oligonucleotide of any of paragraphs 101 to 110, wherein all nucleosides in the 3' flanking region are sugar-modified nucleosides.

[0677] 112. The oligonucleotide of any of paragraphs 100 to 111, wherein all nucleosides of the 5' flanking region are 2'-O-methyl-RNA.

[0678] 113. The oligonucleotide of any of paragraphs 101 to 112, wherein all nucleosides of the 3' flanking region are 2'-O-methyl-RNA.

[0679] 114. The oligonucleotide according to any of the preceding paragraphs, wherein the oligonucleotide comprises or consists of a sequence complementary to SERPINA1 mRNA.

[0680] 115. An oligonucleotide according to any of the preceding paragraphs, wherein the sequence of the oligonucleotide comprises or consists of a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% complementary to positions 986 to 1062 of SEQ ID NO 186, wherein any match or mismatch between the editing nucleoside and the target adenosine is not included when determining the percent complementarity.

[0681] 116. An oligonucleotide according to any one of the preceding paragraphs, wherein the sequence of the oligonucleotide comprises a sequence from:

[0682] CUCUAAAAACAUGGCCCCAGCAGCUUCAGUCCCUUUC TCI UCGAUGGUCAGCACAGCCUUAUGCACGGCCUUGGUGU (SEQ ID NO 87),

[0683] or 30 to 61 consecutive nucleosides from a variant of SEQ ID NO 87, comprising exactly 1, exactly 2 or exactly 3 single nucleoside substitutions,

[0684] wherein I is inosine, and

[0685] Wherein the oligonucleotide comprises positions 38, 39 and 40 of SEQ ID NO 87.

[0686] 117. The oligonucleotide of paragraph 116, wherein positions 38, 39 and 40 of SEQ ID NO 87 are editing triplets.

[0687] 118. The oligonucleotide according to paragraph 116 or paragraph 117, wherein the sequence of the oligonucleotide comprises or consists of 30 to 50 consecutive nucleosides from SEQ ID NO 87 or from a variant thereof.

[0688] 119. The oligonucleotide according to paragraph 118, wherein the sequence of the oligonucleotide comprises or consists of 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 consecutive nucleosides from SEQ ID NO 87 or from a variant thereof, preferably 40 consecutive nucleosides.

[0689] 120. The oligonucleotide of any one of paragraphs 116 to 119, wherein the variant of SEQ ID NO 87 comprises exactly 1 single nucleoside substitution.

[0690] 121. The oligonucleotide according to any one of paragraphs 116 to 120, wherein the variant of SEQ ID NO 87 comprises a nucleoside substitution at position 38, 39 and / or 40 of SEQ ID NO 87.

[0691] 122. An oligonucleotide according to any of the preceding paragraphs, wherein the sequence of the oligonucleotide comprises or consists of a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to any one of SEQ ID NOs 1 to 86.

[0692] 123. An oligonucleotide according to any of the preceding paragraphs, wherein the sequence of the oligonucleotide comprises the same as SEQ ID NO 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 85, or alternatively consists of a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to any of 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, and 86.

[0693] 124. An oligonucleotide according to any of the preceding paragraphs, wherein the sequence of the oligonucleotide comprises or consists of a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to any one of SEQ ID NOs 2, 3, 7, 8, 9, 10, 13, 19, 20, 21, 22, 23, 26, 29, 30, 31, 32, 33, 34, 35, 36, 41, 42, 43, 45, 59, 60, 61, 62, 63, 64 and 65.

[0694] 125. An oligonucleotide according to any of the preceding paragraphs, wherein the sequence of the oligonucleotide comprises or consists of a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to any one of SEQ ID NOs 3, 7, 8, 9, 19, 20, 21, 22, 29, 30, 31, 32, 33, 34, 42, 43, 62 and 63.

[0695] 126. An oligonucleotide according to any of the preceding paragraphs, wherein the sequence of the oligonucleotide comprises or consists of a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to SEQ ID NO 32.

[0696] 127. An oligonucleotide according to any one of the preceding paragraphs, wherein the oligonucleotide comprises or consists of any one of the following: CMP ID NO 1_1、2_1、3_1、3_2、3_3、4_1、5_1、6_1、7_1、8_1、9_1、10_1、11_1、12_1、13_1、14_1、15_1、16_1、17_1、18_1、19_1、20_1、21_1、22_1、23_1、24_1、25_1、26_1、26_2、26_3、26_4、26_5、26_6、26_7、26_8、26_9、27_1、28_1、29_1、30_1、31_1、32_1、32_2、32_3、32_4、32_5、32_6、32_7、32_8、32 _9, 32_10, 32_11, 32_12, 32_13, 32_14, 32_15, 32_16, 32_17, 32_18, 32_19, 32_20, 32_21, 32_22, 32_23, 32_24, 32_25, 32_26, 32_27, 32_28, 32_29, 32_30, 32_31, 32_32, 32_33, 32_34, 32_35, 32_36, 32_37, 32_38, 32_39, 32_40, 32_41, 32_42, 32_43, 32_44, 32_45, 32_46, 32_47, 32_48, 32_49、32_50、32_5_1、32_52、32_53、32_54、32_55、32_56、32_57、32_58、32_59、32_60、32_61、32_62、32_63、32_64、32_65、32_66、32_67、32_68、32_69、32_70、32_71、32_72、32_73、32_74、32_75、32_76、32_77、32_78、32_79、32_80、32_81、32_82、32_83、33_1、34_1、35_1、36_1、37_1、 38_1、39_1、40_1、40_2、40_3、40_4、40_5、40_6、40_7、40_8、40_9、40_10、41_1、41_2、41_3、41_4、41_5、41_6、41_7、41_8、41_9、41_10、42_1、42_2、42_3、42_4、42_5、42_6、43_1、43_2、43_3、44_1、45_1、46_1、47_1、47_2、48_1、49_1、50_1、51_1、52_1、53_1、54_1、55_1、56_1、57_1、58_1、59_1, 60_1, 61_1, 62_1, 63_1, 64_1, 65_1, 66_1, 67_1, 68_1, 69_1, 70_1, 71_1, 72_1, 73_1, 74_1, 75_1, 76_1, 77_1, 78_1, 79_1, 80_1, 81_1, 82_1, 83_1, 84_1, 85_1 and 86_1.,

[0697] 128. The oligonucleotide according to any one of the preceding paragraphs, wherein the oligonucleotide comprises any one of or consists of: CMP ID NO 2_1, 3_1, 3_3, 7_1, 8_1, 9_1, 10_1, 13_1, 19_1, 20_1, 21_1, 22_1, 23_1, 26_8, 29_1, 30_1, 31_1, 32_1, 32_2, 32_4, 32_5, 32_6, 32_7, 32_8, 32_9, 32_10, 32_11, 32_12, 32_13, 32_14, 32_16, 32_17, 32_18, 32_19, 32_20, 32_21, 32_22, 32_23, 32_29, 32_33, 32_34, 32_47, 32_48, 32_49, 32_50, 32_51, 32_52, 32_53, 32_54, 32_55, 32_56, 32_57, 32_58, 32_59, 32_60, 32_61, 32_62, 32_63, 32_64, 32_65, 33_1, 34_1, 35_1, 36_1, 41_8, 42_6, 43_1, 43_3, 45_1, 59_1, 60_1, 61_1, 62_1, 63_1, 64_1 and 65_1.

[0698] 129. An oligonucleotide according to any of the preceding paragraphs, wherein the oligonucleotide comprises or consists of any one of the following: CMP ID NO 3_1, 7_1, 8_1, 9_1, 19_1, 20_1, 21_1, 22_1, 29_1, 30_1, 31_1, 19_1, 32_1, 32_4, 32_5, 32_6, 32_7, 32_8, 32_9, 32_10, 32_11, 32_12, 32_13, 32_14, 32_16, 32_17, 32_18, 32_19, 32_20, 32_2 1, 32_22, 32_23, 32_33, 32_47, 32_48, 32_49, 32_50, 32_51, 32_52, 32_53, 32_54, 32_55, 32_56, 32_57, 32_58, 32_60, 32_61, 32_62, 32_63, 32_64, 32_65, 33_1, 34_1, 42_6, 43_1, 62_1 and 63_1.

[0699] 130. An oligonucleotide according to any one of the preceding paragraphs, wherein the oligonucleotide comprises or consists of any one of the following: CMP ID NO32_1, 32_2, 32_3, 32_4, 325, 32_6, 32_7, 32_8, 32_9, 32_10, 32_11, 32_ 12, 32_13, 32_14, 32_15, 32_16, 32_17, 32_18, 32_19, 32_20, 32_21, 32_2 2. 32_23, 32_24, 32_25, 32_26, 32_27, 32_28, 32_29, 32_30, 32_31, 32_32 ,32_33,32_34,32_35,32_36,32_37,32_38,32_39,32_40,32_41,32_42,3 2_43、32_44、32_45、32_46、32_47、32_48、32_49、32_50、32_51、32_52、32_53、32_54、32_55、32_56、32_57、32_58、32_59、32_60、32_61、32_62、32_ 63, 32_64, 32_65, 32_66, 32_67, 32_68, 32_69, 32_70, 32_71, 32_72, 32_73, 32_74, 32_75, 32_76, 32_77, 32_78, 32_79, 32_80, 32_81, 32_82 and 32_83.

[0700] 131. An oligonucleotide according to any of the preceding paragraphs, wherein the oligonucleotide comprises or consists of CMP ID NO 32_1.

[0701] 132. A Fig.29 Oligonucleotides depicted.

[0702] 133. An oligonucleotide conjugate comprising the oligonucleotide according to any of the preceding paragraphs covalently attached to at least one conjugate moiety.

[0703] 134. An oligonucleotide conjugate according to paragraph 133, wherein the conjugate moiety is covalently attached to the oligonucleotide via a linker.

[0704] 135. An oligonucleotide conjugate according to paragraph 134 or paragraph 135, wherein the conjugate moiety is selected from the group consisting of a carbohydrate, a cell surface receptor ligand, a drug, a hormone, a lipophilic substance, a polymer, a protein, a peptide, a toxin (e.g., a bacterial toxin), a vitamin, a viral protein (e.g., a capsid), or a combination thereof.

[0705] 136. The oligonucleotide conjugate according to paragraph 135, wherein the conjugate moiety is an N-acetylgalactosamine (GalNAc) conjugate moiety.

[0706] 137. The oligonucleotide or oligonucleotide conjugate according to any one of the preceding paragraphs, wherein the oligonucleotide or oligonucleotide conjugate is in the form of a pharmaceutically acceptable salt.

[0707] 138. The oligonucleotide or oligonucleotide conjugate according to paragraph 137, wherein the salt is a sodium salt or a potassium salt.

[0708] 139. The oligonucleotide or oligonucleotide conjugate according to any of the preceding paragraphs, wherein the oligonucleotide or oligonucleotide conjugate is encapsulated in a lipid-based delivery vehicle, covalently linked to or encapsulated in a dendrimer, or conjugated to an aptamer.

[0709] 140. A pharmaceutical composition comprising the oligonucleotide or oligonucleotide conjugate according to any one of paragraphs 1 to 139, and a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.

[0710] 141. The pharmaceutical composition according to paragraph 140, wherein the pharmaceutical composition comprises an aqueous diluent or solvent, such as phosphate buffered saline.

[0711] 142. An in vitro method for editing a target nucleic acid in a target cell, the method comprising administering to the target cell an effective amount of an oligonucleotide or oligonucleotide conjugate according to any one of paragraphs 1 to 139 or a pharmaceutical composition according to paragraph 140 or paragraph 141.

[0712] 143. An in vivo method for editing a target nucleic acid in a target cell, the method comprising administering to the target cell an effective amount of an oligonucleotide or oligonucleotide conjugate according to any one of paragraphs 1 to 139 or a pharmaceutical composition according to paragraph 140 or paragraph 141.

[0713] 144. The method of paragraph 142 or paragraph 143, wherein the target nucleic acid comprises a target adenosine.

[0714] 145. The method of any one of paragraphs 142 to 144, wherein the target cell is a mammalian cell.

[0715] 146. The method of paragraph 145, wherein the target cell is a human cell.

[0716] 147. The method of any one of paragraphs 142 to 146, wherein the target cell is a lung cell or a liver cell.

[0717] 148. The method of any of paragraphs 142 to 147, wherein the amount of edited target nucleic acid is increased by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or 100% compared to a control.

[0718] 149. The method of paragraph 148, wherein the control is a cell that has not been exposed to the oligonucleotide or oligonucleotide conjugate.

[0719] 150. The method of any one of paragraphs 142 to 149, wherein the oligonucleotide binds to the target nucleic acid through complementary base pairing.

[0720] 151. The method of any one of paragraphs 142 to 150, wherein the oligonucleotide recruits ADAR to the target nucleic acid.

[0721] 152. The method of paragraph 151, wherein the ADAR is ADAR1 or ADAR2.

[0722] 153. The method of any one of paragraphs 142 to 152, wherein the target adenosine (A) is converted to inosine (I).

[0723] 154. The method of any one of paragraphs 142 to 153, wherein the target nucleic acid encodes a protein.

[0724] 155. The method of any one of paragraphs 142 to 154, wherein the target nucleic acid is mRNA.

[0725] 156. The method of any one of paragraphs 142 to 155, wherein the target nucleic acid encodes alpha-1 antitrypsin (A1AT).

[0726] 157. The method of any one of paragraphs 142 to 156, wherein the target nucleic acid is SERPINA1 mRNA.

[0727] 158. The method of any one of paragraphs 142 to 157, wherein an AAA codon encoding lysine on the target nucleic acid is converted to an IAA codon encoding glutamate.

[0728] 159. The method of any one of paragraphs 142 to 158, wherein an AAG codon encoding lysine on the target nucleic acid is converted to an IAG codon encoding glutamate.

[0729] 160. The method according to any one of paragraphs 142 to 159, wherein the target adenosine is A1024 on the target nucleic acid as defined by SEQ ID NO 186.

[0730] 161. The method according to any one of paragraphs 142 to 160, wherein the target nucleic acid comprises or consists of a sequence according to SEQ ID NO 186.

[0731] 162. A method for treating or preventing a disease, comprising administering to a subject suffering from or susceptible to the disease a therapeutically or prophylactically effective amount of an oligonucleotide or oligonucleotide conjugate according to any one of paragraphs 1 to 139 or a pharmaceutical composition according to paragraph 140 or paragraph 141.

[0732] 163. An oligonucleotide or oligonucleotide conjugate according to any one of paragraphs 1 to 139 or a pharmaceutical composition according to paragraph 140 or paragraph 141 for use in treating or preventing a disease in a subject.

[0733] 164. Use of an oligonucleotide or oligonucleotide conjugate according to any one of paragraphs 1 to 139 or a pharmaceutical composition according to paragraph 140 or paragraph 141 for the preparation of a medicament for treating or preventing a disease in a subject.

[0734] 165. The method according to paragraph 162, the oligonucleotide for use, the oligonucleotide conjugate for use or the pharmaceutical composition for use according to paragraph 163 or the use according to paragraph 164, wherein the disease is alpha 1 antitrypsin deficiency (A1AD).

[0735] 166. The method, oligonucleotide for use, oligonucleotide conjugate for use, pharmaceutical composition for use, or use according to paragraph 165, wherein the treatment or prevention comprises treating or preventing one or more symptoms of A1AD selected from liver damage, liver failure, cirrhosis, jaundice, elastin breakdown in the lungs, emphysema, and chronic obstructive pulmonary disease (COPD).

[0736] Examples

[0737] Example 1 - Oligonucleotide sequences and compounds

[0738] Oligonucleotides (compounds) and conjugates for editing SERPINA1, GAPDH or mHprt mRNA were synthesized.

[0739] Oligonucleotide synthesis

[0740] Oligonucleotide synthesis is well known in the art. Oligonucleotides of the present invention and conjugates can be synthesized by any such method known in the art. The following is a possible scheme. Oligonucleotides of the present invention can be produced by slightly different methods in terms of equipment, support and concentration used.

[0741] Oligonucleotides were synthesized on a Mermade 192 at 1 μmol scale using the phosphoramidite method on a uridine universal support. At the end of the synthesis, the oligonucleotides were cleaved from the solid support using ammonia at 60° C. for 5 to 16 hours. Oligonucleotides were purified by reverse phase HPLC (RP-HPLC), ion exchange chromatography or by solid phase extraction and characterized by UPLC, and the molecular mass was further confirmed by ESI-MS.

[0742] Extension of oligonucleotides:

[0743] Coupling of β-cyanoethyl-phosphoramidites (DNA-A(Bz), DNA-G(ibu), DNA-C(Bz), DNA-T, LNA-5-methyl-C(Bz), LNA-A(Bz), LNA-G(dmf) or LNA-T) is performed by using a 0.1 M solution of the 5′-O-DMT-protected amidite in acetonitrile and a solution of DCI (4,5-dicyanoimidazole) in acetonitrile (0.25 M) as activating agents. For the final cycle, the phosphoramidite with the desired modification, such as a C6 linker for attaching the conjugated group, or the conjugated group itself, can be used. Thiolation treatment for the introduction of phosphorothioate bonds is performed using hydrogenated xanthine (0.01 M in acetonitrile / pyridine 9:1). Phosphodiester bonds can be introduced using 0.02 M iodine in THF / pyridine / water 7:2:1. The remaining reagents are those commonly used for oligonucleotide synthesis.

[0744] For post solid phase synthesis conjugation, a commercially available C6 amino linker phosphoramidite can be used in the final cycle of solid phase synthesis and the amino linked deprotected oligonucleotide isolated after deprotection and separation from the solid support. The conjugate is introduced via activation of the functional group using standard synthetic methods.

[0745] Purification by RP-HPLC:

[0746] Phenomenex The crude compound was purified on C18 10 μm 150x10 mm column. 0.1 M ammonium acetate pH 8 and acetonitrile were used as buffer with a flow rate of 5 mL / min. The collected fractions were lyophilized to obtain the purified compound as a generally white solid.

[0747] abbreviation:

[0748] DCI: 4,5-Dicyanoimidazole

[0749] DCM: dichloromethane

[0750] DMF: dimethylformamide

[0751] DMT: 4,4'-dimethoxytrityl

[0752] THF: Tetrahydrofuran

[0753] Bz: benzoyl

[0754] Ibu: isobutyryl

[0755] RP-HPLC: Reverse Phase High Performance Liquid Chromatography

[0756] Table of sequences, compounds and conjugates

[0757] Tables 3, 5 and 7 below show the sequences of the oligonucleotides used to edit SERPINA1, GAPDH and mHprt, respectively. The codes used in Tables 3, 5 and 7 are as follows:

[0758] Codes for nucleobases: A = adenine, ab = abasic (i.e., no nucleobase), C = cytosine, E = 5-methylcytosine, F = 7-deaza-8-azaguanine, G = guanine, I = hypoxanthine (i.e., inosine nucleotide), prpC = 5-propynylcytosine, pyrC = pyrrolocytosine, T = thymine, U = uracil, Z = Benner base, 2AP = 2-aminopurine, apC = aminoethylphenoxazine, 5brC = 5-bromocytosine

[0759] Tables 4, 6 and 8 below show the sequences, sugar modification patterns and internucleoside linkage patterns of the oligonucleotides used to edit SERPINA1, GAPDH and mHprt, respectively, using HELM strings. Table 9 also describes conjugation using HELM strings.

[0760] An explanation of the HELM symbols used in Tables 4, 6, 8 and 9 is provided in the detailed description herein.

[0761] Table 3 - SERPINA1 editing sequence

[0762]

[0763]

[0764]

[0765]

[0766] Table 4 - SERPINA1 Editing Compounds

[0767]

[0768]

[0769]

[0770]

[0771]

[0772]

[0773]

[0774]

[0775]

[0776]

[0777]

[0778]

[0779]

[0780]

[0781]

[0782]

[0783]

[0784]

[0785]

[0786]

[0787] Table 5 - GAPDH editing sequences

[0788]

[0789]

[0790]

[0791] Table 6 - GAPDH editing compounds

[0792]

[0793]

[0794]

[0795]

[0796]

[0797]

[0798]

[0799]

[0800]

[0801]

[0802]

[0803]

[0804]

[0805]

[0806]

[0807] Table 7-mHprt editing sequence

[0808]

[0809]

[0810]

[0811] Table 8 - mHprt editing compounds

[0812]

[0813]

[0814]

[0815]

[0816]

[0817]

[0818]

[0819]

[0820]

[0821] Table 9 - mHprt Editing Conjugates

[0822]

[0823] Example 2 - Effect of mixed polymers on stability

[0824] The effect of changing an editing oligonucleotide comprising primarily RNA nucleosides to an editing oligonucleotide comprising a mixed polymer of alternating 2′-O-methyl-RNA and 2′-fluoro-RNA nucleosides on the stability of the editing oligonucleotide was studied. Figure 1 ).

[0825] Oligonucleotides were diluted to a concentration of 5 μM in 10% rat liver trisomic solution in PBS, FBS (Sigma Aldrich), human cerebrospinal fluid (CSF, Zen-Bio) or catabolic buffer (SEKISUI XenoTech) and incubated at 37°C. After the specified different time intervals, the samples were diluted to 0.5 μM in loading buffer and treated with proteinase K (Thermo Fisher Scientific) for 30 minutes according to the manufacturer's protocol. After proteinase K inactivation, the samples were loaded and run on 15% TBE-urea gels (Thermo Fisher Scientific) and the bands were visualized by SYBR Gold (Thermo Fisher Scientific) staining.

[0826] These data suggest that oligonucleotides containing mixed polymer structures of alternating 2′-O-methyl-RNA and 2′-fluoro-RNA nucleosides ( Figure 1 Compared with the oligonucleotides mainly composed of RNA nucleosides ( Figure 1 CMPID NO 91_2) in the sample was more resistant to degradation.

[0827] Example 3 - Method for determining editing efficiency

[0828] The following methodology was used to determine the efficiency of editing a specific target mRNA (SERPINA1, GAPDH or mHprt) when different guide oligonucleotides were used.

[0829] In general, cells are transfected with editing oligonucleotides, RNA is then extracted, the target sequence is amplified by PCR, and the percentage of edited RNA is determined by sequencing. The specific cell type and editing target are indicated in each example or figure.

[0830] HuH-7 / 3T3 cell experiments

[0831] HuH-7-SERPINA1-PiZ cells were custom CRISPR engineered to introduce the SERPINA1-PiZ E342K mutation into the wild-type HuH-7 cell line by Horizon Discovery.

[0832] 7500 cells per well of HuH-7wt (JCRB), HuH-7-SERPINA1-PiZ or 3T3-L1 (ATCC) were seeded into 96-well plates in the corresponding culture medium recommended by the supplier. 24 hours after seeding, the culture medium was changed and cells were transfected with a mixture of 20 μL of ASO (final concentration in the well was 50 nM, if not otherwise stated) and 0.3 μL of Lipofectamine RNAiMAX (Thermo Fisher Scientific) per well in OptiMEM (Thermo Fisher Scientific).

[0833] Flp-In-T-REx 293-hADAR cells

[0834] Stable expression of Flp-In-T-REx 293-hADAR1 p110 / hADAR1 p150 / hADAR2 was generated by co-transfection of the cDNA of hADAR1 p110 / hADAR1 p150 / hADAR2 with Flp recombinase into a pcDNA5 vector obtained from commercially available cDNA vectors (ADAR1 (NM_001111) and RED1 (ADARB1) (NM_001112) Origene) according to the manufacturer's protocol (Thermo Fisher). Subsequently, hygromycin (100 μg / mL) and blasticidin S (15 μg / mL) were selected for three weeks. Cells were maintained in selection medium, but were seeded in medium containing 1 μg / mL tetracycline and without selection antibiotics 24 h before transfection (15,000 cells per well in a 96-well plate).

[0835] Primary mouse hepatocytes

[0836] Freshly isolated primary mouse hepatocytes were reverse transfected by adding 25,000 cells in Williams E medium supplemented with 10% FBS and 2 mM glutamine (Sigma Aldrich) to collagen-coated plates (Coming) containing ASO (final 50 nM) and 0.3 μL Lipofectamine RNAiMAX (Thermo Fisher Scientific) transfection mix. For reverse stripping, 25,000 cells in culture medium were added to collagen-coated plates containing ASO diluted in PBS.

[0837] RNA extraction, PCR and sequencing

[0838] After 24 hours (if not otherwise stated), cells were harvested with RLT buffer and RNA was isolated using an RNeasy 96 kit (Qiagen) with on-column DNase digestion according to the manufacturer's protocol. Oligonucleotides complementary to the editing oligonucleotide ("sense") and transcript-specific forward and reverse primers (Table 10) were added to the isolated RNA and incubated at 90°C for 2 min before performing one-step RT-PCR (QuantaBioqScript XLT One Step Mix). Subsequently, the PCR product was diluted 1:10,000 in water and a second PCR (Phusion High Fidelity PCR Master Mix with GC buffer, Thermo Fisher Scientific) (Table 11) was performed using primers with individual barcodes and Illumina adapters for NGS sequencing. After the second PCR, the PCR products of each well were combined and purified using Monarch PCR & DNA Cleanup KIT (NEB).

[0839] The indexed NGS libraries were sequenced on the Illumina Mini Seq system according to the manufacturer's instructions. The generated fastq files were analyzed using CLC Genomics Workbench version 20.0.4 software (Qiagen). The reads derived from the primers were trimmed, the sequences were mapped to the target transcripts, and variant calls were made for the mapped reads from each sample. A minimum cutoff of 1% was used as a filter in variant detection, and the %G at the editing target site was plotted as the editing efficiency.

[0840] Table 10 - Target-specific primers (1. One-step PCR)

[0841]

[0842] " / 3InvdT / " stands for "3' inverted dT", which refers to the DNA thymine nucleotide being "inverted" to form a 3'-3' bond, according to the following structure:

[0843]

[0844] Table 11 - Sequencing primers (2.PCR)

[0845]

[0846]

[0847]

[0848]

[0849]

[0850]

[0851]

[0852] Example 4 - Effect of mixed polymers on editing efficiency

[0853] Inclusion of mixed-mer sequences in editing oligonucleotides was investigated for the editing of GAPDH mRNA in HEK-293 ADAR1 p150 cells. Figure 2 A) and editing of SERPINA1 mRNA in HuH7 cells ( Figure 2 B and Figure 3 )’s impact.

[0854] The highest editing efficiency was achieved using non-mixed oligomer RNA sequences, but such oligonucleotides will have low stability, as shown herein in Example 2. Good editing efficiencies were also achieved using 2′-O-methyl-RNA / 2′-fluoro-RNA mixed oligomers and RNA / DNA mixed oligomers.

[0855] Example 5 - Effect of editing region inosine on editing efficiency

[0856] Substitution of inosine for guanosine at the -1 position of the editing oligonucleotide greatly enhanced editing of SERPINA1 mRNA ( Figure 4 ).

[0857] Example 6-Effect of Benner bases on editing efficiency when editing nucleosides

[0858] Replacing cytosine with a Benner base (Z) at position 0 (the editing nucleoside) of the editing oligonucleotide greatly enhanced editing of GAPDH mRNA ( Figure 5 ).

[0859] Example 7 - Effects of length and symmetry on editing efficiency

[0860] The effects of varying the length and symmetry of the editing oligonucleotide on the SERPINAl ( Figure 6 and 7 )、GAPDH( Figure 8 and 9 ) and mHprt( Fig.10 )The impact of mRNA editing.

[0861] Figure 6 , 8 and 9 showed that increasing the length of the oligonucleotide 3′ to the editing nucleoside from 4 to 15 nucleotides increased the editing efficiency. Figure 7 It was shown that good editing efficiency was achieved in a range of symmetries from about 30-1-9 to about 22-1-17. Fig.10 A shows that good editing efficiency can be achieved using about 8 to 25 nucleosides 3' to the editing nucleoside. Fig.10 B shows that good editing efficiency can be achieved using about 22 to 30 nucleosides 5′ of the editing nucleoside

[0862] Example 8 - Effect of editing region modification on editing efficiency

[0863] The effects of nucleosides in the editing region of modified editing oligonucleotides on SERPINAl ( Fig.11 and 12 )、GAPDH( Figures 13 to 17 ) and mHprt( Fig.18 ) mRNA editing. Editing nucleosides that are DNA nucleosides or FANA nucleosides particularly enhance editing efficiency (see Fig.11 , 12 , 13, 14 and 16). Example 9 - Effect of internucleoside bonds on editing efficiency

[0864] The internucleoside bonds of modified editing oligonucleotides were investigated for GAPDH ( Figures 19 to 22 ) and mHprt( Fig.23 )The impact of mRNA editing. Fig.19 It was shown that high phosphorothioate (PS) content is tolerated and even preferred in editing oligonucleotides.

[0865] Example 10 - Effect of modified sugar moieties on editing efficiency

[0866] The effects of 2′-O-methyl and 2′-fluoro sugar modifications at specific positions in editing oligonucleotides on the editing of SERPINA1 mRNA were investigated. Fig.24 and 25 ).

[0867] 2′-O-methyl-RNA-enhanced editing at position −2 (see Fig.24 B, CMP ID NO 32_29). 2′-Fluoro-RNA at position -3 enhances editing (see Fig.25 B, CMP ID NO 32_77). Example 11 - Effect of flanking regions on editing efficiency

[0868] The effect of the presence of flanking regions containing 2′-O-methyl or 2′-MOE sugar modifications in editing oligonucleotides on the editing of GAPDH mRNA was investigated. Fig.26 ).

[0869] Example 12 - Effect of conjugation on editing efficiency

[0870] Mouse primary hepatocytes were exposed to editing oligonucleotides targeting mHprt, including oligonucleotides conjugated to a GalNAc conjugate moiety. The conjugate (CNJ ID NO 126_2_1) was as effective in editing mHprt mRNA as the unconjugated compound with the same oligonucleotide sequence and modification pattern (CMP ID NO 126_2). Fig. 27 and 28 ).

Claims

1. An oligonucleotide comprising an editing region comprising an editing nucleoside, a 5' mixed-mer region located 5' to the editing region, and A 3' mixed-mer region located 3' to the editing region, wherein The editing nucleoside is designated as position 0, Each nucleoside 5′ to the edited nucleoside is designated as position + x, where x is the number of nucleosides 5′ to the edited nucleoside at that position, including the nucleoside at that position, and Each nucleoside 3' to the edited nucleoside is designated as position-y, where y is the number of nucleosides 3' to the edited nucleoside at that position, inclusive.

2. The oligonucleotide according to claim 1, wherein (a) the 5′ mixed-mer region comprises a first type of 5′ mixed-mer nucleosides and a second type of 5′ mixed-mer nucleosides, wherein the sugar moiety of the first type of 5′ mixed-mer nucleosides is different from the sugar moiety of the second type of 5′ mixed-mer nucleosides; and / or (b) the 3' mixed-mer region comprises a first type of 3' mixed-mer nucleosides and a second type of 3' mixed-mer nucleosides, wherein the sugar moiety of the first type of 3' mixed-mer nucleosides is different from the sugar moiety of the second type of 3' mixed-mer nucleosides.

3. The oligonucleotide according to claim 1 or claim 2, wherein (a) the 5' mixed-mer region comprises an alternating pattern of single nucleosides of the first type of 5' mixed-mer nucleosides and single nucleosides of the second type of 5' mixed-mer nucleosides; and / or (b) the 3' mixed-mer region comprises an alternating pattern of single nucleosides of the first type of 3' mixed-mer nucleosides and single nucleosides of the second type of 3' mixed-mer nucleosides.

4. The oligonucleotide according to any one of claims 1 to 3, wherein (a) the 5′ mixed-mer region comprises or consists of nucleosides from position +1 to position +10, +11, +12, +13, +14, +15, +16, +17, +18, +19, +20, +21, +22, +23, +24 or +25, preferably from position +2 to position +10, +11, +12, +13, +14, +15, +16, +17, +18, +19, +20, +21, +22, +23, +24 or +25, more preferably from position +2 to position +15, +16, +17, +18, +19, +20, +21, +22, +23 or +24, more preferably from position +2 to position +19, +20, +21, +22, +23 or +24; and / or (b) the 3′ mixed polymer region comprises or consists of nucleosides from position -1 to position -3, -4, -5, -6, -7, -8, -9, -10, -11, -12, -13, -14, -15, -16 or -17, preferably from position -2 to position -3, -4, -5, -6, -7, -8, -9, -10, -11, -12, -13, -14, -15, -16 or -17, more preferably from position -2 to position -5, -6, -7, -8, -9, -10, -11, -12, -13, -14, -15, -16 or -17, more preferably from position -2 to position -5, -6, -7, -8, -9 or -10.

5. The oligonucleotide according to any one of claims 2 to 4, wherein (a) the first type of 5′ mixed polymer nucleoside is selected from the group consisting of DNA, RNA, 2′-O-methyl-RNA, 2′-O-methoxyethyl-RNA (MOE-RNA), 2′-fluoro-RNA, linking nucleic acid (LNA), arabino nucleic acid (ANA) and 2′-fluoroarabino nucleic acid (FANA) nucleosides, preferably wherein the first type of 5′ mixed polymer nucleoside is a 2′-O-methyl-RNA nucleoside or a 2′-fluoro-RNA nucleoside, more preferably a 2′-fluoro-RNA nucleoside; and / or (b) the second type of 5′ mixed polymer nucleoside is selected from the group consisting of DNA, RNA, 2′-O-methyl-RNA, MOE-RNA, 2′-fluoro-RNA, LNA, ANA and FANA nucleosides, preferably wherein the second type of 5′ mixed polymer nucleoside is a 2′-O-methyl-RNA nucleoside or a 2′-fluoro-RNA nucleoside, more preferably a 2′-O-methyl-RNA nucleoside; and / or (c) the first type of 3′ mixed polymer nucleoside is selected from the group consisting of DNA, RNA, 2′-O-methyl-RNA, MOE-RNA, 2′-fluoro-RNA, LNA, ANA and FANA nucleosides, preferably wherein the first type of 3′ mixed polymer nucleoside is a 2′-O-methyl-RNA nucleoside or a 2′-fluoro-RNA nucleoside, more preferably a 2′-O-methyl-RNA nucleoside; and / or (d) The second type of 3′ mixed polymer nucleoside is selected from the group consisting of DNA, RNA, 2′-O-methyl-RNA, MOE-RNA, 2′-fluoro-RNA, LNA, ANA and FANA nucleosides, preferably wherein the second type of 3′ mixed polymer nucleoside is a 2′-O-methyl-RNA nucleoside or a 2′-fluoro-RNA nucleoside, more preferably a 2′-fluoro-RNA nucleoside.

6. The oligonucleotide according to claim 5, wherein The first type of 5′ mixed polymer nucleosides are 2′-fluoro-RNA nucleosides, The second type of 5' mixed polymer nucleosides are 2'-O-methyl-RNA nucleosides, The first type of 3' mixed polymer nucleosides are 2'-fluoro-RNA nucleosides, and The second type of 3' mixed polymer nucleosides are 2'-O-methyl-RNA nucleosides.

7. The oligonucleotide according to any one of claims 1 to 6, wherein (a) the nucleoside at one or more of positions +3, +5, +7, +9, +11, +13, +15, +17 and +19 is a 2′-fluoro-RNA nucleoside, preferably wherein the nucleoside at each of positions +3, +5, +7, +9, +11, +13, +15, +17 and +19 is a 2′-fluoro-RNA nucleoside; and / or (b) the nucleoside at one or more of positions -3, -5, -7 and -9 is a 2'-fluoro-RNA nucleoside, preferably wherein the nucleoside at each of positions -3, -5, -7 and -9 is a 2'-fluoro-RNA nucleoside; and / or (c) the nucleoside at one or more of positions +2, +4, +6, +8, +10, +12, +14 and +18 is a 2′-O-methyl-RNA nucleoside, preferably wherein the nucleoside at each of positions +2, +4, +6, +8, +10, +12, +14 and +18 is a 2′-O-methyl-RNA nucleoside; and / or (d) the nucleoside at one or more of positions -2, -4 and -6 is a 2'-O-methyl-RNA nucleoside, preferably wherein the nucleoside at each of positions -2, -4 and -6 is a 2'-O-methyl-RNA nucleoside.

8. The oligonucleotide according to any one of claims 1 to 7, wherein (a) the nucleoside at position -2 is a 2′-O-methyl-RNA nucleoside; and / or (b) the nucleoside at position -3 is a 2′-fluoro-RNA nucleoside; and / or (c) the nucleoside at position -8 is a 2′-fluoro-RNA nucleoside; and / or (d) the nucleoside at position +16 is a 2′-fluoro-RNA nucleoside; and / or (e) The nucleoside at position +17 is a 2'-fluoro-RNA nucleoside.

9. The oligonucleotide according to any one of claims 1 to 7, wherein (a) the nucleoside at position -8 is a 2′-O-methyl-RNA nucleoside; and / or (b) The nucleoside at position +16 is a 2'-O-methyl-RNA nucleoside.

10. The oligonucleotide according to any one of the preceding claims, wherein the oligonucleotide is used to edit a target nucleic acid comprising a target adenosine, wherein the oligonucleotide is capable of effecting the conversion of the target adenosine (A) to inosine (I). The oligonucleotide according to claim 10 , wherein the target nucleic acid is SERPINA1 mRNA.

12. The oligonucleotide according to any one of claims 1 to 11, wherein all nucleosides of the editing region are DNA nucleosides.

13. The oligonucleotide of any one of claims 1 to 11, wherein the editing nucleoside is a FANA nucleoside and all other nucleosides in the editing region are DNA nucleosides.

14. An oligonucleotide according to any one of the preceding claims, wherein the oligonucleotide is 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleosides long, preferably 35, 36, 37, 38, 39, 40, 41, 42, 43, 44 or 45 nucleosides long, more preferably 40 nucleosides long.

15. An oligonucleotide according to any one of the preceding claims, wherein (a) the oligonucleotide comprises exactly 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleosides 5′ of the editing nucleoside, preferably 24, 25, 26 or 27 nucleosides 5′ of the editing nucleoside, more preferably exactly 24 nucleosides 5′ of the editing nucleoside; and / or (b) the oligonucleotide comprises exactly 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleosides 3′ of the editing nucleoside, preferably exactly 12, 13, 14 or 15 nucleosides 3′ of the editing nucleoside, more preferably exactly 15 nucleosides 3′ of the editing nucleoside.

16. An oligonucleotide according to any one of the preceding claims, wherein the sequence of the oligonucleotide comprises a sequence from: CUCUAAAAACAUGGCCCCAGCAGCUUCAGUCCCUUUC TCI UCGAUGGUCAGCACAGCCUUAUGCACGGCCUUGGUGU (SEQ ID NO 87), or 30 to 61 consecutive nucleosides from a variant of SEQ ID NO 87, said variant comprising exactly 1, exactly 2 or exactly 3 single nucleoside substitutions, wherein I is inosine, and wherein the oligonucleotide comprises positions 38, 39 and 40 of SEQ ID NO 87.

17. An oligonucleotide according to any one of the preceding claims, wherein the sequence of the oligonucleotide comprises the same as SEQ ID NO 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 85, or alternatively consists of a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to any of 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, and 86.

18. An oligonucleotide according to any one of the preceding claims, wherein the sequence of the oligonucleotide comprises or consists of a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to SEQ ID NO 32.

19. An oligonucleotide according to any one of the preceding claims, wherein the oligonucleotide comprises or consists of any one of: CMP ID NO 1_1、2_1、3_1、3_2、3_3、4_1、5_1、6_1、7_1、8_1、9_1、10_1、11_1、12_1、13_1、14_1、15_1、16_1、17_1、18_1、19_1、20_1、21_1、22_1、23_1、24_1、25_1、26_1、26_2、26_3、26_4、26_5、26_6、26_7、26_8、26_9、27_1、28_1、29_1、30_1、31_1、32_1、32_2、32_3、32_4、32_5、32_6、32_7、32_8、32_9、32_10、32_11、32_12、32_13、32_14、32_15、32_16、32_17、32_18、32_19、32_20、32_21、32_22、32_23、32_24、32_25、32_26、32_27、32_28、32_29、32_30、32_31、32_32、32_33、32_34、32_35、32_36、32_37、32_38、32_39、32_40、32_41、32_42、32_43、32_44、32_45、32_46、32_47、32_48、32_49、32_50、32_51、32_52、32_53、32_54、32_55、32_56、32_57、32_58、32_59、32_60、32_61、32_62、32_63、32_64、32_65、32_66、32_67、32_68、32_69、32_70、32_71、32_72、32_73、32_74、32_75、32_76、32_77、32_78、32_79、32_80、32_81、32_82、32_83、33_1、34_1、35_1、36_1、371、38_1、39_1、40_1、40_2、40_3、40_4、40_5、40_6、40_7、40_8、40_9、4010、41_1、41_2、41_3、41_4、41_5、41_6、41_7、41_8、41_9、41_10、42_1、422、42_3、42_4、42_5、42_6、431、43_2、43_3、44_1、45_1、46_1、47_1、472、48_1、49_1、50_1、51_1、52_1、53_1、54_1、55_1、56_1、57_1、58_1、59_1、60_1、61_1、62_1、63_1、64_1、65_1、66_1、67_1、68_1、69_1, 70_1, 71_1, 72_1, 73_1, 74_1, 75_1, 76_1, 77_1, 78_1, 79_1, 80_1, 81_1, 82_1, 83_1, 84_1, 85_1 and 86_1.

20. An oligonucleotide according to any one of the preceding claims, wherein the oligonucleotide comprises or consists of CMP ID NO 32_1.

21. An oligonucleotide as depicted in Figure 29.

22. An oligonucleotide conjugate comprising the oligonucleotide according to any one of the preceding claims covalently attached to at least one conjugate moiety.

23. The oligonucleotide or oligonucleotide conjugate according to any one of the preceding claims, wherein the oligonucleotide or the oligonucleotide conjugate is in the form of a pharmaceutically acceptable salt.

24. A pharmaceutical composition comprising the oligonucleotide or oligonucleotide conjugate according to any one of claims 1 to 23, and a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.

25. An in vitro or in vivo method for editing a target nucleic acid in a target cell, the method comprising administering to the target cell an effective amount of an oligonucleotide or oligonucleotide conjugate according to any one of claims 1 to 23 or a pharmaceutical composition according to claim 24.

26. The oligonucleotide or oligonucleotide conjugate according to any one of claims 1 to 23 or the pharmaceutical composition according to claim 24 for use in treating or preventing a disease in a subject.

27. The oligonucleotide for use, the oligonucleotide conjugate for use or the pharmaceutical composition for use according to claim 26, wherein the disease is alpha 1 antitrypsin deficiency (A1AD).

Images