Application of KAT5 inhibitors in cancer treatment drugs, drugs for the treatment of endometrial cancer

Abstract

This application belongs to the field of biomedicine technology, and in particular relates to the use of a KAT5 inhibitor in a cancer treatment drug, as well as a drug for treating endometrial cancer. The use of a KAT5 inhibitor in a cancer treatment drug includes applying a KAT5 inhibitor to a drug for treating cancer. This application applies a KAT5 inhibitor to a drug for treating cancer. The small molecule KAT5 inhibitor can achieve anti-tumor activity by inducing accumulation of cellular DNA damage. Furthermore, the KAT5 inhibitor can significantly inhibit the growth of cancer cells both in vitro and in vivo. This application, through verification experiments, has for the first time clarified the anti-tumor effect of a KAT5 inhibitor, which has important pharmaceutical development value and market benefits.

Description

Technical Field

[0001] The present application belongs to the field of biomedicine technology, and in particular relates to the use of a KAT5 inhibitor in cancer treatment drugs, and a drug for treating endometrial cancer. Background Art

[0002] Endometrial cancer accounts for 20% to 30% of female reproductive tract malignancies. Globally, there are approximately 142,000 new cases and 42,000 deaths each year. In recent years, the incidence rate in Asia has shown a significant increase, with a younger age group. The primary clinical manifestation of endometrial cancer is postmenopausal bleeding. Local symptoms of some advanced endometrial cancers include abdominal distension, abdominal pain, and urinary and bowel dysfunction. Currently, the diagnosis of endometrial cancer relies primarily on histological examination of endometrial tissue samples, but this invasive procedure is only suitable for patients who demonstrate endometrial pathology or endometrial thickening on transvaginal ultrasound scans. For the vast majority of postmenopausal women, the positive and predictive rates of histological examinations are low, so most women still require additional testing to screen for significant cancerous changes.

[0003] Endometrial cancer is treated with a combination of surgery, supplemented by chemotherapy and radiotherapy. While patients receiving adjuvant chemotherapy can achieve higher survival rates, the significant side effects of chemotherapy can severely impact patients' quality of life. In recent years, targeted therapy and precision medicine have provided new avenues for the treatment of endometrial cancer. For example, patients with p53 (phosphoprotein 53) abnormalities in their tumors have benefited from targeted therapies, while those with MMRD (mismatch repair deficient) tumors are expected to benefit from treatments such as carboplatin and paclitaxel. However, these treatment options remain under investigation.

[0004] Currently, there is still a lack of effective treatments for cancer, especially endometrial cancer. Summary of the Invention

[0005] The purpose of this application is to provide a use of a KAT5 inhibitor in a cancer treatment drug, as well as a drug for treating endometrial cancer, aiming to solve the problem of the lack of effective methods for existing cancer treatments.

[0006] To achieve the above application objectives, the technical solutions adopted in this application are as follows:

[0007] In a first aspect, the present application provides a use of a KAT5 inhibitor in a drug for treating cancer, including applying the KAT5 inhibitor to a drug for treating cancer.

[0008] In some possible implementations, the KAT5 inhibitor includes Nu9056.

[0009] In some possible implementations, the cancer includes endometrial cancer.

[0010] In some possible implementations, the KAT5 inhibitor inhibits cancer cell growth by inducing accumulation of DNA damage in cancer cells.

[0011] In some possible implementations, the KAT5 inhibitor is used to regulate the levels of γ-H2AX and RAD51 proteins in endometrial cancer cells.

[0012] In some possible implementations, the KAT5 inhibitor is used to induce accumulation of γ-H2AX protein levels in endometrial cancer cells while inhibiting RAD51 protein expression.

[0013] In some possible implementations, the treatment of cancer with the KAT5 inhibitor includes in vitro treatment and in vivo treatment.

[0014] In some possible implementations, the KAT5 inhibitor has an inhibition rate of no less than 23% on endometrial cancer cells.

[0015] In a second aspect, the embodiments of the present application provide a drug for treating endometrial cancer, comprising a KAT5 inhibitor and excipients.

[0016] In some possible implementations, the KAT5 inhibitor includes Nu9056.

[0017] In some possible implementations, in the case of in vitro treatment, the effective concentration of the KAT5 inhibitor in the drug for treating endometrial cancer is 40 μM to 50 μM.

[0018] In some possible implementations, in the case of in vivo treatment, the effective concentration of the KAT5 inhibitor in the drug for treating endometrial cancer is 4 mM to 10 mM.

[0019] In some possible implementations, the dosage form of the drug for treating endometrial cancer includes an injection.

[0020] In some possible implementations, the excipient includes at least one solvent selected from dimethyl sulfoxide, phosphate buffer, Tween-80, and glucose injection.

[0021] The first aspect of the present application provides the use of KAT5 inhibitors in cancer treatment drugs. The present application has found through research that knocking down KAT5 in cancer cells inhibits the growth of cancer cells, and therefore KAT5 can be used as a therapeutic target for cancer. KAT5 inhibitors are applied to drugs for the treatment of cancer. The small molecule KAT5 inhibitors can achieve anti-tumor activity by inducing the accumulation of cellular DNA damage. Moreover, the KAT5 inhibitors can significantly inhibit the growth of cancer cells both in vitro and in vivo. Through verification experiments, the present application has clarified for the first time the effect of KAT5 inhibitors in anti-tumor aspects, which has important pharmaceutical development value and market benefits.

[0022] The drug for treating endometrial cancer provided in the second aspect of the present application contains a KAT5 inhibitor. The small molecule KAT5 inhibitor can induce the accumulation of γ-H2AX protein levels in endometrial cancer cells, while inhibiting RAD51 protein expression, inducing the continuous accumulation of DNA damage in endometrial cancer cells, achieving anti-tumor activity, and thus treating endometrial cancer. Therefore, the drug for treating endometrial cancer in the present application has an excellent therapeutic effect on endometrial cancer, and has a significant effect of inhibiting the growth of endometrial cancer both in vitro and in vivo, and has important medical value and market benefits. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the following briefly introduces the drawings required for use in the embodiments or descriptions of the prior art. Obviously, the drawings described below are only some embodiments of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without any creative work.

[0024] Figure 1 This is a spectrum of the lentiviral knockdown vector PLKO.1-puro involved in the examples of this application;

[0025] Figure 2 This is a test graph showing the effect of KAT5 knockdown on the growth status of Ishikawa, HEC-1B, and KLE cells in Example 2 of the present application;

[0026] Figure 3 This is a test graph showing the effect of KAT5 knockdown on the levels of three key proteins designed for DNA damage and repair, γ-H2AX, RAD51, and 53BP1, in Ishikawa, HEC-1B, and KLE cells in Example 3 of the present application;

[0027] Figure 4 This is a test graph showing the effect of different concentrations of Nu9056 on the viability of Ishikawa cells in Example 4 of the present application;

[0028] Figure 5This is a graph showing the cumulative changes in DNA damage detected by WB in the Ishikawa human endometrial cancer cell line after treatment with NU9056 (50 uM) for 48 hours in Example 4 of the present application;

[0029] Figure 6 This is a test graph of the effect of Nu9056 on the growth volume change of endometrial cancer cell xenografts in nude mice in Example 5 of the present application;

[0030] Figure 7 This is a test chart showing the effect of Nu9056 on the tumor weight of endometrial cancer cell xenografts in nude mice in Example 5 of the present application. DETAILED DESCRIPTION

[0031] In order to make the technical problems, technical solutions and beneficial effects to be solved by this application more clearly understood, the present application is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain this application and are not intended to limit this application.

[0032] In this application, the term "and / or" describes the relationship between associated objects, indicating that three possible relationships exist. For example, A and / or B can represent: A exists alone, A and B exist simultaneously, and B exists alone. A and B can be singular or plural. The character " / " generally indicates that the associated objects are in an "or" relationship.

[0033] In this application, "at least one" means one or more, and "plurality" means two or more. "At least one of the following" or similar expressions refers to any combination of these items, including any combination of single items or plural items. For example, "at least one of a, b or c", or "at least one of a, b and c" can all mean: a, b, c, ab (i.e., a and b), ac, bc, or abc, where a, b, c can be single or multiple.

[0034] It should be understood that in the various embodiments of the present application, the size of the serial numbers of the above-mentioned processes does not mean the order of execution. Some or all of the steps can be executed in parallel or sequentially. The execution order of each process should be determined by its function and internal logic, and should not constitute any limitation on the implementation process of the embodiments of the present application.

[0035] The terms used in the embodiments of the present application are only for the purpose of describing specific embodiments and are not intended to limit the present application. The singular forms "a", "an" and "the" used in the embodiments of the present application and the appended claims are also intended to include plural forms unless the context clearly indicates otherwise.

[0036] The weights of the relevant components mentioned in the examples of this specification may not only refer to the specific content of each component, but also represent the weight ratio between the components. Therefore, as long as the content of the relevant components in the examples of this specification is proportionally enlarged or reduced according to the examples of this specification, it is within the scope disclosed in the examples of this specification. Specifically, the mass described in the examples of this specification may be μg, mg, g, kg, etc., which are mass units commonly known in the chemical industry.

[0037] The terms "first" and "second" are used solely for descriptive purposes to distinguish objects, such as substances, from one another and should not be understood to indicate or imply relative importance or to implicitly specify the quantity of the technical features being referred to. For example, without departing from the scope of the embodiments of this application, a first XX may also be referred to as a second XX, and similarly, a second XX may also be referred to as a first XX. Thus, features defined as "first" or "second" may explicitly or implicitly include one or more of such features.

[0038] In a first aspect, an embodiment of the present application provides a use of a KAT5 inhibitor in a drug for treating cancer, wherein the KAT5 inhibitor is applied to a drug for treating cancer.

[0039] The first aspect of the present application provides an application of a KAT5 inhibitor in a drug for treating cancer. The present application has found through research that knocking down KAT5 in cancer cells inhibits the growth of cancer cells, and therefore KAT5 can be used as a therapeutic target for cancer. KAT5 inhibitors are applied to drugs for treating cancer. The small molecule KAT5 inhibitor can achieve anti-tumor activity by inducing accumulation of cellular DNA damage. Moreover, the KAT5 inhibitor can significantly inhibit the growth of cancer cells both in vitro and in vivo. The present application embodiment, through verification experiments, has clarified for the first time the effect of KAT5 inhibitors in anti-tumor aspects, which has important pharmaceutical development value and market benefits.

[0040] It should be noted that KAT5, also known as Tip60 (Tat-interactive protein, 60kDa), an example of the present application, is a histone acetyltransferase (HAT) that plays a vital role in eukaryotes. It belongs to the MYST family (MOZ, Ybf2 / Sas3, Sas2, and Tip60), and members of this family all have acetyltransferase activity. KAT5 plays a key role in a variety of cellular processes, including but not limited to DNA damage repair, cell cycle regulation, gene transcription regulation, and maintaining genomic stability. Among them, DNA damage repair: KAT5 is involved in the repair process of DNA double-strand breaks (DSBs), particularly non-homologous end joining (NHEJ) and homologous recombination (HR) pathways. It can promote these repair processes by acetylation of histones and other repair proteins. Cell cycle regulation: KAT5 affects the progression of the cell cycle by acetylation of specific cell cycle regulatory proteins, such as p53 and Chk2. These acetylation reactions can affect the stability and activity of these proteins, thereby regulating cell proliferation and apoptosis. Gene transcription regulation: As an acetyltransferase, KAT5 acetylates lysine residues on histones H3 and H4, which helps alter chromatin structure, making it more open and conducive to the binding of transcription factors and gene transcription. KAT5 can also directly acetylate transcription factors and other regulatory proteins, affecting their activity and function. Maintaining genomic stability: By participating in DNA damage repair and cell cycle regulation, KAT5 helps maintain genomic stability, preventing the mistransmission of genetic information and cell carcinogenesis.

[0041] The DNA damage repair (DDR) pathway of the present application embodiment is intended to protect cells from the influence of certain acquired genomes and monitor exogenous or endogenous DNA damage. Cytotoxic drugs targeting the DDR pathway have been used as anti-cancer treatments. The combination of DNA damaging agents and immune checkpoint inhibitors can enhance genomic instability and immunotherapy activity. For example, when exposed to chemotherapy and / or radiotherapy, DDR signals are activated by DSBs. Excessive DNA damage can cause cancer cells to die, induce the release of DAMPs, and cause an immune response. Therefore, the DDR pathway and its changes have broad application prospects in cancer treatment.

[0042] In some possible implementations, the KAT5 inhibitor includes Nu9056. The KAT5 inhibitor NU9056 in the present application is a compound with multiple biological activities, alias: 5-(1,2-Thiazol-5-yldisulfanyl)-1,2-thiazole, and the compound structure is CAS: 1450644-28-6; Molecular weight: 232.37; Molecular formula: C6H4N2S4. NU9056 is a potent and selective Tip60 (KAT5) histone acetyltransferase inhibitor. NU9056 is more than 16 times more selective for Tip60 than PCAF, p300, and GCN5. NU9056 can inhibit protein acetylation in cancer cells, reduce cell proliferation, prevent DNA damage repair, and induce cell apoptosis through cysteine ​​protease activation. In addition, the KAT5 inhibitor NU9056 in the embodiment of the present application is a small molecule drug. The structure of small molecule drugs has good spatial dispersion, and their chemical properties determine their good drugability and pharmacokinetic properties. Generally, oral administration is an option, which is widely used and convenient.

[0043] In some possible implementations, cancer includes endometrial cancer. In this case, the KAT5 inhibitor NU9056 can be applied to drugs for endometrial cancer. The present application found that Nu9056 can inhibit the growth of endometrial cancer cells. Its specific relationship with endometrial cancer cells is through inducing the accumulation of DNA damage in endometrial cancer cells. At the same time, the key genes RAD51 and 53BP1 involved in the relevant pathways of DNA damage repair were also detected, and it was found that Nu9056 inhibited the protein expression of RAD51, thereby damaging the HR repair (Homologous Recombination Repair, homologous recombination repair) pathway, resulting in the accumulation of DNA damage in cancer cells. In addition, the present application embodiment found in animal experiments that a drug containing the KAT5 inhibitor NU9056 alone can have a certain therapeutic effect. Given that its mechanism is to induce DNA damage in cancer cells, it does not require the help of related immune inducers to kill cancer cells. The treatment method of single medication in clinical practice can reduce the side effects of patients after treatment to a certain extent. The effect of KAT5 inhibitor NU9056 is independent of ER (Estrogen Receptor) expression. Nu9056 shows a killing effect on endometrial cancer cells regardless of whether ER is highly expressed or lowly expressed in endometrial cancer.

[0044] In some possible implementations, KAT5 inhibitors inhibit cancer cell growth by inducing the accumulation of DNA damage in cancer cells. The KAT5 inhibitor NU9056, an example of this application, has been experimentally demonstrated to inhibit cancer cell growth by inducing the accumulation of DNA damage in cancer cells, thereby treating endometrial cancer. This represents a novel, yet undisclosed mechanism for treating endometrial cancer. By combining immune checkpoint inhibitors, multiple therapeutic mechanisms can be utilized to enhance the efficacy of drug therapy.

[0045] In some possible implementations, KAT5 inhibitors are used to regulate the levels of γ-H2AX and RAD51 proteins in endometrial cancer cells, thereby inducing the accumulation of DNA damage in endometrial cancer cells, thereby treating endometrial cancer.

[0046] In some possible implementations, KAT5 inhibitors are used to induce accumulation of γ-H2AX protein levels in endometrial cancer cells while simultaneously inhibiting RAD51 protein expression. The KAT5 inhibitors of the present application examples induce accumulation of γ-H2AX protein levels in endometrial cancer cells while simultaneously inhibiting RAD51 protein expression, thereby inducing continuous accumulation of DNA damage in endometrial cancer cells, thereby treating endometrial cancer.

[0047] In some possible implementations, KAT5 inhibitors can be used to treat cancer both in vitro and in vivo. The KAT5 inhibitors described in this application induce the accumulation of DNA damage in cancer cells, achieving anti-tumor activity and significantly inhibiting the growth of endometrial cancer both in vitro and in vivo, demonstrating significant pharmaceutical value and market benefits.

[0048] In some embodiments, a method for inducing DNA damage in endometrial cancer cells in vitro using the KAT5 inhibitor NU9056 comprises the steps of contacting endometrial cancer cells in vitro with an effective concentration of a KAT5-specific small molecule targeted inhibitor, wherein the KAT5-specific small molecule targeted inhibitor comprises Nu9056.

[0049] In some possible implementations, the KAT5 inhibitor has an inhibition rate of no less than 23% on endometrial cancer cells. In this case, the KAT5 inhibitor has a high inhibition rate on endometrial cancer cells, high anti-tumor activity, and a good therapeutic effect on endometrial cancer.

[0050] In some embodiments, when the effective concentration of Nu9056 is 5 μM, the KAT5 inhibitor has an inhibition rate of no less than 23% on endometrial cancer cells at 48 hours and no less than 35% at 72 hours.

[0051] In some embodiments, when the effective concentration of Nu9056 is 10 μM, the KAT5 inhibitor has an inhibition rate of no less than 38% on endometrial cancer cells at 48 hours and no less than 38% at 72 hours.

[0052] In some embodiments, when the effective concentration of Nu9056 is 20 μM, the KAT5 inhibitor has an inhibition rate of no less than 48% on endometrial cancer cells at 48 hours and no less than 55% at 72 hours.

[0053] In some embodiments, when the effective concentration of Nu9056 is 30 μM, the KAT5 inhibitor has an inhibition rate of no less than 68% on endometrial cancer cells at 48 hours and no less than 70% at 72 hours.

[0054] In some embodiments, when the effective concentration of Nu9056 is 40 μM, the KAT5 inhibitor has an inhibition rate of no less than 81% on endometrial cancer cells at 48 hours and no less than 84% at 72 hours.

[0055] In some embodiments, when the effective concentration of Nu9056 is 50 μM, the KAT5 inhibitor has an inhibition rate of no less than 89% on endometrial cancer cells at 48 hours and no less than 90% at 72 hours.

[0056] In a second aspect, the embodiments of the present application provide a drug for treating endometrial cancer, comprising a KAT5 inhibitor and excipients.

[0057] The drug for treating endometrial cancer provided in the embodiments of the present application contains a KAT5 inhibitor. This small molecule KAT5 inhibitor can induce the accumulation of γ-H2AX protein levels in endometrial cancer cells, while inhibiting RAD51 protein expression, inducing the continuous accumulation of DNA damage in endometrial cancer cells, achieving anti-tumor activity, and thus treating endometrial cancer. Therefore, the drug for treating endometrial cancer in the embodiments of the present application has excellent therapeutic effects on endometrial cancer and has a significant effect of inhibiting the growth of endometrial cancer both in vitro and in vivo, and has important medical value and market benefits.

[0058] In some possible implementations, the KAT5 inhibitor includes Nu9056. In this case, Nu9056 can effectively inhibit the growth of endometrial cancer cells by inducing the accumulation of DNA damage in endometrial cancer cells. Moreover, a drug containing the KAT5 inhibitor NU9056 alone can have a certain therapeutic effect. Given that its mechanism is to induce DNA damage in cancer cells, it can kill cancer cells without the help of related immune inducers. In clinical practice, single-drug treatment can reduce the side effects of patients after treatment to a certain extent. The effect of the KAT5 inhibitor NU9056 is not dependent on ER expression. Regardless of whether ER is highly expressed or low in endometrial cancer, Nu9056 shows a killing effect on endometrial cancer cells.

[0059] In some possible implementations, in the context of in vitro treatment, the effective concentration of the KAT5 inhibitor in the drug for treating endometrial cancer is 40 μM to 50 μM. Exemplarily, the effective concentration of the KAT5 inhibitor in the drug can be any typical but non-limiting value, such as 40 μM, 41 μM, 42 μM, 43 μM, 45 μM, 46 μM, 47 μM, 48 μM, or 50 μM, or a range between any two points. At this effective concentration, the 48-hour growth inhibition rate of the KAT5 inhibitor for treating endometrial cancer is no less than 80%, fully ensuring the inhibitory effect of the KAT5 inhibitor on endometrial cancer growth, thereby ensuring the therapeutic effect on endometrial cancer.

[0060] In some possible implementations, in the context of in vivo treatment, the effective concentration of the KAT5 inhibitor in a drug for treating endometrial cancer is 4 mM to 10 mM. For example, the effective concentration of the KAT5 inhibitor in the drug can be any typical but non-limiting value, such as 4 mM, 5 mM, 6 mM, 7 mM, 8 mM, or 9 mM, or a range between any two values. At this effective concentration, the KAT5 inhibitor inhibits the growth of endometrial cancer by no less than 60%, fully ensuring the inhibitory effect of the KAT5 inhibitor on endometrial cancer growth, thereby ensuring a therapeutic effect on endometrial cancer.

[0061] In some possible implementations, the dosage form of the drug for treating endometrial cancer includes an injection. In this case, the injection is usually dosed in milliliters or micrograms, so that the amount of drug used can be accurate to the smallest unit, ensuring the accuracy of medication. Compared with oral medications, injections can directly enter the blood circulation, avoiding the absorption and metabolism of oral medications in the gastrointestinal tract, and thus taking effect faster. In addition, the injection directly enters the blood circulation, which can avoid the first-pass effect (the first-pass effect refers to the phenomenon that the drug is partially metabolized or destroyed when passing through the intestinal mucosa and liver), thereby improving the bioavailability of the drug. And injections usually have better stability.

[0062] In some possible implementations, the excipients include at least one solvent selected from dimethyl sulfoxide (DMSO), phosphate buffer, Tween-80, and glucose injection. These solvents all have a good dissolving effect on KAT5 inhibitors, making it easy to prepare injections of specific concentrations according to actual application conditions, and are flexible and convenient to use. The DMSO in the injection of the embodiment of the present application has solubility and permeability for many drugs, and it itself has anti-inflammatory, analgesic, blood circulation and wound healing effects, and has diuretic and antiseptic effects. It can increase drug absorption and improve efficacy. In addition, it can increase the local drug content in the affected area and reduce the harm of other drugs in the body. Studies have found that the half-quantity LG50 value of DMSO is (22.4±1.4) g / kg, which is non-toxic and consistent with pathological anatomy findings. In animal experiments, the local drug concentration is 2 to 8 times higher than the concentration of other drugs, which can enhance the absorption capacity of drugs dissolved by DMSO. At the same time, DMSO has the ability to dissolve and penetrate the keratin of cancer tissue, improving efficacy. The use of DMSO as a solvent in the injection of the present application embodiment can increase the component content of the KAT5 inhibitor NU9056, thereby improving the efficacy.

[0063] In some embodiments, the solvent in the injection includes dimethyl sulfoxide, and when diluted for use, solvents such as phosphate buffer, Tween-80 (polysorbate 80 or polyoxyethylene sorbitan monooleate) and 5% glucose injection can be used.

[0064] In some embodiments, the original powder of the KAT5 inhibitor NU9056 is fully dissolved in a solvent such as dimethyl sulfoxide, and then aliquoted for use. Upon use, the solution is diluted with PBS phosphate buffer or the like to a working solution of appropriate concentration to prepare an injection of a specific concentration.

[0065] To ensure that the above implementation details and operations of the present application can be clearly understood by those skilled in the art, as well as to demonstrate the significant improvement in the performance of the KAT5 inhibitors in the examples of the present application in treating cancer and the drugs for treating endometrial cancer, the above technical solutions are illustrated below through multiple examples.

[0066] This example investigates the effect of knocking down KAT5 in endometrial cancer cells on their growth inhibition, validating KAT5 as a therapeutic target for endometrial cancer. Furthermore, the KAT5 inhibitor NU9056 demonstrated antitumor activity against endometrial cancer in vivo and in vitro. The details are as follows:

[0067] Example 1

[0068] The present application example is a method for constructing a PLKO.1-puro-KAT5-shRNA plasmid. Taking a lentiviral knockdown vector and packaged lentivirus as an example, the method for knocking down the KAT5 gene and protein in endometrial cancer is described. In the present application example, the PLKO.1-puro plasmid vector was purchased from addgene (https: / / www.addgene.org / ), and the spectrum is shown in FIG. Figure 1 .

[0069] In this embodiment, the method for constructing a viral knockdown vector containing the KAT5 gene includes the following steps:

[0070] 1. Design of KAT5-shRNA sequence:

[0071] Using the shRNA design website (https: / / www.sigmaaldrich.cn / CN / zh / semi-configurators / shrna?activeLink=reviewAndConfirm), based on the target gene KAT5 and the species, the target sequence was determined to be CGTCCATTACATTGACTTCAA (the sense sequence) from the validated target sequences. From this, the antisense sequence (an RNA sequence complementary to the target mRNA sequence) was inferred. AgeI and EcoRI restriction enzyme sites were selected for the PLKO.1-puro vector. Based on the characteristics of the constructed shRNA and the restriction enzyme sites of the vector, the final template sequences were determined as follows: 5'-CCGGCGTCCATTACATTGACTTCAATTCAAGAGATTGAAGTCAATGTAATGGACGTTTTTTGGTACC-3'; 3'-GCAGGTAATGTAACTGAAGTTAAGTTCTCTAACTTCAGTTACTAATGGAGCAAAAAACCATGGTTAA-5'. After synthesis, the two oligonucleotides were annealed. The annealing step involved mixing the two oligonucleotides in an equimolar ratio in annealing buffer (10 mM Tris-HCl (pH 7.5), 50 mM NaCl, and 1 mM EDTA), heating to 100°C for 5 minutes, and then slowly cooling to room temperature (25°C) to obtain a double-stranded KAT5-shRNA structure. The vector was then double-digested and ligated.

[0072] 2. Double digestion of lentiviral vector with AgeI and EcoRI:

[0073] AgeI restriction site: The AgeI restriction site is ACCGGT (or the reverse complementary sequence CCGGTT), which is a 6-base pair recognition sequence.

[0074] EcoRI restriction site: The EcoRI restriction site is GAATTC (or the reverse complementary sequence CTTA AG), which is also a 6-base pair recognition sequence.

[0075] Double enzyme digestion reaction system: 2 μg (2 μl) vector, 1 μl of each endonuclease, 2 μl of 10× Fast Digest buffer, 14 μl of deionized water, total volume 20 μl;

[0076] Double enzyme digestion reaction program: 37°C for 20 minutes, add 1 μl of CIP (2-chloro-1,3-dimethylimidazolium hexafluorophosphate), and continue at 37°C for 10 minutes. After the digestion is completed, the digestion product is purified using a PCR purification kit.

[0077] 3. Ligation of the digested product and the target fragment:

[0078] Ligation reaction system: 10 μl buffer, 1 μl vector, 3-6 μl PCR product, 1 μl quic kligase rapid ligase (NEB, Cat: M2200), add deionized water to a total volume of 20 μl, and let it stand at room temperature for 15 minutes to obtain the ligation product.

[0079] 4. Transformation of ligation products:

[0080] In the examples of the present application, after ligation, the ligation product is preferably transformed into an Escherichia coli competent cell to obtain a lentiviral knockdown vector connected to the KAT5 gene. The transformation method is performed using a 42°C heat shock method. Screening culture is preferably performed on an LB agarose plate containing 100 μg / ml ampicillin antibiotics. The screening culture temperature is preferably 36-38°C, more preferably 37°C, and the screening culture time is preferably 8-16 hours, more preferably 12 hours. After screening culture, a single colony was picked for sequencing, and the sequencing results were analyzed: the alignment results showed that the PLKO.1-Puro-KAT5-shRNA sequencing results were consistent with the designed sequence.

[0081] 5. Lentivirus packaging:

[0082] In the examples of the present application, the method for packaging a lentivirus containing a KAT5-shRNA vector preferably includes the following steps:

[0083] A. 293-T cells were trypsinized one day before transfection to obtain single-cell 293-T cells for further culture.

[0084] B. When the density of single-cell 293-T cells reached 70% to 80%, a mixture of a lentiviral knockdown vector containing the KAT5-shRNA gene, a lentiviral packaging vector (PPAX2, PMD2.G), Lipofectamine 2000 transfection reagent (Thermo Scientific, USA), and Opti-MEM medium with reduced serum was added for transfection; the lentiviral packaging process for the blank vector control was the same as above.

[0085] 8 hours after transfection, replace the culture medium with DMEM high-glucose complete medium (DMEM + 10% FBS + 1% P / S) and continue culturing. 48-72 hours after transfection, collect the culture medium and centrifuge at 500×g for 10 minutes. Collect the supernatant to obtain the lentiviral solution containing the KAT5-shRNA gene. Aliquot the amount of virus used into 1.5ml EP tubes and store at -80°C. The blank vector control lentiviral solution was processed the same way as above.

[0086] 6. Construction of stable cell lines:

[0087] In the examples of the present application, the method for constructing a stably transfected cell line containing a KAT5-shRNA vector preferably includes the following steps:

[0088] A. Resuscitate Ishikawa, HEC-1B and KLE cells, and subculture them when the cells grow to 80% to 90% density, and subculture them 2 to 3 times.

[0089] B. Culture Ishikawa, HEC-1B and KLE cells, and digest and count the cells when the cells grow to 80% to 90%. 5 Cells were seeded into 6-well plates at a density of 10 cells / well.

[0090] The next day after the cells adhered to the wall, the lentivirus constructed in Example 1 and the blank vector control virus were added at an MOI of 50 (the added dose of lentivirus was 10 μl / 10 5 cell); continue culturing in a 37°C, 5% CO2 incubator overnight.

[0091] 24 hours after the addition of virus D, the medium was replaced with MEM (minimum essential medium) + 10% FBS (fetal bovine serum) + 1% P / S (penicillin / streptomycin) + 1% NEAA non-essential amino acids (ishikwa / HEC-1B) and DME M + 10% FBS + 1% P / S (KLE) complete medium.

[0092] 48 hours after the addition of virus E, puromycin was added at a final concentration of 2 μg / ml for drug screening for 48 to 72 hours.

[0093] F. After the drug screening of the blank control group cells is complete, a KAT5 knockdown stable cell line is obtained.

[0094] Example 2

[0095] The present application example explores the in vitro anti-tumor activity of KAT5 knockdown stably transfected cell lines:

[0096] 1. The experimental method uses the Prestoblue method:

[0097] Human endometrial cancer cells (Ishikawa and HEC-1B) were cultured in MEM (containing 10% FBS, 1% P / S, and 1% NEAA), while KLE (human endometrial cancer) cells were cultured in DMEM (containing 10% FBS, 1% P / S) in a 5% CO2, 37°C incubation. Lentivirally infected cells (Ishikawa, HEC-1B, and KLE) were harvested, the cell suspension concentration adjusted, and plated into 96-well plates. The cells were plated to a density of approximately 1000 cells / well, with 100 μL of cell suspension per well. The plates were incubated in a 5% CO2, 37°C incubator for 6-8 hours. Cell attachment was observed under a microscope. Finally, a blank vector-infected group served as a blank control. The plates were then incubated in a 5% CO2, 37°C incubator. After 48 hours, the plates were removed, and 10 μL of PrestoBlue (10×) solution was added to each well. The cultures were incubated for an additional 30 minutes before terminating. Place the plate in a 4°C low-temperature centrifuge at 5000 rpm for 10 min to completely eliminate bubbles. Detect the absorbance of each well at 535-560 nm using an automatic microplate reader.

[0098] 2. The experimental results are as follows Figure 2 As shown, attached Figure 2 This figure shows the effect of KAT5 knockdown on the growth of Ishikawa, HEC-1B, and KLE cells. shKAT5 represents KAT5 knockdown, while shCtrl represents the control group. The OD value on the vertical axis represents optical density, corresponding to cell concentration. The results show that KAT5 knockdown significantly inhibits the growth of Ishikawa, HEC-1B, and KLE human endometrial cancer cells.

[0099] Example 3

[0100] The examples of this application further explore the anti-tumor mechanism of knocking down KAT5:

[0101] Western blotting or immunoblotting analysis: After knocking down KAT5 in ishikawa, HEC-1B, and KLE cells, proteins were extracted from the cells using RIPA buffer (Beyotime / Biyuntian) containing 1% PMSF (phenylmethylsulfonyl fluoride) and 1% protease and phosphatase inhibitor cocktail. After repeated scraping with a cell brush, the protein sample was placed on ice for 10 minutes, shaken once every 5 minutes, and then centrifuged at 4°C and 12000 rpm for 10 minutes to collect the supernatant. Then, Pierce TM Protein concentration was quantified using Rapid Gold BCA Protein Assay Kit (Thermo Scientific, Waltham, MA, USA). 30 μg of protein was separated by SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) at 120 V for 50 min and transferred to a 0.2 μm Immunofluorescence microscope. PVDF (polyvinylidene fluoride) membrane (Bio-Rad, Hercules, CA, USA). Then blocked with TBST (Tris-buffered saline with Tween 20) solution containing 5% skim milk at room temperature for 60 minutes. The primary antibody (1:1000) was used to incubate the PVDF membrane overnight at 4°C. The membrane was then washed 3 times with TBST for 10 minutes each time and incubated with the secondary antibody (1:10000) at room temperature on a low-speed shaker for 60 minutes. Afterwards, protein expression was exposed using ECL ultrasensitive detection reagent (GE Healthcare, Buckinghamshire, UK) and detected using ChemiDoc. TM Images were captured using the MP imaging system and Image Lab 5.1 software (Bio-Rad, Hercules, CA, USA).

[0102] The experimental results are as follows Figure 3 As shown, attached Figure 3 The following figure shows the effect of KAT5 knockdown on the levels of three key proteins involved in DNA damage and repair: γ-H2AX, RAD51, and 53BP1 in Ishikawa, HEC-1B, and KLE cells. The test results show that after KAT5 knockdown, γ-H2AX protein levels increased, RAD51 protein levels decreased, and 53BP1 protein levels remained unchanged in endometrial cancer cells. This suggests that KAT5 knockdown induces the accumulation of γ-H2AX in endometrial cancer cells, a process achieved by inhibiting the key HR repair protein RAD51. This in turn induces the accumulation of DNA damage in endometrial cancer cells, thereby inhibiting their proliferation.

[0103] Example 4

[0104] The present invention explores the in vitro anti-tumor activity of the KAT5 inhibitor Nu9056:

[0105] 1. Prepare Nu9056, a specific small molecule targeted inhibitor of KAT5. The compound structure is CAS: 1450644-28-6.

[0106] 2. Dissolve Nu9056 in DMSO to prepare a stock solution for storage. Dilute to a working solution of appropriate concentration using PBS phosphate buffer before use.

[0107] 3. Using Prestoblue method:

[0108] Human endometrial cancer cells Ishikawa were cultured in MEM medium (containing 10% FBS, 1% P / S + 1% NEAA) at 5% CO2 and 37°C.

[0109] The Nu9056 stock solution was diluted with PBS to form a working solution with gradient concentrations.

[0110] Cells in logarithmic phase growth were harvested, the cell suspension concentration was adjusted, and the cell suspension was plated onto a 96-well plate. The cells to be tested were plated to a density of approximately 1000 cells / well, with 100 μL of cell suspension added to each well. The plates were incubated at 37°C with 5% CO₂ for 6-8 hours. Microscopic observation revealed adherent cell growth. 10 μL of Nu9056 was added to the plates at effective concentrations of 5 μM, 10 μM, 20 μM, 30 μM, 40 μM, and 50 μM. PBS was added as a blank control. The plates were incubated in a 37°C incubator with 5% CO₂. After 48 and 72 hours of incubation, the plates were removed and 10 μL of prestoblue (10×) solution was added to each well. The cells were incubated for an additional 30 minutes before terminating the incubation. The plates were then centrifuged at 3000 rpm in a 4°C refrigerated centrifuge for 10 minutes to completely eliminate air bubbles. The absorbance of each well was detected at 535-560 nm using an automatic microplate reader.

[0111] 4. Experimental results are as attached Figures 4-5 As shown in Table 1 below:

[0112] Among them, Figure 4 This is a test graph of the effect of different concentrations of Nu9056 on the viability of Ishikawa cells for 48 hours and 72 hours. The horizontal axis is the concentration of Nu9056, and the vertical axis OD value is the optical density, corresponding to the cell concentration. Control is the control group.

[0113] Table 1 shows the inhibition rate (%) of Nu9056 at different concentrations on the growth of Ishikawa cells after culturing for 48 h and 72 h, respectively. The calculation formula is as follows:

[0114] Growth inhibition rate = (average absorbance of blank group - average absorbance of treatment group) / average absorbance of corresponding blank group × 100%.

[0115] Table 1

[0116]

[0117] As shown in the test data in Table 1, as the concentration of Nu9056 increases, the average absorbance of the treated cells gradually decreases, indicating a decrease in cell growth rate and cell number. This suggests that increasing the effective concentration of the KAT5 inhibitor Nu9056 can more significantly inhibit cancer cell growth and exhibit a stronger inhibitory effect on cancer cells. Furthermore, in vitro treatment showed that when the effective concentration of Nu9056 was 40μM to 50μM, the inhibitory effect on cancer cells was even stronger, with an inhibition rate exceeding 89% after 48 hours and over 90% after 72 hours.

[0118] From the attached Figure 4 The test results showed that Nu9056 exhibited inhibitory activity against ishikawa human endometrial cancer cells at gradient concentrations.

[0119] Attachment Figure 5 Figure 1 shows the cumulative DNA damage in the Ishikawa human endometrial cancer cell line after 48 hours of treatment with NU9056 (50 μM, maximum dose). H2AZac is a classic downstream substrate of KAT5. NU9056's mechanism of action is to inhibit the expression of downstream substrate proteins of KAT5, rather than directly acting on KAT5, thereby inhibiting its acetylation function. This graph demonstrates that NU9056 can induce DNA damage accumulation in cancer cells. It should be noted that, as KAT5 knockdown has previously been shown to have no effect on 53BP1, 53BP1 was not tested here.

[0120] Example 5

[0121] The present invention explores the in vivo anti-tumor activity of the KAT5 inhibitor Nu9056:

[0122] 1. Test Animals: BALB / c (nu / nu) nude mice, weighing 15-19 g, 5-week-old female, bred in an SPF-grade housing facility at our laboratory, maintained at a temperature of 23 ± 2°C, with free access to food and water. A total of 12 animals were housed. They were acclimated for 7 days prior to inoculation.

[0123] 2. Drugs and Reagents: Nu9056 was dissolved in DMSO and diluted with Tween-80 and 5% glucose injection, respectively. The groups and dosing schedules were as follows: Blank control group: intraperitoneal injection of 0.1 mL of 5% glucose injection once a week for 4 consecutive weeks. Nu9056-1 group (5 mg / kg): intraperitoneal injection of 0.1 mL of Nu9056 (5 mg / kg) once a week for 4 consecutive weeks. Nu9056-2 group (10 mg / kg): intraperitoneal injection of 0.1 mL of Nu9056 (10 mg / kg) once a week for 4 consecutive weeks. Converted to molar concentration, according to the calculation formula: mass (g) = concentration (mol / L) * volume (L) * molecular weight (g / mol), assuming a mouse weight of 20g, a known molecular weight of Nu9056 of 232, and an injection volume of 0.1mL, the molar concentration of the Nu9056-1 group (5mg / kg) was calculated to be 4.3103mM, and the molar concentration of the Nu9056-2 group (10mg / kg) was 8.6206mM. In other words, for in vivo treatment, the effective concentration of Nu9056 is preferably between 4.3103mM and 8.6206mM.

[0124] 3. Experimental method: Take Ishikawa cells in logarithmic growth phase and prepare cell suspension with a concentration of 8×10 6 Cells / mL, 0.1mL / mouse was inoculated into the right abdominal cavity of nude mice to establish the Ishikawa nude mouse xenograft model. The diameter of the transplanted tumor was measured with a vernier caliper. After the tumor grew to a certain size, the animals were randomly divided into groups. The anti-tumor effect of Nu9056 was dynamically observed by measuring the tumor diameter. The tumor diameter was measured once every 3 days, and the mouse body weight was checked every 3 days. The tumor volume exceeded 150mm 3 Mice with tumors should be promptly killed with CO2. After 4 weeks, all mice were killed with CO2, and laparotomy was performed. Tumors were removed, and irrelevant tissues were carefully removed. The tumors were washed 2-3 times with PBS to remove blood, and the water was drained and stored in liquid nitrogen. The tumor volume (TV) was measured. The formula for calculating the tumor volume (TV) is: TV = 1 / 2 × a × b 2 , where a is the longest length of the tumor and b is the shortest length of the tumor.

[0125] 4. Calculate the relative tumor volume (RTV) based on the measurement results. The calculation formula is: RTV = V t / V0, where V0 is the tumor volume measured when the mice were initially dosed (i.e., d0), and V t The tumor volume at a single measurement. The evaluation index of the drug's anti-tumor activity: relative tumor proliferation rate T / C (%), calculated as follows:

[0126]

[0127] Among them, T RTV : Treatment group R TV ; C RTV : Blank group RTV.

[0128] Another evaluation index of anti-tumor activity: tumor growth inhibition rate (%), calculated as follows:

[0129] Tumor growth inhibition rate = (average tumor weight of blank group - average tumor weight of treatment group) / average tumor weight of corresponding blank group × 100%

[0130] The results of the inhibitory effect of Nu9056 on the growth of endometrial cancer cell ishikawa xenograft tumors in nude mice are shown in Table 2 (test data of the inhibitory effect of different concentrations of Nu9056 on the growth of endometrial cancer cell ishikawa xenograft tumors in nude mice) and the attached Figure 6 (Test chart showing the effect of different concentrations of Nu9056 on the growth volume changes of endometrial cancer cell xenografts in nude mice, where the horizontal axis is the number of days, corresponding to 1 to 7 days, and the vertical axis is the tumor volume) and Figure 7 (The effect of different concentrations of Nu9056 on the tumor weight of endometrial cancer cell xenografts in nude mice, where the vertical axis is the tumor weight and control is the blank control group) is shown.

[0131] Table 1

[0132] Group Relative tumor proliferation rate T / C (%) Tumor growth inhibition rate (%) Blank control group / / Nu9056-1 34.79 61.5 Nu9056-2 22.55 75.86

[0133] Experimental test results indicate that the KAT5 inhibitor NU9056 can inhibit the growth of endometrial cancer in vivo. Compared to the Nu9056-1 group (5 mg / kg), the Nu9056-2 group (10 mg / kg) exhibited a more potent inhibitory effect on endometrial cancer growth, with a lower relative tumor proliferation rate and a higher tumor growth inhibition rate.

[0134] In addition, the KAT5 inhibitor NU9056 in the examples of the present application has achieved certain therapeutic effects when used alone in animal experiments. Given that its mechanism is to induce DNA damage in cancer cells, it can kill cancer cells without the help of related immune inducers. In clinical practice, the treatment method of using a single drug can reduce the side effects of patients after treatment to a certain extent.

[0135] Furthermore, animal experiments showed that mice treated with Nu9056 had reduced tumor burden, a survival period exceeding 28 days, and maintained good growth with long-term use. This indicates that the KAT5 inhibitor NU9056 in this application example has minimal side effects and does not suppress the immune function of animals with long-term use.

[0136] The above is a further detailed description of the present invention in conjunction with specific preferred embodiments, and the specific implementation of the present invention should not be considered to be limited to these descriptions. For those skilled in the art of the present invention, without departing from the concept of the present invention, several simple deductions or substitutions can be made, which should be considered to fall within the scope of protection of the present invention.

Claims

1. Use of a KAT5 inhibitor in the preparation of a drug for treating cancer, characterized in that: The method includes applying a KAT5 inhibitor to the preparation of a drug for treating cancer, wherein the KAT5 inhibitor is Nu9056 and the cancer is endometrial cancer.

2. Use of the KAT5 inhibitor according to claim 1 in the preparation of a drug for treating cancer, characterized in that: The KAT5 inhibitor inhibits cancer cell growth by inducing the accumulation of DNA damage in cancer cells.

3. Use of the KAT5 inhibitor according to claim 2 in the preparation of a drug for treating cancer, characterized in that: The KAT5 inhibitor is used to regulate the levels of γ-H2AX and RAD51 proteins in endometrial cancer cells.

4. Use of the KAT5 inhibitor according to claim 3 in the preparation of a drug for treating cancer, characterized in that: The KAT5 inhibitor is used to induce the accumulation of γ-H2AX protein levels in endometrial cancer cells and simultaneously inhibit the expression of RAD51 protein.

5. Use of the KAT5 inhibitor according to claim 4 in the preparation of a drug for treating cancer, characterized in that: The KAT5 inhibitors can be used to treat cancer in vitro and in vivo. And / or, the KAT5 inhibitor has an inhibition rate on endometrial cancer cells of not less than 23%.

6. Use of the KAT5 inhibitor according to any one of claims 1 to 5 in the preparation of a drug for treating cancer, characterized in that: The cancer treatment drug comprises a KAT5 inhibitor and excipients.

7. Use of the KAT5 inhibitor according to claim 6 in the preparation of a drug for treating cancer, characterized in that: In the case of in vitro cell experiments, in the drug for treating endometrial cancer, the effective concentration of the KAT5 inhibitor is 40 μM to 50 μM; And / or, in the case of in vivo treatment, the effective concentration of the KAT5 inhibitor in the drug for treating endometrial cancer is 4 mM to 10 mM.

8. Use of the KAT5 inhibitor according to claim 7 in the preparation of a drug for treating cancer, characterized in that: The dosage form of the drug for treating endometrial cancer includes injection; And / or, the excipient includes at least one solvent selected from dimethyl sulfoxide, phosphate buffer, and glucose injection.

Images