Use of threonine dehydratase in regulating didymella eguicola growth and as fungicide target
By regulating the threonine dehydratase gene (Td) of Didymella segeticola, the problem of unclear pathogenic mechanism was solved, enabling the establishment of a fungicide screening model and drug development, improving the screening accuracy of fungicides, and enhancing the sensitivity to Wuyi mycin.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-24
- Publication Date
- 2026-03-10
AI Technical Summary
The existing technology does not understand the pathogenic and infection mechanisms of Didymella segeticola, which limits the development and application of fungicides. There is a lack of effective research on the pathogenic mechanism of the pathogen and the host's defense response mechanism.
By utilizing the threonine dehydratase gene (Td) to regulate the mycelial growth, pyruvate, and ATP content of Didymella segeticola, the sensitivity to Wuyi mycin was enhanced. Furthermore, a fungicide target screening model was established by knocking out or inhibiting Td gene expression to screen fungicides.
Significantly reduced mycelial growth, pyruvate and ATP content of Didymella segeticola, enhanced sensitivity to Wuyi mycin, improved the accuracy of fungicide screening, and laid the foundation for the development of new agents. Threonine dehydratase protein has broad application prospects as a fungicide target.
Smart Images

Figure CN119570832B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of biotechnology, and particularly relates to application of threonine dehydratase in regulating growth of Didymella segeticola and as a fungicide target. BACKGROUND
[0002] The genus Didymella belongs to the family Didymellaceae in the order Pleosporales in the class Dothideomycetes in the phylum Ascomycota. Fungi in this genus are known to be pathogenic to some plants (Crous, P.W., Gams, W., Stalpers, J.A., Robert, V., Stegehuis, G. MycoBank: an online initiative to launch mycology into the 21st century. Studies in Mycology, 2004, 50: 19-22; Chen, Q., Hou, L.W., Duan, W.J., Crous, P.W., Cai, L. Didymellaceae revisited. Studies in Mycology, 2017, 87: 105-159).For example, Didymella segeticola can cause leaf spot disease on Zanthoxylum bungeanum (Yang, J. Z., Chen, C. X., Yin, X. H., Xu, H., Long, H. J., Gu, G., Shu, R., Yuan, J., Zhou, H. C. Didymella segeticola is a new pathogen causing leaf spot disease on Zanthoxylum bungeanum. New Zealand Journal of Crop and Horticultural Science, 2022, 51: 694-703), tobacco (Guo, Z. N., Xie, H. L., Wang, H. C., Huang, Y., Chen, Q. L., Xiang, L. G., Yu, Z. H., Yang, X. H. Leaf spot caused by Didymella segeticola on tobacco in China. Plant Disease, 2019, 104: 1559-1560), Fritillaria taipaiensis P. Y. Li (Chen, L. J., Hu, Y. W., Huang, L., Luo, M., Wang, G. Z. Isolation and identification of two pathogens causing leaf spot of Fritillaria taipaiensis P. Y. Li. in China. Archives Of Microbiology, 2023, 206: 1), and tea (Zhao, X. Z., Wang, Y., Li, D. X., Ren, Y. F., Chen, Z. Morphological characteristics and phylogenetic analysis of Phoma segeticola var. camelliae, a new pathogen of tea. Plant Disease, 2018, 48: 556-559; Deng, X. Y., Yang, J., Wan, Y. H., Han, Y. X., Tong, H. R., Chen, Y. J. Characteristics of leaf spot disease caused by Didymella species and the influence of infection on tea quality. Phytopathology, 2023, 113: 516-527).D. segeticola var. camelliae strain GZSQ-4 (China General Microbiological Culture Collection Center, strain preservation number CGMCC 3.20152) was isolated and identified from tea leaf spot in Shiqian County, Guizhou Province by the research group of the present inventors. The pathogen can infect tea shoots, tender leaves and mature leaves, and has a serious impact on the quality and yield of tea, so it is necessary to develop a technology for the disease (Zhao X Z, Wang Y, Li D X, Ren Y F, Chen Z. Morphological characteristics and phylogenetic analysis of Phoma segeticola var. camelliae, a new pathogen of tea. Plant Disease, 2018, 48:556-559).
[0003] So far, the pathogenic biology of D. segeticola is still weak, especially the lack of reports on pathogenic mechanism of pathogen and host defense response mechanism. Although there is some research on the pathogen D. segeticola at present, and some fungicides that can prevent and control D. segeticola have been screened in production, such as zhongshengmycin, shenqinmycin, griseofulvin, carvacol and other biological pesticides (Ren, Y. F., Li, D. X., Jiang, S. L., Wang, Y., Tang, Q., Huang, H. L., Wang, D. L., Song, B. A., Chen, Z. Integration of transcriptomic and proteomic data reveals the possible action mechanism of the antimicrobial zhongshengmycin against Didymella segeticola, the causal agent of tea leafspot. Phytopathology, 2021, 111: 2238-2249; Zhao, X. Z., Chen, Z., Yu, L., Hu, D. Y., Song, B. A. Investigating the antifungal activity and mechanism of a microbial pesticide shenqinmycin against Phoma sp. Pesticide Biochemistry and Physiology, 2018, 147: 46-50; Huang, H. K., Li, D. X., Jiang, S. L., Yang, R., Yang, Y. Q., Xia, Z. Q., Jiang, X. Y., Zhao, Y. T., Wang, D. L., Song, B. A., Chen, Z. Integrated transcriptome and proteome analysis reveals that the antimicrobial griseofulvin targets Didymella segeticola beta-tubulin to control tea leafspot. Phytopathology, 2023, 113: 194-205; Yin, J. Y., Wu, S., Yang, Y. L., Wang, D. L., Ma, Y., Zhao, Y. T., Sheth, S., Huang, H.L., Song, B. A., Chen, Z. In addition to damaging the plasma membrane, phenolic monoterpenoid carvacrol can bind to minor groove of DNA of Phytopathogenic fungi to potentially control tea leaf spot caused by Lasiodiplodia theobromae. Phytopathology, 2023, 114: 700-716). But due to the unclear pathogenic mechanism and infection mechanism of D. segicola, the development and application of fungicides are limited, so it is very important to construct a D. segicola fungicide target screening model and study the mechanism of fungicides. SUMMARY
[0004] In view of this, one of the purposes of the present application is to provide the application of threonine dehydratase gene Td in any one of the following 1)-5):
[0005] 1) regulating the mycelial growth of Didymella segicola;
[0006] 2) regulating the content of pyruvic acid in Didymella segicola;
[0007] 3) regulating the content of ATP in Didymella segicola;
[0008] 4) regulating the sensitivity of Didymella segicola to Wuyi mycin;
[0009] 5) designing and screening antifungal drugs;
[0010] The nucleotide sequence of the Td gene is as shown in SEQ ID NO. 1 or the encoded amino acid sequence is as shown in SEQ ID NO. 2.
[0011] Preferably, the regulation in the regulation of the mycelial growth of Didymella segicola, the regulation of the content of pyruvic acid in Didymella segicola and the regulation of the content of ATP in Didymella segicola is all decrease; the regulation in the regulation of the sensitivity of Didymella segicola to Wuyi mycin is increase.
[0012] The second object of the present application provides an application of threonine dehydratase gene Td in breeding a transgenic Didymella segeticola with reduced mycelial growth ability and / or reduced content of pyruvate in vivo and / or reduced content of ATP in vivo and / or increased sensitivity to Wuyi mycins, wherein the nucleotide sequence of the Td gene is shown as SEQ ID NO. 1 or the amino acid sequence encoded by the Td gene is shown as SEQ ID NO. 2.
[0013] The third object of the present application provides a method for breeding a transgenic Didymella segeticola with reduced mycelial growth ability and / or reduced content of pyruvate in vivo and / or reduced content of ATP in vivo and / or increased sensitivity to Wuyi mycins, comprising the step of reducing the expression amount or / and activity of mRNA or protein of threonine dehydratase gene Td in a recipient Didymella segeticola to obtain the transgenic Didymella segeticola, wherein the nucleotide sequence of the Td gene is shown as SEQ ID NO. 1 or the amino acid sequence encoded by the Td gene is shown as SEQ ID NO. 2.
[0014] Preferably, the method for reducing the expression amount or / and activity of mRNA or protein of threonine dehydratase gene Td in the recipient Didymella segeticola is achieved by knocking out or inhibiting or silencing the expression of the Td gene of the recipient.
[0015] The fourth object of the present application provides an application of threonine dehydratase protein as a drug target in screening fungicides, wherein the amino acid sequence of the threonine dehydratase protein is shown as SEQ ID NO. 2.
[0016] The fifth object of the present application provides a method for screening fungicides by using threonine dehydratase protein as a drug target, comprising the following steps:
[0017] 1) Protein expression and purification of threonine dehydratase gene;
[0018] 2) Prediction of candidate fungicides, wherein the prediction method comprises the following steps:
[0019] A1) Homology modeling of threonine dehydratase;
[0020] A2) Molecular docking analysis with the fungicide to be tested, wherein if the components of the fungicide to be tested can form stable chemical bonds with the residues of the homology modeled threonine dehydratase, the fungicide to be tested is determined as an intended fungicide; for the formed chemical bonds, the more and the more stable the chemical bonds are, the stronger the interaction between the two molecules is, the greater the conformational change of the protein is, the more the activity of the protein is affected, and the more outstanding the fungicidal effect of the fungicide is; in addition, the hydrogen bond in the interaction between molecules is a relatively stable chemical bond.
[0021] A3) Molecular dynamics simulation of homology modeling of threonine dehydratase and intended fungicides, confirming that threonine dehydratase has conformational changes, and then screening to obtain candidate fungicides;
[0022] 3) Micro-thermal mobility experiment is used to detect the interaction between the candidate fungicide and the purified threonine dehydratase protein in step 1), and if there is interaction, it is determined to be a fungicide.
[0023] Preferably, the method for protein expression and purification in step 1) comprises the following steps:
[0024] B1) Construction of a prokaryotic expression vector;
[0025] B2) Induced expression of a fusion protein;
[0026] B3) Purification of a fusion protein;
[0027] The number of stable chemical bonds in step 2) is at least 5.
[0028] Preferably, the fungicide component in the fungicide determined in step 3) is wuyi mycins.
[0029] The sixth object of the present application is to provide the application of wuyi mycins in regulating the structure and activity of threonine dehydratase protein.
[0030] The present application provides the application of threonine dehydratase gene (Td) derived from Didymella segeticola in regulating the growth of D. seiticola, the content of pyruvic acid in vivo, the content of ATP in vivo, and the sensitivity to wuyi mycin. After knocking out the Td gene in wild-type D. seiticola, it was found that the mycelial growth, the content of pyruvic acid in vivo, and the content of ATP in vivo of the knocked-out D. seiticola were significantly reduced. The method for screening fungicides of the present application establishes an activity screening model for fungicides with threonine dehydratase (Td) as the target, improves the accuracy of active ingredient screening, and lays a foundation for the development of new drugs. The protein expression and purification method of threonine dehydratase has the advantages of high expression amount, simple separation and purification of exogenous protein, and high recovery rate; the molecular docking analysis, molecular dynamics simulation, and micro-thermal mobility experiment prove that wuyi mycin has a strong interaction with the threonine dehydratase protein (Td) of the present application, i.e., threonine dehydratase can be used as a fungicide target. Therefore, the threonine dehydratase of the present application can be used as a fungicide target and a key protein in the pathogenesis of plant pathogenic fungi, and has a broad application prospect in the prevention and control of plant pathogenic fungi. BRIEF DESCRIPTION OF DRAWINGS
[0031] Figure 1Schematic diagram of Td gene knockout and mutant screening strategy in pathogenic bacteria D. segiticola;
[0032] Figure 2 Map of plasmid pct74;
[0033] Figure 3 Schematic diagram of microscope observation of prepared protoplasts;
[0034] Figure 4 PCR electrophoresis map for verification of transformants;
[0035] Figure 5 WT and ΔTd enzyme activity determination map;
[0036] Figure 6 WT and ΔTd colony growth condition map under different concentrations of wuyishun;
[0037] Figure 7 Restriction enzyme detection of recombinant plasmid;
[0038] Figure 8 Alignment results of target gene fragment and Td gene sequence;
[0039] Figure 9 Small-scale SDS-PAGE analysis map of fusion protein expression;
[0040] Figure 10 SDS-PAGE analysis map of finally purified protein;
[0041] Figure 11 Molecular docking and molecular dynamics simulation techniques are used to analyze the interaction between Td and wuyishun;
[0042] Figure 12 MST is used to study the in vitro interaction between Td and wuyishun. DETAILED DESCRIPTION
[0043] The application will be described in detail below with reference to the embodiments, which are only illustrative and not limited to the application scope of the application. The application is not limited to the following embodiments or examples, and any modification and variation made without departing from the spirit of the application shall be included in the scope of the application. The experimental materials used in the following examples are commercially available unless otherwise specified.
[0044] The wild strain GZSQ-4 of D. segiticola var. camelliae in the following examples was isolated and identified from tea leaf spot in Shiqian County, Guizhou Province, and was deposited with the China General Microbiological Culture Collection Center, with the strain deposit number CGMCC 3.20152. The CDS sequence of the threonine dehydratase gene Td in the strain is shown as SEQ ID NO. 1, and the amino acid sequence of the Td protein encoded by the Td gene is shown as SEQ ID NO. 2.
[0045] Experimental Example 1, Construction of D. segiticola gene knockout ΔTd mutant
[0046] The knockout and mutant screening strategy of the threonine dehydratase gene Td of D. segiticola is shown in Figure 1 The specific construction and screening method is as follows:
[0047] 1. Construction of knockout gene fragment
[0048] 1) Amplification of upstream and downstream homologous sequences of the target gene: using the genomic DNA of the wild strain CGMCC 3.20152 of D. segiticola as a template, the upstream A fragment was amplified using primers 1F and 1R, and the downstream B fragment was amplified using primers 2F and 2R. The 5' end of primer 1R has a reverse complementary sequence of primer hph-F, and the 5' end of primer 2F has a reverse complementary sequence of primer hph-R. The sequences (5' end to 3' end) of primers 1F, 1R, 2F, 2R, hph-F and hph-R are as follows:
[0049] 1F: AGGTCTATCACCAGAAGTAGCTCAG
[0050] 1R: ACCTCCACTAGCTCCAGCCAAGGTGTGTATGTTGTGTTGTGTTGGG 2F: GAATAGAGTAGATGCCGACCGGGGGGATTGAACTTCTATCACGTCTTG 2R: CATAGCTGACACAAGCGACAGC
[0051] hph-F: CTTGGCTGGAGCTAGTGGAGGT
[0052] hph-R: CCCGGTCGGCATCTACTCTATTC
[0053] 2) Amplification of the hygromycin resistance gene hph: using plasmid pct74 (map as shown in Figure 2The template is shown in Figure 1. The first half of the hygromycin resistance gene H1 (1094 bp) is amplified with primers hph-F and hph-1R, and the second half of the hygromycin resistance gene H2 (748 bp) is amplified with primers hph-1F and hph-R. The sequences of primers hph-1F and hph-1R (from 5' to 3') are:
[0054] hph-1F: CGTTGCAAGACCTGCCTGAA
[0055] hph-1R: GGATGCCTCCGCTCGAAGTA
[0056] 3) Fusion of the upstream and downstream fragments of the target gene with the hygromycin resistance gene: Overlapping PCR is used to overlap the recovered A fragment and B fragment with H1 fragment and H2 fragment, respectively, to obtain A-H1 and H2-B connecting fragments. Primers 1F / hph-1R and hph-1F / 2R are used to amplify A-H1 and H2-B fragments, respectively, and the knockout fragment is purified to a concentration of 500 ng / μL.
[0057] 2. Preparation of D. segiticola protoplasts
[0058] 1) D. segiticola is inoculated on potato glucose agar medium and cultured at 25°C for 48 h. 2-3 mL of sterile water is added to the surface of the colony, and the mycelium is broken with a loop. The mycelium suspension is transferred to CM liquid medium and shaken for 12 h. Fresh mycelium of D. segiticola is collected by filtration;
[0059] 2) 10 mL of 0.8 mol / L NaCl solution is used as an osmotic stabilizer to prepare a mixed enzyme solution of Drislase, Snailase, and Lyticase. The enzyme solution is used to lyse 5 g of the suspended mycelium at 30°C and 120 rpm for 4 h;
[0060] 3) The filtrate is collected by filtering through sterilized 2-3 layers of lens paper (fiber mesh size 45±12 μm) and washing with 0.8 mol / L NaCl. The filtrate is centrifuged at 4000 rpm for 6 min at 4°C, and resuspended in 15 mL of 1.2 mol / L STC buffer solution.
[0061] 4) The supernatant is discarded, and the protoplasts are resuspended in 1 mL of STC buffer to prepare a protoplast suspension with a concentration of 1×10 7 Figure 3
[0062] 3. P. segiticola protoplast transformation
[0063] 1) Take 200 μL of the protoplast suspension into a 50 mL centrifuge tube, add 10-20 μg of A-H1 and H2-B knockout transformation fragments, mix gently, and let stand on ice for 20 min.
[0064] 2) Add 200 μL, 200 μL, and 800 μL of 60% polyethylene glycol 4000 buffer (PTC) in sequence, mix well by inverting, let stand at room temperature for 20 min, add 5 mL of TB3 liquid medium, mix well by inverting, and let stand for 8-12 h.
[0065] 3) Centrifuge at 4000 rpm / min for 6 min at room temperature, discard the supernatant, and resuspend the remaining 1 mL with the regenerated protoplasts.
[0066] 4) Add 50 mL of warm TB3 regeneration solid medium, mix well, and prepare a plate. After 10 h of inverted culture at 25°C, overlay with PDA medium containing 50 μg / mL of hygromycin B, and culture at 25°C for 3-4 days until the transformants grow, and then subculture for 3 generations for selection.
[0067] 4. PCR verification of transformants
[0068] Extract DNA from WT and ΔTd mutants as templates, and use 4 pairs of primers to detect the upstream, downstream, hph gene, and target gene on the fusion fragment. The results are shown in Figure 4 (M: Plus II DNA Marker; lanes 1-4 are WT, lane 1: Td-up, lane 2: Td-down, lane 3: hph, and lane 4: Td; lanes 5-8 are ΔTd mutants, lane 5: Td-up, lane 6: Td-down, lane 7: hph, and lane 8: Td). The sizes of the upstream and downstream fragments, hph fragment, and target gene fragment are 1506 bp, 1521 bp, 1376 bp, and 1729 bp, respectively, which are the same as expected, proving that the transformant ΔTd mutant is obtained, and thus subsequent experiments are entered.
[0069] Example 2, biochemical experiment comparison between wild type WT and mutant ΔTd
[0070] 1. Determination of pyruvate and ATP content in wild type WT and mutant ΔTd
[0071] Inoculate WT and ΔTd into potato glucose agar medium, and perform in vivo pyruvate determination (kit: Solabio BC2205) and ATP content determination (kit: Biyun Tian S0026) after 48 h of culture at 25°C. The determination results are as follows:Figure 5 Figure 5 A: pyruvate content determination; Figure 5 B: ATP content determination), the pyruvate and ATP contents of △Td were significantly lower than those of WT, indicating that knocking out Td gene affected the synthesis of pyruvate and ATP in the strain.
[0072] 2, Colony morphology observation of WT and △Td
[0073] WT and △Td were inoculated on PDA medium respectively, and cultured at 25°C in the dark. The colony diameter was measured by cross method at 7d, and the colony morphology was observed. Five replicates were set for each treatment. As shown in Figure 6 As shown in A0 plate and B0 plate, the mycelial growth of knockout mutant △Td on PDA medium was significantly slower than that of wild type WT, indicating that Td gene affected the growth of Didymella segeticola.
[0074] 3, Sensitivity determination of WT and △Td to Wuyi mycotoxin
[0075] WT and △Td were inoculated on PDA medium containing different concentrations (20, 40, 60, 80, 100, 120, 140 μg / mL) of Wuyi mycotoxin respectively, and cultured at 25°C in the dark. The colony diameter was measured by cross method at 7d, and the colony morphology was observed. Five replicates were set for each treatment. The results showed that the indoor virulence regression equation of Wuyi mycotoxin to WT was y = 1.5442x + 1.804, R 2 = 0.9846, and the EC 50 was 82.34 μg / mL. The indoor virulence regression equation of Wuyi mycotoxin to △Td was y = 1.6399x + 2.5775, R 2 = 0.9608, and the EC 50 was 30.01 μg / mL. Compared with WT, the mycelial growth of △Td was slow, indicating that the sensitivity to Wuyi mycotoxin was increased Figure 6 Figure 6 A: WT strain; Figure 6 B: △Td strain; wherein, A1-A7, B1-B7 were Wuyi mycotoxin PDA plates corresponding to 7 concentrations from low to high.
[0076] Experimental Example 3, Prokaryotic expression and protein purification of Td gene
[0077] 1, Construction of prokaryotic expression vector of Td gene
[0078] The Td gene was synthesized by Shenguo Bioengineering (Shanghai) Co., Ltd. according to the sequence of SEQ ID NO. 1, and the synthesized Td gene was inserted into pET-28a(+) vector by double enzyme digestion to obtain a recombinant plasmidFigure 7 A: Td fragment; Figure 7 B: pET-28-Td recombinant vector; Figure 8 : Sequencing result comparison, target sequence is completely consistent with Td gene sequence).
[0079] 2. Small-scale expression of Td protein
[0080] Transformation: The recombinant plasmid was transformed into E. coli competent BL21 DE3 cells, which were then plated on plates containing 30 μg / mL kanamycin after heat shock at 42°C and cultured at 37°C.
[0081] Activation: Single colonies were picked into liquid medium containing antibiotics and cultured at 37°C.
[0082] Induction: When the OD value reached 0.6, the working concentration of 0.2-1 mM inducer IPTG was added, and the culture was continued, and the culture was incubated at 16°C overnight, and the culture without inducer was used as negative control.
[0083] Collection of bacterial cells: Centrifugation at 4000 rpm for 10 min, discard the supernatant, and collect the bacterial cells.
[0084] Expression detection: Add binding buffer (150 mL PBS, 0.2 M mercaptoethanol, 100 mL glycerol, 17.4 sodium chloride, sterile water to 1 L) to the collected bacterial cells and suspend them, and use an ultrasonic disrupter to fully dissolve them. Centrifuge to collect the supernatant, and prepare samples for the supernatant protein, and detect the results as shown in Figure 9 (M: Protein standard molecular weight; Lane 1: 16°C overnight, no IPTG; Lane 2: 16°C overnight, 0.2 mM IPTG; Lane 3: 16°C overnight, 0.4 mM IPTG; Lane 4: 16°C overnight, 0.6 mM IPTG; Lane 5: 16°C overnight, 0.8 mM IPTG; Lane 6: 16°C overnight, 1 mM IPTG) The effect of 0.8 mM IPTG induction on protein expression is better.
[0085] 3. Large-scale expression of Td protein
[0086] Re-expression: The bacterial solution was cultured in a medium containing the corresponding antibiotic, and when the OD value reached 0.6, 0.8 mM inducer IPTG was added, and the culture was incubated at 16°C overnight for large-scale expression, and the cell bacterial cells were collected by centrifugation.
[0087] 4. Td expression and purification
[0088] The large-scale sample was collected and treated for affinity purification;
[0089] Collecting crude protein: cell bacteria were dissolved with buffer (150 mL PBS, 0.2 M mercaptoethanol, 100 mL glycerol, 17.4 sodium chloride, and sterilized water to 1 L), broken by ultrasonic, and the supernatant crude protein was collected by centrifugation;
[0090] Equilibrium: the Ni-NTA filler was packed into a column, and the column was washed with Binding buffer to balance the column;
[0091] Column loading: the crude protein was incubated with the balanced column filler, and the effluent was collected;
[0092] Equilibrium: the column was washed with Binding buffer to balance the column;
[0093] Washing: the column was washed with Washing buffer, and the effluent was collected;
[0094] Elution: the column was eluted with Elution buffer, and the effluent was collected;
[0095] Purification detection: the effluent components of the crude protein were treated, sample preparation was performed, and SDS-PAGE detection was prepared.
[0096] Collection and treatment: the purified components were dialyzed into protein storage buffer 50 mM Tris, 300 mM NaCl, 0.1% sarkosyl, 2 mM DTT, pH 8.0, concentrated, filtered to remove bacteria, 1 mL / tube, and stored at -80°C.
[0097] 5. Detection of target protein
[0098] SDS-PAGE detection: the protein sample was treated, sample preparation was performed, 12% separation gel, 5% concentration gel, gel running was performed, and the molecular weight was detected (M: Marker; Lane 1: desalted protein), which was consistent with the target size and used for subsequent micro-thermal mobility technology experiments. Figure 10 , M: Marker; Lane 1: desalted protein), which was consistent with the target size and used for subsequent micro-thermal mobility technology experiments.
[0099] Example 4, molecular docking and molecular dynamics simulation and micro-thermal mobility technology experiment
[0100] 1. Molecular docking and molecular dynamics simulation
[0101] The homologous protein of Td (PDB accession number: 2XTS.1) was used as a template for homologous modeling of Td, and then molecular docking analysis was performed with the molecules to be tested. The molecules that form stable chemical bonds with the residues of threonine dehydratase are intended fungicides, and then molecular dynamics simulation is performed to screen intended fungicides that interact with threonine dehydratase and cause conformational changes in the protein to determine candidate fungicides. The process of molecular docking analysis and molecular dynamics simulation includes: through Discovery Studio TMV4.5 for protein pretreatment, hydrogenation and charge, and PyMol 2.5.4 for visualization of the processed protein; since there is no active site reported for this protein structure, this docking is in global search mode, and the entire protein is wrapped in a docking box; before docking, the energy of the small molecule drug is optimized, and all rotatable bonds are set to rotate freely, while the protein structure is minimized in energy, hydrogenated, and charged to obtain the optimal conformation, and the binding cavity is generated by clicking Pick on the protein interface in the Centroid of Workspace ligand module, with a binding cavity distance of , and the small molecule drug is subjected to 100 independent docking operations with the parameter set to SP (Standard Precision); the docking results are grouped according to RMSD (0.1 nm), and the docking conformation with the lowest binding energy and the most operations is selected as the interaction mode of the test molecule and Td. As shown in Figure 11 ( Figure 11 A: molecular docking results of Wuyi mycotoxin and Td; Figure 11 B: molecular dynamics simulation results of Wuyi mycotoxin and Td) show that Wuyi mycotoxin and Td have interaction, and the amino acids N380, N382, K175, A145, D300 of Td form stable hydrogen bonds, thus indicating that Td can be used as a target for screening fungicides, and Wuyi mycotoxin is a candidate fungicide.
[0102] 2. Verification of the interaction between Td and the candidate fungicide molecule Wuyi mycotoxin by microscale thermophoresis (MST)
[0103] Td protein sample preparation: mix 5 μL of RED-NHS dye and NHS labeling buffer by gently blowing, take 10 μL of purified desalted protein 90 μL and the above RED-NHS solution into a de-enzyme 1.5 mL centrifuge tube, mix on ice, and incubate in a dark light-proof environment at room temperature for 30 min; take 10 μL of protein fluorescence labeling solution with a capillary and place it on a microscale thermophoresis instrument for determination, and keep the protein labeling solution with a fluorescence value of 400-1200 for subsequent experiments;
[0104] Parameter setting of microscale thermophoresis instrument: Monolith NT.115 microscale thermophoresis instrument is used to study the interaction between Wuyi mycotoxin and Td, and the instrument parameters are LED power 40%, Laser power 30%, and Red excitation;
[0105] Interaction analysis of Wuyi mycotoxin and Td: microscale thermophoresis technology analysis found that Wuyi mycotoxin and Td have interaction, and the dissociation constant K d= 8.992 ± 2.380 Figure 12 Td has strong affinity with Wuyi mycins, and experiments prove that Td can be used as a target for screening fungicides.
[0106] The conventional techniques and schemes not described in detail in the above examples are well known in the art, and therefore will not be described in detail here. The above examples and / or experimental examples describe the preferred embodiments of the present application, however, the present application is not limited to the specific details of the above embodiments, and within the technical concept of the present application, various simple modifications can be made to the technical solutions of the present application, and these simple modifications all belong to the protection scope of the present application.
Claims
1. Knocking out a threonine dehydratase gene Td In any one of the following 1) - 5): 1) reduced Didymella segeticola hyphal growth ability; 2) reducing Didymella segeticola the level of pyruvate in vivo; 3) reducing Didymella segeticola the amount of ATP in vivo; 4) increase Didymella segeticola sensitivity to wuyishunisin; 5) Design and screening of anti Didymella segeticola drugs; The nucleotide sequence of the gene is as set forth in SEQ ID NO. 1 or the encoded amino acid sequence is as set forth in SEQ ID NO.
2. Td The nucleotide sequence of the gene is as set forth in SEQ ID NO. 1 or the encoded amino acid sequence is as set forth in SEQ ID NO.
2.
2. Threonine dehydratase gene Td application to a transgenic plant having reduced mycelial growth and / or reduced pyruvate content in vivo and / or reduced ATP content in vivo and / or increased sensitivity to fusaricidin Didymella segeticola application to a transgenic plant having reduced mycelial growth and / or reduced pyruvate content in vivo and / or reduced ATP content in vivo and / or increased sensitivity to fusaricidin The application also provides a method for improving the yield of threonine in plants, comprising introducing and expressing in a plant a nucleotide sequence as shown in SEQ ID NO. 1 or an amino acid sequence as shown in SEQ ID NO. 2, so that the threonine yield of the plant is improved. Td The application also provides a method for improving the yield of threonine in plants, comprising introducing and expressing in a plant a nucleotide sequence as shown in SEQ ID NO. 1 or an amino acid sequence as shown in SEQ ID NO. 2, so that the threonine yield of the plant is improved. Td The application also provides a method 3. A method for breeding a transgenic plant having reduced mycelial growth and / or reduced pyruvate content in vivo and / or reduced ATP content in vivo and / or increased sensitivity to beauvericin, characterized by, Didymella segeticola comprising knocking out a threonine dehydratase gene in the recipient Didymella segeticola Td obtaining a transgenic Didymella segeticola comprising the step of Td the nucleotide sequence of the gene is shown as SEQ ID NO. 1 or the amino acid sequence encoded is shown as SEQ ID NO. 2. 4. Use of a threonine dehydratase protein as a drug target for the screening of bactericides, characterized in that, The amino acid sequence of the threonine dehydratase protein is shown as SEQ ID NO. 2, the bacterium is Didymella segeticola , and the bactericidal agent is Wuyi bacteriocin.
5. A method for screening bactericidal agents using threonine dehydratase protein as a drug target, characterized by, comprising the following steps: 1) protein expression and purification of threonine dehydratase gene; 2) prediction of candidate fungicides, the prediction method comprising the following steps: A1) homology modeling of threonine dehydratase; A2) molecular docking analysis with the fungicide to be tested, if the components of the fungicide to be tested can form stable hydrogen bonds with the N380, N382, K175, A145 and D300 residues of the homology modeled threonine dehydratase, it is determined as the intended fungicide; A3) molecular dynamics simulation of the homology modeled threonine dehydratase and the intended fungicide, and the determination of the conformational change of the threonine dehydratase as the candidate fungicide; 3) micro-thermal mobility experiment to detect the interaction between the candidate fungicide and the purified threonine dehydratase protein in step 1), if there is interaction, it is determined as the fungicide; The amino acid sequence of the threonine dehydratase protein is shown as SEQ ID NO. 2, the bacterium is Didymella segeticola , and the bactericide is Wuyi bacteriocin.
6. The method of claim 5, wherein, The method of protein expression and purification in the step 1) comprises the following steps: B1) construction of prokaryotic expression vector; B2) induced expression of fusion protein; B3) purification of fusion protein.