An artificially synthesized promoter PH and its application in vitamin B12 producing strains

Abstract

The present invention belongs to the field of genetic engineering technology, and specifically relates to an artificial synthetic promoter PH and its application in vitamin B12 producing strains. The nucleotide sequence of the artificial promoter is shown in SEQ ID NO: 1. Functional verification shows that it can be widely used in vitamin B12 producing strains such as Sinorhizobium alfalfa, Pseudomonas denitrificans and Xylocopa glutinosus. 12 The invention also relates to a plasmid vector containing the promoter, a method for constructing a genetic engineering strain using the promoter and the corresponding strain, and the use of a host cell in initiating the expression of a target gene.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and relates to an artificially synthesized promoter, in particular to a strain containing the promoter, and also to a plasmid containing the promoter and a transformant containing the plasmid vector, as well as their applications in homologous or heterologous protein expression and in the production of vitamin B12. 12 Application of strains. Background Art

[0002] Promoters play a vital role in the initiation and regulation of gene transcription and are important components of genetic engineering. Natural promoters are sometimes difficult to achieve purposeful regulation. In order to obtain more promoters with different strengths and functions to finely regulate gene expression, more and more studies have been conducted on artificial promoters in recent years. Regulation of transcription levels directly affects the expression level of genes, and promoters are an important factor in determining transcription levels. Therefore, promoters are one of the important regulatory elements in biology. Artificial synthetic promoters refer to a promoter sequence synthesized according to practical needs. Artificial synthetic promoters can achieve more precise and quantitative regulation of genes, so that the expression intensity of each gene in the regulatory network can achieve the best combination [Yasmeen E, Wang J, Riaz M, Zhang L, Zuo K. Designing artificial synthetic promoters for accurate, smart, and versatile gene expression in plants. Plant Commun. 2023 Jul 10;4(4):100558.]. Artificial synthetic promoters are of great value for biotechnology, gene therapy and basic research on life sciences. In the process of transforming microbial metabolic engineering pathways, a common strategy is to use promoters of different strengths to finely regulate the expression of target genes, achieve a coordinated balance between the generation and utilization of various intermediate metabolites, reduce or prevent the accumulation of intermediates and toxic substances, and improve the synthesis efficiency of metabolites.

[0003] Vitamin B 12 Widely used in food additives, medicine, feed and other industries. Vitamin B 12 The synthesis pathway of vitamin B12 is very complex and difficult to synthesize chemically. It is almost always carried out through microbial fermentation. There are two synthetic pathways for vitamin B12, one is aerobic synthesis pathway and the other is anaerobic synthesis pathway. Pseudomonas denitrificans )、Adhesive Sword Fungus( Ensifer adherents ) and Sinorhizobium meliloti ( Sinorhizobium meliloti ) is synthesized through aerobic synthesis of vitamin B12 , Propionibacterium Propionibacterium freudenreichii ) is synthesized through the anaerobic pathway 12 [Liu Y, Huang W, Wang Q, Ma C, Chang Y, Su J. Research on the targeted improvement of the yield of a newVB12-producing strain, Ensifer adhaerens S305, based on genomic and transcriptomic analysis. BMC Biotechnol. 2023 Dec 11;23(1):53.]. Global demand for vitamin B 12 The growing demand has attracted widespread attention, but currently vitamin B 12 Production increase is slow.

[0004] To further investigate the production of vitamin B 12 Physiological characteristics of bacterial strains and cobalamin metabolic mechanism, enhance the production of vitamin B12 by corresponding bacterial strains 12 The ability to produce vitamin B often requires the appropriate expression of one or more genes in the bacteria, which requires a suitable promoter element. 12 The number of promoters available in a bacterial species is very limited. Summary of the invention

[0005] In order to overcome the shortcomings of the prior art, the inventor discovered a sequence on a plasmid vector. The inventor accidentally discovered that fusing it to the front of a natural promoter could enhance the expression of the natural promoter. Thus, an artificial protein was synthesized that can be used in a variety of vitamin B production. 12 Promoter in bacterial species. One of the purposes of the present invention is to provide an artificial synthetic promoter, which can drive the expression of endogenous or heterologous genes.

[0006] The present invention provides an artificial synthetic promoter, the nucleotide sequence of which is selected from the following sequences (a), (b) or (c):

[0007] (a) The artificially synthesized promoter is the nucleotide sequence shown in SEQ ID NO: 1 in the sequence listing;

[0008] (b) a nucleotide sequence having a 75% or higher identity with SEQ ID NO: 1 in the sequence listing and having promoter function;

[0009] (c) a nucleotide sequence that hybridizes with the nucleotide sequence described in (a) or (b) under high stringency conditions and has a promoter function;

[0010] Preferably, the (b) is a nucleotide sequence having more than 90% homology with SEQ ID NO: 1 in the sequence listing and having promoter function.

[0011] The present invention further provides an expression cassette containing the artificial synthetic promoter.

[0012] The present invention also provides a recombinant vector containing the artificial synthetic promoter or the expression cassette.

[0013] Specifically, the backbone vector of the recombinant vector is a broad host shuttle plasmid vector containing a replicon and a mob gene that can be recognized by Gram-negative bacteria.

[0014] More specifically, the backbone vector of the recombinant vector is PBBR1MCS2 or pME6032.

[0015] The present invention provides a recombinant bacterium containing the artificial synthetic promoter or the recombinant vector.

[0016] Specifically, the recombinant bacteria produces vitamin B 12 strains of Pseudomonas denitrificans ( Pseudomonas denitrificans )、Adhesive Sword Fungus( Ensifer adherents ) or Sinorhizobium meliloti ( Sinorhizobium meliloti ).

[0017] The present invention also provides the use of the artificial synthetic promoter in initiating the expression of target genes.

[0018] Specifically, the target gene is to synthesize vitamin B 12 Related genes, by starting the expression of the target gene to make the recombinant bacteria produce vitamin B 12 .

[0019] More specifically, the recombinant bacteria are obtained by introducing the recombinant vector.

[0020] The artificially synthesized promoter of the present invention can be used to drive the expression of endogenous or heterologous genes, especially to increase the production of vitamin B 12 The number of promoters available in the strain provides a basis for promoter engineering to be better applied to vitamin B production 12 It contributes to the expression regulation of genes in the metabolic pathways of strains. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 : Using artificial promoter P H Expressgfp Gene. SM / control means control, which is not expressed in SM bacteria gfp Gene, SM / P H Indicates the use of P in SM bacteria H Express gfp Gene, EA / control means control, not expressed in EA bacteria gfp Gene, EA / P H Indicates the use of P in EA bacteria H Express gfp Gene, PD / control means control, not expressed in PD bacteria gfp Gene, PD / P H Indicates the use of P in PD bacteria H Express gfp Gene.

[0022] Figure 2 :Sinorrhiza meliloti SM-P H -cobEABCD strain verification band. Among them, lane 1 is the successful insertion of P H Sinorhizobium meliloti SM-P H Lane 2 is the verification band of the wild Sinorhizobium meliloti SM, and lane 3 is the DNA marker. The molecular weights of the bands from top to bottom in the DNA marker lane are: 10000 bp, 8000 bp, 6000 bp, 5000 bp, 4000 bp, 3000 bp, 2000 bp, and 1000 bp.

[0023] Figure 3 : Using artificial promoter P H Overexpression of B 12 Synthetic pathway genes cobEABCD Recombinant strain B 12 Yield. DETAILED DESCRIPTION

[0024] The following examples and drawings of the present invention only illustrate specific implementation schemes for implementing the present invention. These schemes and drawings should not be understood as limiting the present invention. Any changes made without departing from the principle and essence of the present invention fall within the protection scope of the present invention.

[0025] The experimental techniques and experimental methods used in this embodiment are conventional technical methods unless otherwise specified. The materials, reagents, etc. used in this embodiment can be obtained through regular commercial channels unless otherwise specified.

[0026] Example 1: Artificial synthesis of promoter PH Sequence design

[0027] (1) Gene synthesis Artificial promoter P H , the promoter consists of a plasmid vector sequence and cobEABCD The present inventors found that this sequence can enhance the expression of some natural promoters, so they extracted it and fused it with the natural promoter to obtain an artificially designed promoter, which is used to express the target gene. The specific nucleotide sequence is shown in SEQ ID NO: 1.

[0028] Example 2: Construction of an overexpression plasmid vector containing an artificially synthesized promoter

[0029] (1) Construction of a recombinant vector, comprising the above-mentioned artificial synthetic promoter, the specific construction process is as follows:

[0030] With primer P H -F and P H -R amplification of synthetic promoter P with adapter H Nucleotide sequence; GFPmut1-F and GFPmut1-R were used to amplify the GFPmut1 fragment with a linker; pME6032 plasmid was used as a template and primers pKP-ver-F and pKP-ver-R were used to amplify the plasmid backbone pKP-Gibson with a linker. The three fragments were recombined by Gibson assembly to obtain the plasmid pKP-P H -GFP, transform 100μL E. coli DH5α competent cells. Mix well, ice bath for 30min, heat shock at 42℃ water bath for 90s, ice for 2min; add 1mL of liquid LB without antibiotics, culture at 220rpm, 37℃ incubator for 1h; centrifuge the cultured bacterial solution at 5000rpm for 5min, remove part of the supernatant, and leave 100μL to be coated on spectinomycin (100mg / L) resistance plate, place it in a 37℃ incubator and invert for 16-18h; pick colonies for colony PCR identification, verify the primers are: YZEF and YZER, and the correct band size is 1580bp. After sequencing by a sequencing company, the recombinant plasmid with correct sequencing was obtained.

[0031] Among them, P H -F, P H The sequences of pKP-ver-F, pKP-ver-R, YZEF and YZER are:

[0032] P H-F:GATGGTTCCCCCTGTACAGTGACTAATTATATGTCGTTGTGACAATTATTG (SEQ ID NO: 2);

[0033] P H -R: GTTCTTTCCTTTACTCATCAGCCCGGCTCCTGCTTTC (SEQ ID NO: 3);

[0034] GFPmut1-F:GGAGCCGGGCTGATGAGTAAAGGAGAAGAACTTTTCACTGGAG (SEQ ID NO: 4);

[0035] GFPmut1-R: CCGGGGATCCCTATTTGTATAGTTCATCCATGCCATGTGTAATC (SEQ ID NO: 5);

[0036] pKP-ver-F: TGGATGAACTATACAAATAGGGATCCCCGGGGCATGC (SEQ ID NO: 6);

[0037] pKP-ver-R: ATAATTAGTCACTGTACAGGGGGAACCATCCAACACCTG (SEQ ID NO: 7);

[0038] YZEF: GAATTAACGCCGAATTTCGGTCG (SEQ ID NO: 8);

[0039] YZER: GCCACCAATCCCCATATGGAAAC (SEQ ID NO: 9).

[0040] (2) The correctly sequenced recombinant plasmid was transformed into Pseudomonas denitrificans, Xanthomonas adhensus and Sinorhizobium meliloti for activity testing. The specific process is as follows:

[0041] pKP-P H -GFP recombinant plasmid was transformed into Pseudomonas denitrificans, Sword-like bacteria and Sinorhizobium meliloti, and single clones were picked and cultured in 5 mL of TYC medium containing spectinomycin (600 mg / L) at 32 °C and 200 rpm overnight. The fluorescence intensity (fluorescence expression intensity at absorption wavelength of 488 nm and emission wavelength of 525 nm) and the absorbance at 600 nm (OD 600 ), and the starting strain without plasmid was used as control. Each experiment was performed in triplicate. The results showed that the artificial synthetic promoter P H Can be started gfpGene expression, the results are as follows Figure 1 TYC medium (g / L): 5% tryptone, 3% yeast extract, 0.67% calcium chloride, 18% agar powder added to solid medium. LB medium (g / L): 10% sodium chloride, 10% tryptone, 5% yeast extract, 15% agar powder added to solid medium.

[0042] Example 3: Artificially synthesized promoter overexpressing B 12 Synthetic pathway genes cobEABCD Method for constructing denitrifying Pseudomonas, Xanthomonas adhering and Sinorhizobium meliloti

[0043] Taking Sinorhizobium alfalfa as an example, the following steps are included:

[0044] (1) Using the genomic DNA of Sinorhizobium alfalfa as a template, PCR amplified orf4171 The upstream homology arm and the downstream homology arm of the gene, and cobEABCD Gene;

[0045] (2) Overlap extension PCR orf4171 The upstream homology arm of the gene and the artificial promoter P H , cobEABCD Genes and orf4171 The downstream homologous arms of the gene are connected together to form the target gene fragment;

[0046] (3) PCR amplification with targeted orf4171 The gene editing plasmid vector PBBR-CasX-sgRNA of the site;

[0047] (4) Use Gibson assembly to connect the target fragment obtained in (2) and the linear plasmid fragment obtained in step (3) to obtain the gene editing plasmid PBBR-CasX-sgRNA-P H -cobEABCD;

[0048] (5) Insert the gene editing plasmid PBBR-CasX-sgRNA-P H -cobEABCD was transferred into Sinorhizobium meliloti, and apramycin was used as a selection marker to screen for positive transformants;

[0049] (6) Cultivate the positive transformants at 30-32°C until OD 600 The induction agent was added to the plate, and the colony PCR test was performed after dilution and plating. orf4171 The upstream homology arm and the downstream homology arm of the gene produce homologous recombination with the genomic DNA of Sinorhizobium meliloti;

[0050] (7) Pick the strain that has correctly undergone homologous recombination and inoculate it into a medium without apramycin. After several transfer cultures, the plasmid is lost. After smearing, place it in a 30-32℃ incubator for culture. The grown colonies are copied on plates with apramycin resistance and plates without resistance to obtain plasmid-free P H -cobEABCD expression cassette was inserted into the strain Sinorhizobium meliloti SM-P H -cobEABCD.

[0051] 1. The specific steps of step (1) are:

[0052] According to the genomic DNA sequence of Sinorhizobium meliloti SM orf4171 Genes and cobEABCD Gene sequence, design orf4171 The upstream homology arm primers of the gene (orf4171-upF, orf4171-upR), the downstream homology arm primers (orf4171-dF, orf4171-dR) and cobEABCD gene primers (cobEABCD-F, cobEABCD-R); and the genomic DNA of Sinorhizobium meliloti SM was used as template, respectively. orf4171 The upstream homology arm primer, downstream homology arm primer and cobEABCD PCR amplification of the gene orf4171 The upstream homology arm of the gene (1035bp), orf4171 The downstream homology arm of the gene (1033 bp) and the cobEABCD gene (4668 bp) were cloned with pKP-P H -GFP as template, design primer P H -1F and P H -1R, and use it to amplify P H Promoter (538 bp).

[0053] The primer sequences used are:

[0054] orf4171-upF:CGGTCGAGATCCCGGCTTCGTGTTCGACTTCCTGTTTC (SEQ ID NO: 10);

[0055] orf4171-upR: CATATAATTAGTCACTGTACAGGCGACTGGGTGCATCG (SEQ ID NO: 11);

[0056] orf4171-dF: GCAATCGCAATGATTTGAGTGATCAGGATCTTTCGACCGC (SEQ ID NO: 12);

[0057] orf4171-dR: CATTAGGCACCGCATTTTTATCAGTTATTGAAAACGCTCAAATCG (SEQ ID NO: 13);

[0058] cobEABCD-F: AGCAGGAGCCGGGCTGGTGCTCGGGCTCGGCTG (SEQ ID NO: 14);

[0059] cobEABCD-R:GATCCTGATCACTCAAATCATTGCGATTGCAAGAAAAAC (SEQ ID NO: 15);

[0060] P H -1F: CCAGTCGCCTGTACAGTGACTAATTATATGTCGTTGTGACAAATTATTG (SEQ ID NO: 16);

[0061] P H -1R: CGAGCCCGAGCACCAGCCCGGCTCCTGCTTTC (SEQ ID NO: 17).

[0062] 2. The specific steps of step (2) are:

[0063] by orf4171 The upstream homology arm of the gene and the artificial promoter P H , cobEABCD Genes and orf4171 The downstream homology arm of the gene was used as a template, and the upstream homology arm primer orf4171-upF and the downstream homology arm primer orf4171-dR were used as primers. orf4171 The upstream homology arm of the gene and the artificial promoter P H , cobEABCD Genes and orf4171 The downstream homology arms of the gene were connected together to obtain the target gene fragment (7201 bp);

[0064] 3. The specific steps of step (3) are:

[0065] Using plasmid PBBR-CasX-sgRNA as a template, primers Vector-1F, Vector-1R, Vector-2F, and Vector-2R were designed for PCR amplification to obtain a target gene. orf4171 Linearized plasmid vector fragment of the 20 nucleotide sequence of the gene (5127 bp, 4485 bp);

[0066] The primer sequences used are:

[0067] Vector-1F: ATAGAGCGAGAGCCAGCTCTCCTTTGATGCGTTTTACTTATCGGTTTCTC (SEQ IDNO: 18);

[0068] Vector-1R: GAAGTCGAACACGAAGCCGGGATCTCGACCGAAATTCG (SEQ ID NO: 19);

[0069] Vector-2F: CAATAACTGATAAAAATGCGGTGCCTAATGAGTGAGCTAACTTAC (SEQ ID NO: 20);

[0070] Vector-2R: CATCAAAGAGGGAGGCTGGCTCTCGCTCTATAACGCAGAAAGGCCCACC (SEQ IDNO: 21).

[0071] 4. The specific steps of step (4) are:

[0072] The fragment obtained in step (2) and the linear plasmid fragment obtained in step (3) were assembled by Gibson to obtain a ligation product; the product was transformed into Escherichia coli DH5α and screened at 30-32°C in a culture medium containing apramycin resistance to obtain transformants. The transformant colonies were selected for colony PCR verification (primers used were: YZ-FF / YZ-FR, YZ-N20F / YZ-N20R). If the PCR verification result of the transformant is: electrophoresis bands appear at 7418 bp and 851 bp, the product was sent for sequencing. If the sequence is correct, it means that the gene editing plasmid was successfully constructed. The above transformant is a positive transformant, and the gene editing plasmid PBBR-CasX-sgRNA-P is obtained. H -cobEABCD;

[0073] The primer sequences used are:

[0074] YZ-FF: CTGGGTGGCAGGATATATTGTGGTG (SEQ ID NO: 22);

[0075] YZ-FR: CAATACGAAAACCGCCTCTC (SEQ ID NO: 23);

[0076] YZ-N20F: GTGGCCATGAAGTTCATGCTG (SEQ ID NO: 24);

[0077] YZ-N20R:GAAGTCCAGCCGCCAGAAACAG (SEQ ID NO: 25).

[0078] 5. The specific steps of step (5) are:

[0079] The gene editing plasmid PBBR-CasX-sgRNA-P H -cobEABCD was transferred into Sinorhizobium meliloti, and screened in a culture medium containing apramycin resistance at 30-32°C to obtain transformants, which were verified by colony PCR (primers used were: YZ-FF / YZ-FR). If the PCR verification result of the transformant is: an electrophoresis band appears at 7418 bp, it proves that the gene editing plasmid PBBR-CasX-sgRNA-P H -cobEABCD was successfully transferred into Sinorhizobium alfalfa. At this time, the transformant was a positive transformant (i.e., the gene editing plasmid PBBR-CasX-sgRNA-P H -cobEABCD of Sinorhizobium meliloti SM);

[0080] 6. The specific steps of step (6) are:

[0081] The positive transformants obtained in step (5) were cultured at 30-32°C on a culture medium containing apramycin resistance. 600 When the pH value is about 0.8, add IPTG with a final concentration of 1mM for induction. After 24h of induction, dilute the cells by about 10 5 After folding, plate the transformants and perform colony PCR verification (primers used are: YZ-ISF / YZ-ISR); if the PCR verification result of the transformant is: an electrophoresis band appears at 7420 bp, it means that the genome of Sinorhizobium alfalfa SM orf4171 The gene locus was successfully inserted into P H -cobEABCD expression cassette, the transformant is a positive transformant, such as Figure 2 As shown. Then DNA sequencing was performed on the positive transformants for further verification. cobEABCD The gene overexpression strain (Sinorrhiza meliloti SM-P H -cobEABCD).

[0082] The primer sequences used are:

[0083] YZ-ISF: GCTTGCGGCCAAGCAGAATATAAG (SEQ ID NO: 26);

[0084] YZ-ISR: CATCTGTGTCGATGAGCGCAG (SEQ ID NO: 27).

[0085] 7. The specific steps of step (6) are:

[0086] The strain that has correctly undergone homologous recombination was inoculated in a culture medium without apramycin at 30-32°C and cultured several times to lose the plasmid. After plating, the plate was placed in a 30-32°C incubator for culture. The grown colonies were photocopied on plates with apramycin resistance and plates without resistance. The colonies that grew on the plates without resistance but did not grow on the plates with apramycin resistance were picked, indicating that the plasmid of this colony had been completely lost during the subculture process. Finally, a plasmid-free P was obtained. H -cobEABCD expression cassette was inserted into the strain Sinorhizobium meliloti SM-P H -cobEABCD.

[0087] The recombinant strain PD-P was obtained by the same method. H -cobEABCD and EA-P H -cobEABCD.

[0088] Example 4: Recombinant strain PD-P H -cobEABCD,EA-P H -cobEABCD and SM-P H -cobEABCD shake flask fermentation to produce vitamin B 12 Yield determination

[0089] This example provides a recombinant strain PD-P H -cobEABCD,EA-P H -cobEABCD and SM-P H -cobEABCD in vitamin B 12 The application in production includes the following steps: A seed fermentation, B production fermentation.

[0090] The medium formula of the seed fermentation is (g / L): sucrose 40, corn syrup 20, betaine 5, (NH 4)2 SO4 1, (NH4)2HPO4 2, MnSO4·H2O 0.8, CoCl2·6H2O 0.02, MgO 0.3, DMBI 0.01, ZnSO4·7H2O 0.01, CaCO3 1.5, pH was controlled at 7.0-7.4 by NaOH.

[0091] The fermentation medium formula is (g / L): 80% sucrose, 30% corn steep liquor, 15% betaine, 2% (NH4)2SO4, 1.5% MgSO4, 0.75% K2HPO4, 0.14% CoCl2·6H2O, 0.075% DMBI, 0.08% ZnSO4·7H2O, 1% CaCO3, and the pH is controlled at 7.0-7.4 by NaOH.

[0092] The specific steps of seed fermentation are: first, Pseudomonas denitrificans PD, PD-P H -cobEABCD, Adhesive Sword Bacteria EA, EA-P H -cobEABCD and Sinorhizobium meliloti SM, SM-P H -cobEABCD activation, that is, first spread the frozen bacteria on the LB solid culture medium, then inoculate the activated bacteria into the seed fermentation culture medium and culture it at 180-250 rpm and 30-32°C for 24-36h to obtain the seed culture solution; the specific steps of production fermentation are: fill 25-30mL of the production fermentation culture medium into a 250mL triangular flask, then ferment the seed culture solution with an inoculation amount of 10% (volume percentage), a rotation speed of 180-250rpm, a temperature of 30-32°C, and culture for 7 days to obtain the production fermentation solution. The specific steps of seed fermentation and production fermentation are both prior art.

[0093] The vitamin B12 in the fermented bacterial broth produced in the above embodiment was analyzed by high performance liquid chromatography (HPLC). 12 The yield was determined. Sample pretreatment: Take 1 mL of fermentation broth, add 8% sodium nitrite solution and 0.1 mL of glacial acetic acid, shake well, and place in a 95-100°C water bath for 30-60 minutes; after cooling to room temperature, centrifuge at 10,000 rpm for 1 minute, and filter the supernatant through a 0.22 μm membrane filter into a sample bottle. The amount of sodium nitrite solution and glacial acetic acid added can be adjusted accordingly with the amount of fermentation broth. The specific determination conditions are: C18-250A column (Agilent, 4.6mmid 9×250mm, 5μm). The mobile phase is 30% organic phase (methanol) and 70% inorganic phase (water), the absorption wavelength is 361nm, the column temperature is 35°C, the flow rate is 0.8mL / min, and the injection volume is 15 μL. According to vitamin B 12 The standard curve prepared by the standard product can calculate the vitamin B content in the fermentation liquid 12 of production.

[0094] The above test results are as follows Figure 3The results show that under the same seed fermentation and production fermentation conditions, compared with the prior art Pseudomonas denitrificans PD, Sword Bacteria EA and Sinorhizobium alfalfa SM, the Pseudomonas denitrificans PD-P of the present invention is superior to the conventional Pseudomonas denitrificans PD-P H -cobEABCD, sticky sword fungus EA-P H -cobEABCD and Sinorhizobium meliloti SM-P H -cobEABCD production of vitamin B in fermented bacterial broth 12 The potency has been greatly improved (increased by ~25%), indicating that the technical solution of the present invention is effective in increasing the 12 It has significant application value in terms of output.

[0095] The above are only preferred embodiments of the present invention, and are not limited to the above examples. For those skilled in the art, various changes and variations are possible under the principle of the present invention. Any modifications and improvements made should be considered within the scope of protection of the present invention.

Claims

1. An artificial synthetic promoter, characterized in that: The nucleotide sequence thereof is shown in SEQ ID NO:

1.

2. An expression cassette containing the artificial synthetic promoter as claimed in claim 1.

3. A recombinant vector containing the artificial synthetic promoter as claimed in claim 1 or the expression cassette as claimed in claim 2.

4. The recombinant vector according to claim 3, characterized in that The backbone vector of the recombinant vector is a broad host shuttle plasmid vector containing a replicon and a mob gene which can be recognized by Gram-negative bacteria.

5. The recombinant vector according to claim 4, characterized in that The vector backbone of the recombinant vector is PBBR1MCS2 or pME6032.

6. A recombinant bacterium containing the artificial synthetic promoter as claimed in claim 1, or the recombinant vector as claimed in any one of claims 3 to 5.

7. The recombinant bacterium according to claim 6, characterized in that The recombinant bacteria produces vitamin B 12 The strain was Pseudomonas denitrificans ( Pseudomonas denitrificans )、Adhesive Sword Fungus( Ensifer adherents ) or Sinorhizobium meliloti ( Sinorhizobium meliloti ).

8. Use of the artificial synthetic promoter as claimed in claim 1 in initiating the expression of a target gene.

9. The use according to claim 8, characterized in that The target gene is to synthesize vitamin B 12 Related genes, by starting the expression of the target gene to make the recombinant bacteria produce vitamin B 12 .

10. The use according to claim 9, characterized in that The recombinant bacteria are obtained by introducing the recombinant vector according to any one of claims 3 to 5.

11. The use according to claim 10, characterized in that The recombinant bacteria produces vitamin B 12 strains of Pseudomonas denitrificans ( Pseudomonas denitrificans )、Adhesive Sword Fungus( Ensifer adherents ) or Sinorhizobium meliloti ( Sinorhizobium meliloti ).

Images