Application of rapeseed ammonium transporter BnaAMT1;10 and its haplotypes

Abstract

This invention relates to the rapeseed ammonium transporter BnaAMT1;10 and the application of its haplotypes. Experiments have demonstrated that BnaAMT1;10 possesses ammonium transport capabilities. Mutations in BnaAMT1;10 inhibit rapeseed growth and nitrogen uptake and assimilation. Furthermore, under low nitrogen conditions, mutations in BnaAMT1;10 suppress rapeseed yield, while overexpression of BnaAMT1;10 increases yield. Further candidate gene association analysis identified a previously unreported superior allele that plays a crucial role in regulating the ammonium transport activity of the BnaAMT1;10 protein and rapeseed nitrogen efficiency.

Description

Technical Field

[0001] This invention belongs to the field of molecular breeding technology, specifically relating to the application of the rapeseed ammonium transporter BnaAMT1;10 and its haplotypes. Background Technology

[0002] Nitrogen (N) is an essential macronutrient for plants. For many years, agricultural demand for nitrogen has been steadily increasing. Approximately 50% of the population's food production relies on industrial fertilizers. Nitrogen utilization efficiency is generally low; crops can only utilize 30-40% of the nitrogen in applied fertilizers, resulting in significant nitrogen loss into the air, water, and soil, causing a series of environmental and human health problems. However, a 1% increase in nitrogen utilization efficiency (NUE) could save approximately $1.1 billion annually. Therefore, to minimize nitrogen loss, reduce environmental pollution, and lower agricultural production costs, it is crucial to identify nitrogen-efficient gene pools in crops and accelerate the development of nitrogen-efficient crop varieties.

[0003] Plants generally rely on ammonium and nitrate, two more readily available and reactive forms of inorganic nitrogen, for growth and development. Inorganic nitrogen is assimilated into glutamate (Glu) and glutamine (Gln) within the plant. For most plants, a small portion of nitrate is absorbed and assimilated in the roots, while the majority is transported to the aboveground parts for assimilation. It is first reduced to nitrite by nitrate reductases in the cytoplasm, and then further reduced to ammonium by nitrite reductases in the plastids and glutamine synthases (GS) in both the plastids and cytoplasm. Ammonium from nitrate or directly from ammonium transporters (AMTs) is further assimilated into amino acids through the GS / glutamine-2-oxoglutarate aminotransferase (GOGAT) cycle. In aerobic soils, nitrogen exists primarily as nitrate, while in anaerobic soils such as paddy fields, ammonium is the dominant inorganic nitrogen form, and ammonium transporters (AMTs) are crucial for the acquisition of ammonium from the soil by plants.

[0004] Rapeseed (Brassica napus) is one of my country's main oilseed crops, with seeds containing approximately 40% oil. It has multiple economic values, including edible, medicinal, and forage uses. Nitrogen nutrition has a significant impact on the growth, development, and quality formation of rapeseed. Rapeseed requires three times the nitrogen of cereal crops, making it crucial to improve its nitrogen utilization. Ammonium is an important inorganic nitrogen source for plants, and its assimilation process consumes relatively little energy. Therefore, regulating ammonium transporters to enhance the absorption of ammonium nitrogen in rapeseed is of great significance for improving nitrogen use efficiency, increasing yield, and reducing nitrogen fertilizer application. Summary of the Invention

[0005] This invention discovers that the BnaAMT1;10 gene in rapeseed can enhance the uptake and assimilation of ammonium nitrogen under low nitrogen conditions. Pot experiments showed that mutation of this gene decreased rapeseed yield under low nitrogen conditions, while overexpression of this gene increased rapeseed yield. In natural populations, BnaAMT1;10 contains two haplotypes, with haplotype one (Hap1) being the superior haplotype, and the G / C site in the CDS region is crucial for its ammonium transport activity.

[0006] This invention provides the application of the rapeseed ammonium transporter BnaAMT1;10 in any of the following:

[0007] A1) Improve nitrogen use, number of siliques per plant, and / or yield in rapeseed;

[0008] A2) Prepare products that improve nitrogen use, number of siliques per plant, and / or yield in rapeseed;

[0009] A3) Enhance the growth and development of rapeseed under low nitrogen conditions;

[0010] A4) Prepare products that enhance the growth and development of rapeseed under low nitrogen conditions.

[0011] Furthermore, the amino acid sequence encoded by BnaAMT1;10 is shown in SEQ ID NO:2, and the nucleotide sequence of BnaAMT1;10 is shown in SEQ ID NO:1.

[0012] This invention also provides a method for improving nitrogen utilization, number of siliques per plant, yield, and / or enhancing the growth and development of rapeseed under low nitrogen conditions by overexpressing BnaAMT1;10 in rapeseed.

[0013] Furthermore, the amino acid sequence encoded by BnaAMT1;10 is shown in SEQ ID NO:2, and the nucleotide sequence of BnaAMT1;10 is shown in SEQ ID NO:1.

[0014] This invention also provides a combination of SNP molecular markers that are significantly associated with ammonium utilization in rapeseed. With reference to the rapeseed genome version Westar.v0, the combination of molecular markers includes ChrC06:13880756, ChrC06:13880762, ChrC06:13880785, ChrC06:13880795, and ChrC06:13883423.

[0015] Furthermore, when the base sequence of the molecular marker combination is CGCAG, rapeseed exhibits a phenotype with high ammonium utilization capacity, while when the base sequence is TAAGC, rapeseed exhibits a phenotype with low ammonium utilization capacity.

[0016] The present invention also provides the application of substances for detecting the above-described combinations of molecular markers in any of the following:

[0017] B1) Identification or auxiliary identification of rapeseed nitrogen utilization;

[0018] B2) Preparation, identification, or auxiliary identification of rapeseed nitrogen utilization products;

[0019] B3) Rapeseed breeding or preparation of rapeseed breeding products.

[0020] This invention also provides the application of substances that detect significantly relevant SNPs for ammonium utilization in rapeseed in the identification or auxiliary identification of rapeseed ammonium utilization capacity, wherein the SNP is ChrC06:13883423, with rapeseed genome version: Westar.v0 as a reference.

[0021] This invention also provides a method for detecting, identifying, or assisting in the identification of, predicting, and breeding high-ammonia-utilization-capacity rapeseed, using the rapeseed genome version Westar.v0 as a reference.

[0022] C1) The base sequence of ChrC06:13883423 in rapeseed was detected. When it is G, it indicates that the ammonium utilization capacity of rapeseed is high, and when it is C, it indicates that the ammonium utilization capacity of rapeseed is low.

[0023] C2) The base sequences of ChrC06:13880756, ChrC06:13880762, ChrC06:13880785, ChrC06:13880795, and ChrC06:13883423 in rapeseed were detected. When the sequence was CGCAG, rapeseed showed high ammonium utilization capacity, while when the sequence was TAAGC, rapeseed showed low ammonium utilization capacity.

[0024] Compared with existing technologies, this invention has at least the following advantages: First, the tissue localization of BnaAMT1;10 was detected using GUS, and the ammonium transport activity of BnaAMT1;10 was demonstrated using yeast and Xenopus oocytes. Then, by comparing the sensitivity of wild-type, mutant, and overexpression materials to methylammonium, it was demonstrated that BnaAMT1;10 has ammonium transport capacity in plants. By comparing the phenotypes of wild-type and bnaamt1;10 mutants under different nitrogen treatments, it was demonstrated that the mutation of BnaAMT1;10 inhibits rapeseed growth and ammonium absorption and assimilation. Pot experiments showed that under low nitrogen conditions, the mutation of BnaAMT1;10 inhibits rapeseed yield, while the overexpression of BnaAMT1;10 increases rapeseed yield. Candidate gene association analysis identified a previously unreported superior allele that plays a crucial role in the ammonium transport activity of this protein. In conclusion, the study of BnaAMT1;10 provides a genetic approach to promote ammonium uptake in rapeseed and improve rapeseed yield and nitrogen efficiency under conditions of limited nitrogen fertilizer supply. Attached Figure Description

[0025] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0026] Figure 1 The expression levels of the BnaAMT1;10 gene at different time points under normal nitrogen supply and nitrogen-free treatment in Example 1 of this invention;

[0027] Figure 2 The vector map for constructing the ProBnaAMT1;10-GUS fusion plasmid in Example 2;

[0028] Figure 3 The GUS staining results of wild-type and ProBnaAMT1;10-GUS Arabidopsis thaliana in Example 2 show the tissue localization of BnaAMT1;10.

[0029] Figure 4 The results of yeast ammonium transport activity and ammonium transport affinity of BnaAMT1;10 in Example 3;

[0030] Figure 5 The editing status of the BnaAMT1;10 mutant rapeseed in Example 4 and the expression level of overexpressed rapeseed;

[0031] Figure 6 The phenotype and biomass of the BnaAMT1;10 mutant and overexpressing rapeseed in Example 5 under 30 mM methylammonium (MeA) treatment;

[0032] Figure 7 The wild-type and BnaAMT1;10 mutant rapeseed in Example 6 were subjected to 3 mM NH4NO3 and 0.1 mM NH4NO3. + Phenotypes and biomass under treatment;

[0033] Figure 8 The wild-type and BnaAMT1;10 mutant rapeseed in Example 7 were subjected to 3 mM NH4NO3 and 0.1 mM NH4NO3. + Analysis of nitrogen concentration and nitrogen content under treatment;

[0034] Figure 9 The wild-type and BnaAMT1;10 mutant rapeseed in Example 7 were subjected to 3 mM NH4NO3 and 0.1 mM NH4NO3. +Analysis of ammonium content, GS enzyme activity and Gln content under treatment;

[0035] Figure 10 These are photographs of the flowering phenotypes of wild-type, BnaAMT1;10 mutant, and overexpressing rapeseed in Example 8.

[0036] Figure 11 The data for mature plant height, number of siliques per plant, thousand-seed weight, and yield of wild-type, BnaAMT1;10 mutant, and overexpressing rapeseed in Example 8 are as follows:

[0037] Figure 12 BnaAMT1; 10 Haplotype Analysis and Phenotypic Data;

[0038] Figure 13 BnaAMT1;10 different haplotypes of yeast ammonium transport activity. Detailed Implementation

[0039] The following embodiments are only used to more clearly illustrate the technical solutions of the present invention, and are therefore merely examples and should not be used to limit the scope of protection of the present invention. It should be noted that, unless otherwise stated, the technical or scientific terms used in this application should have the ordinary meaning understood by those skilled in the art. Unless specifically stated, the reagents, methods, and equipment used in this invention are conventional reagents, methods, and equipment in this technical field. Unless specifically stated, the reagents and materials used in the following embodiments are commercially available.

[0040] To better understand the invention and not to limit its scope, all figures and other numerical values ​​used in this application to indicate amounts, percentages, etc., should in all cases be understood to be modified by the word "approximately". Therefore, unless specifically stated otherwise, the numerical parameters listed in the specification and appended claims are approximate values ​​and may vary depending on the desired properties being sought. Each numerical parameter should at least be considered as obtained based on reported significant figures and through conventional rounding methods.

[0041] In this application, the term "gene" refers to a nucleic acid fragment that expresses a specific protein or functional RNA molecule, which may contain a regulatory sequence (5' non-coding region) preceding the coding sequence and a regulatory sequence (3' non-coding region) following it.

[0042] Example 1: Response of the BnaAMT1;10 gene to nitrogen

[0043] (1) Rapeseed material culture formula: 3.0mM NH4NO3, 1.0mM NaH2PO4·2H2O, 2.0mM MgSO4·7H2O, 2.0mM KCl, 3.24mM CaCl2, 46.0μM H3BO3, 9.14μM MnCl2·4H2O, 0.5μM Na2MoO4·2H2O, 0.77μM ZnSO4·7H2O, 0.32μM CuSO4·5H2O and 25.0μM Fe-EDTA.

[0044] (2) Rapeseed material culture steps: After the rapeseed seeds were broken and grown in 0.5mM CaCl2 for 5 days, they were transferred to normal nutrient solution for 6 days. Then, seedlings with uniform growth were selected and cultured in nitrogen-free, 3mM NH4NO3 for 9 days, and nitrogen-free treatment was restored for 3 days. RNA was extracted from the samples and the response of BnaAMT1;10 to nitrogen was analyzed by qPCR.

[0045] Using EF-α as the internal reference gene, BnaAMT1; 10 primer sequences:

[0046] F: CGGCGTCACTAGTTGTCCTT;

[0047] R:GACGTTTCCCGAAGAGGGTT

[0048] qPCR analysis revealed that BnaAMT1;10 expression increased in the aboveground parts of the plant after 6 hours of nitrogen deficiency, while root expression significantly increased after 3 days of nitrogen deficiency, exceeding that in the aboveground parts. The gene expression levels in both aboveground and belowground parts decreased rapidly after nitrogen supply, indicating that BnaAMT1;10 expression is induced by nitrogen deficiency.

[0049] Example 2: Tissue-specific expression of BnaAMT1;10

[0050] (1) Construction of ProBnaAMT1; 10-GUS fusion vector

[0051] The gDNA sequence of BnaAMT1;10 was located using BnIR. The first 1895 bp fragment of ATG was cloned, as shown in SEQ ID NO:3. The primer sequences were (GATTACGCCAAGCTTAAGCTAAAC CAGAACTCGTG; GGACTGACCACCCGGGTTGGGAGAGATTGGTGAG). This 1895 bp promoter was ligated into the pBI121-GUS vector using SmaⅠ and XbaⅠ. The vector map is shown below. Figure 2As shown. The ProBnaAMT1;10-GUS fusion plasmid was transformed into Agrobacterium and then infected Arabidopsis thaliana to obtain transgenic Arabidopsis thaliana material, and the tissue localization of BnaAMT1;10 was observed.

[0052] (2) Acquisition of Arabidopsis thaliana materials

[0053] The Agrobacterium strain containing the ProBnaAMT1;10-GUS fusion plasmid was taken out, thawed, and a small amount was spread onto LB solid medium containing Kan and Gen, and incubated at 28°C for 2 days. Single colonies were picked and added to 500 μL of double-antibiotic LB medium, and incubated overnight at 200 rpm on a shaker at 28°C. 200-400 μL of the turbid bacterial solution was transferred to 100 mL of double-antibiotic LB medium and incubated at 200 rpm at 28°C until the OD600 reached 0.8-1.2. The 100 mL of turbid bacterial solution was aliquoted into 50 mL centrifuge tubes, centrifuged at 3600 rpm for 15 min, the supernatant was discarded, and the bacterial cells were resuspended in an equal volume of sterile 5% sucrose (with a small amount of magnesium sulfate added). An appropriate amount of silwet was added. L-77 (add 50 μL to 100 mL); Infect Arabidopsis thaliana flower buds that have been normally cultured to the flowering stage in the bacterial solution for 30 seconds, and then culture in the dark for 24 hours after infection; After normal culture for 1 week, re-infect and transform once, and the first batch of seeds can be harvested in about 2-3 weeks.

[0054] The cultured GUS transgenic Arabidopsis thaliana was immersed in GUS staining solution, vacuumed for 30 minutes, and incubated at 37°C until a blue color appeared. After decolorization with 75% ethanol, the stain was photographed and recorded. Figure 3 As shown, no blue color appeared in wild-type Arabidopsis thaliana, while blue color appeared in both leaves and roots of ProBnaAMT1;10-GUS transgenic Arabidopsis thaliana, indicating that BnaAMT1;10 is expressed in both leaves and roots of Arabidopsis thaliana, mainly in the root epidermis and cortex, which is consistent with the localization of AtAMT1;1 in Arabidopsis thaliana.

[0055] Example 3: Ammonium transport activity and affinity of BnaAMT1;10

[0056] 1. Ammonium transport activity of BnaAMT1;10

[0057] The yeast mutant strain 31019b has the genotype mep1D mep2D mep3D ura3, meaning that strains lacking these three MEP genes cannot survive below 5 mM NH4+. +The bacteria grew normally on the culture medium. The PDR196-BnaAMT1;10 fusion vector was constructed using primer pairs (F: CGACTAGTGGATCCCATGTCGGGATCTTTATCTTGCTCTGCT; R: CGATAAGCTTGATATCGTCAAACAGAAGTGGTAGTAACACCCG). The PDR196 (negative control), PDR196-AtAMT1;1 (positive control), and PDR196-BnaAMT1;10 vectors were transformed into yeast strain 31019b, respectively. The cultures were then inoculated into 100 mL Erlenmeyer flasks containing 0.17% YNB, 0.1% L-proline, and 2% glucose, and shaken at 200 rpm at 28°C until the OD600 reached 1–1.2. One mL of the culture was then centrifuged at 4000 rpm for 2 min, washed twice, and resuspended in 0.17% YNB. Dilute all bacterial cultures with 0.17% YNB to an OD600 of 0.5. Then, divide the yeast into four concentration gradients by dilution tenfold with sterile water and incubate them on plates containing 0.2M and 2M ammonium sulfate until colonies appear.

[0058] like Figure 4 As shown, the yeast transferred into the empty vector only grew on the medium supplemented with proline and could not grow on the medium with ammonium chloride as the sole nitrogen source. The yeast transferred into BnaAMT1;10 and AtAMT1;1 could grow normally under 0.2 mM and 2 mM ammonium chloride conditions, indicating that BnaAMT1;10 has ammonium transport activity.

[0059] 2. Ammonium transport affinity of BnaAMT1;10

[0060] The BnaAMT1;10-pT7Ts fusion vector was constructed using primer pairs (F: AACTTTGGCAGATCTATGTCGGGATCTTTATCTTGCTC TGCT; R: TAGTCAGTCACTAGTTCAAACAGAAGTGGTAGTAACACCCG). 6-7 μg of plasmid was linearized with restriction endonucleases. 0.4 μL of proteinase K (20 mg / mL) and 20 μL of 1% SDS were added to the linearized plasmid. After incubation at 50°C for 30 min, enzyme-free water was added to a final volume of 100 μL, along with 100 μL of phenol / chloroform solution. The mixture was then centrifuged at 13000 rpm at room temperature. - Centrifuge at -20°C for 15 min for 3 min. Collect the supernatant and add 10 μL of sodium acetate (3M) and 200 μL of 95% ethanol. Centrifuge again at 4°C, 13000 rpm for 30 min. Wash the precipitate with 200 μL of 70% ethanol and dissolve the precipitate with 8–10 μL to obtain the purified linearized plasmid.

[0061] Take 1 μg of linearized plasmid, add 2 μL of enzyme mix, 10 μL of 2×NTP / Cap, 2 μL of 10×buffer, and bring the volume to 20 μL with sterile deionized water. Incubate at 37°C for 2 h. Add 1 μL of DNase and incubate at 37°C for 15-30 min. Add 100 μL of water, 15 μL of sodium acetate (3M), and 150 μL of phenol / chloroform solution, and centrifuge at 13000 rpm for 3 min at room temperature. Absorb the supernatant, add 100 μL of water, mix well, and centrifuge again. Add an equal volume of isopropanol to the supernatant and incubate at -20°C for 15 min. Centrifuge at 4°C for 13000 rpm for 30 min to precipitate cRNA. Wash the precipitate with 200 μL of 70% ethanol and dissolve the precipitate with 11 μL to obtain cRNA.

[0062] Xenopus oocytes were obtained by selecting robust, adult female Xenopus ravens with darker coloration and anesthetizing them on ice. After complete anesthesia, the oocytes were dissected and retrieved. Large clusters of Xenopus oocytes were carefully broken up with forceps and transferred to a solution containing 1.5-2 mg / mL of [unspecified substance]. -1 The collagenase MBS was used to enzymatically digest the outer membrane of oocytes at 25°C. When most Xenopus oocytes were scattered, they were promptly treated with a Ca2+-containing solution. + Xenopus oocytes were washed with MBS to terminate the enzymatic digestion reaction. Oocytes with a clear black-white boundary and uniform size were selected for injection. Xenopus oocytes microinjected with BnaAMT1 and 10 cRNA were then transferred to a solution containing 100 mg L... -1 Streptomycin, 60 mg / L -1 Xenopus oocytes cultured in penicillin- and gentamicin-containing MBS for 2 days were then transferred to 20 μM NH4+. + 50μM NH4 + 100μM NH4 + 400μM NH4 + 800μMNH4 + and 1000μM NH4 + The current was detected in the solution using a two-electrode voltage clamp.

[0063] The results are as follows Figure 4 As shown, compared with uninjected oocytes, oocytes injected with BnaAMT1;10 exhibited a larger inward current at -50 nA when the cell membrane potential was clamped. The Km for BnaAMT1;10 to transport ammonium was 25.64 ± 1.11 μM. Therefore, experiments with yeast and Xenopus laevis oocytes both demonstrate that BnaAMT1;10 is a high-affinity ammonium transporter.

[0064] Example 4: Construction of BnaAMT1;10 mutant rapeseed and overexpressing rapeseed lines

[0065] The target gene was knocked out using CRISPR / Cas9 gene editing technology. The gene BnaAMT1 was designed using the CRISPR-P v2.0 website (http: / / crispr.hzau.edu.cn / CRISPR2 / ) as the target site, with the specific sequence (ATATATGGTCTCGATTGCTGCTGCCGGAATCACCAGGTT; TGCT GCTGCCGGAATCACCAGGTTTTAGAGCTAGAAATAGC; AACTTGCACCCA AGGAGTACCACAATCTCTTAGTCGACTCTAC; ATTATTGGTCTCGAAACTTGCACCCAAGGAGTACCACAA). A mutant vector was constructed using primer pairs (TTT CGCGAGCTCGGTACCCGGGATGTCGGGATCTTTATCTTGCTC; GTCGACT). The BnaAMT1;10CDS sequence was constructed into the pBI21s overexpression vector (CTAGAGGATCCCCGGGCAAACAGAAGTGGTAGTAACACC). Positive materials were then obtained through genetic transformation of rapeseed hypocotyls. Positive materials were identified by PCR, and gene sequencing was used to determine whether the target sequence had been edited. The expression level of overexpressing plants was determined by qPCR.

[0066] like Figure 5 As shown, three mutant lines were obtained, with the editing types being insertion mutation, deletion mutation, and insertion mutant, respectively. Two overexpression lines were obtained, with overexpression of 25-fold and 15-fold, respectively.

[0067] Example 5: Investigating the ammonium uptake capacity of the BnaAMT1;10 transgenic material using MeA.

[0068] MeA is an ammonium analogue. The absorption mechanism of methylammonium by plants is consistent with that of ammonium, and after absorption, it rapidly causes toxicity to plants, inhibiting their growth. Therefore, MeA can be used to explore the mechanism of ammonium absorption in plants. Overexpression and mutant materials were treated with 30 mM MeA under normal light and in the dark, respectively. After 3 days, as... Figure 6The hypocotyl length of seedlings under the indicated light-shielded conditions showed no significant difference under normal culture. However, in seedlings cultured with added methylammonium, the hypocotyl length of the mutants was significantly longer than that of the wild type, while the overexpression lines showed significant inhibition. Under normal light and nutrient solution culture, there were no significant differences among all lines. However, after MeA treatment, the fresh weight of the mutant lines was significantly higher than that of the wild type, while the fresh weight of the overexpression lines was significantly lower than that of the wild type. This indicates that BnaAMT1;10 facilitates MeA absorption and also demonstrates that BnaAMT1;10 has ammonium absorption capacity.

[0069] Example 6: Phenotypic characteristics of bnaamt1;10 mutant rapeseed under different nitrogen treatments

[0070] 1. Cultivation conditions for rapeseed

[0071] Rapeseed seeds were incubated in 0.5 mM CaCl2 for 5 days, then transferred to normal and low-nitrogen treatments: normal treatment with 3 mM NH4NO3 and low-nitrogen treatment with 0.1 mM NH4NO3. + Three biological replicates were set up for each treatment. After 12 days of treatment, aboveground and underground samples were collected and dried. The roots were pre-cooled and washed with CaCl2 before being blanched together with the aboveground parts in an oven at 105℃ for 30 minutes, and then dried at 75℃ to constant weight. The dry weight and nitrogen content were then determined.

[0072] 2. Determination of total nitrogen content in rapeseed

[0073] The solutions are prepared as follows: (1) Preparation of phenol solution: Weigh 5g of phenol and 50mg of sodium nitroferricyanide, dissolve them in distilled water, transfer them to a 500mL volumetric flask and make up to volume. Store in a brown bottle at 4℃. Warm to room temperature before use. (2) Preparation of sodium hypochlorite alkaline solution: Weigh 5g of sodium hydroxide, 3.53g of disodium hydrogen phosphate, and 15.9g of sodium phosphate. Measure 5mL of sodium hypochlorite (i.e., bleaching agent solution containing 5% available chlorine), dissolve it, transfer it to a 500mL volumetric flask and make up to volume. Store in a brown bottle at 4℃. (3) Preparation of masking agent: Weigh 20g of potassium sodium tartrate, 5g of disodium EDTA, and 0.2g of NaOH in a beaker, add about 60mL of water and heat to dissolve. Transfer to a 100mL volumetric flask and make up to volume. (4) Ammonium nitrogen standard solution (5 μg / mL, available in the laboratory): On the day of the test, dilute the ammonium nitrogen standard stock solution 20 times with water (e.g., dilute 5 mL to 100 mL).

[0074] The specific procedure is as follows: Accurately weigh approximately 0.05g of plant sample and place it in a 20mL digestion tube. Add 2mL of concentrated H2SO4 and let it stand for about 10-12 hours. After cold nitrification, perform hot nitrification in a metal bath (120℃). During this process, add 2-3 drops of H2O2 every 10-15 minutes and shake well, repeating this process until the solution becomes colorless and transparent. After the digestion solution cools, dilute it to 20mL with pure water, shake well, and filter it through medium-speed quantitative filter paper into a 10mL centrifuge tube. Finally, take 4mL of the solution and dilute it twice with ultrapure water to complete the preparation. The nitrogen content in each tissue was determined using a flow injection analyzer (AA3, SEAL Analytical GmbH), and seven standard curve concentrations were set (0mg / L, 5mg / L, 10mg / L, 20mg / L, 40mg / L, 50mg / L, and 60mg / L).

[0075] like Figure 7 As shown, under 3 mM NH4NO3 treatment, there was no significant difference in the dry weight of the aboveground parts and roots. However, under 0.1 mM NH4NO3 treatment, there was no significant difference in the dry weight of the aboveground parts and roots. + Under the treatment, the aboveground and root fresh weights of the mutant lines were significantly lower than those of the wild type, indicating that the Bnaamt1;10 mutation inhibits the growth and development of rapeseed under low ammonium conditions. Simultaneously, the changes in nitrogen content and concentration of all materials under different treatments were measured. Under 3 mM NH4NO3 conditions, there were no significant changes in nitrogen content and concentration for any material, while under 0.1 mM NH4NO3 conditions… + Under the given conditions, the nitrogen concentration and nitrogen content in the aboveground parts and roots of the mutant were significantly lower than those in the wild type, indicating that the reduced nitrogen concentration caused by the BnaAMT1;10 mutation may be the reason for the inhibited growth of the mutant rapeseed.

[0076] Example 7: Effect of BnaAMT1;10 mutation on nitrogen assimilation in rapeseed

[0077] (1) Determination of ammonium nitrogen content

[0078] In this embodiment, the reagent preparation, standard curve construction, and result calculation methods for the determination of ammonium nitrogen content are the same as in Example 6. The only difference is the sample preparation and determination method. Sample determination: Weigh 0.5g of sample into a mortar, grind with 5mL of ultrapure water, transfer to a centrifuge tube, centrifuge at 12500rpm for 15min, take 0.1mL of supernatant and dilute it into a test tube, add 2.9mL of ultrapure water, 0.5mL of phenol solution, and 1mL of sodium hypochlorite alkaline solution in sequence, shake well, and place at room temperature (around 28℃) for 30min. Add 0.1mL of masking agent to dissolve any precipitate that may form. After shaking well, measure the color at 625nm. Express the result as μmol / gFW.

[0079] Xylem sap collection: A natural collection method relying on plant root pressure was used. Specific steps: Absorbent cotton was washed with dilute hydrochloric acid, distilled water, and deionized water, dried, and placed in clean 50mL Eppendorf tubes. The material was moved to a shady location, and the stem was quickly cut approximately 4cm from the root base using a blade sterilized with acetone. Absorbent cotton soaked in deionized water was used to quickly wipe the cut surface connected to the root system and absorb surface moisture; the first drop of sap was discarded with the cotton. Using a 200μL pipette, the overflowing sap was repeatedly aspirated into 10mL Eppendorf tubes, with 5 plants per replicate. Collection was stopped after 2 hours. The volume of xylem sap collected for each treatment was calculated by weighing and subtracting the initial mass of the centrifuge tube. The collected xylem sap was diluted 10-fold before determining free ammonium content.

[0080] (2) Determination of glutamine synthase activity

[0081] Preparation of enzyme extraction buffer: Weigh 1.5295g Tris, 0.1245g MgSO4·7H2O, 0.1543g DTT (dithiothreitol) and 34.23g sucrose, dissolve them in deionized water, adjust the pH to 8.0 with 1.0mol / L HCl, and finally bring the volume to 250mL.

[0082] Preparation of control reaction solution A: Weigh 1.2236g Tris, 1.9918g MgSO4·7H2O, 0.3451g sodium glutamate, 0.2422g cysteine, and 0.0744g EDTA-Na2, respectively, and hydrolyze them in a deionized water bath. Then, adjust the pH to 7.4 with 1.0mol / L HCl and bring the volume to 100mL.

[0083] Preparation of complete reaction solution B: In addition to the components of reaction mixture A, add 80 mmol / L hydroxylamine hydrochloride (containing 0.5560 g hydroxylamine hydrochloride per 100 mL).

[0084] Preparation of the colorimetric reagent: Weigh 3.3176g TCA (trichloroacetic acid) and 10.1021g FeC l3 Dissolve 6H2O in deionized water, add 5 mL of concentrated hydrochloric acid, and bring the volume to 100 mL.

[0085] Preparation of 40 mmol / L ATP solution: Weigh 0.2420 g ATP and dissolve it in 10 mL of deionized water (prepare immediately before use).

[0086] Extraction of crude enzyme solution: Weigh 0.5-1.0g of plant material into a mortar, add 5mL of extraction buffer, grind into a homogenate on an ice bath, transfer the homogenate to a centrifuge tube, and centrifuge at 4℃ and 15000g for 20min. The supernatant is the crude enzyme solution.

[0087] Determination of GS activity: Take 1.0 mL of complete reaction solution (B) into a 10 mL centrifuge tube, add 0.5 mL of crude enzyme solution and 0.5 mL of ATP solution, mix well, incubate at 37 °C for 0.5 h, add 1 mL of colorimetric reagent to terminate the reaction, shake well, place at room temperature for 5 min, centrifuge at 3500 r / min for 10 min, take the supernatant and measure the absorbance at 540 nm, with the solution containing 1.0 mL of control reaction solution (A) as the control.

[0088] Results calculation: GS activity (A540·g / FW / h), where: A is the absorbance at 540nm; m is the sample mass; V1 is the total volume of crude enzyme solution; V2 is the volume of crude enzyme solution added to the reaction system; t is the reaction time.

[0089] (3) Glutamic acid content determination

[0090] This experiment used the Solarbio Glutamic Acid Content Detection Kit (BC1580) to determine the glutamate content in rapeseed. The determination method was performed according to the kit instructions.

[0091] like Figure 9 As shown, under ammonium nitrate conditions, the free ammonia content, GS enzyme activity, glutamate content, and xylem sap ammonia concentration in the roots did not change significantly; only the ammonium concentration in the aboveground parts decreased in two lines. However, under 0.1 mM NH4+ conditions... + Under the treatment, the ammonium concentration in the roots of the mutant material decreased to 79%, 71%, and 67% of the wild type, respectively; GS enzyme activity significantly decreased to 52%, 68%, and 62% of the wild type, respectively; and glutamate content significantly decreased to 70%, 65%, and 52% of the wild type, respectively. There were no significant changes in the aboveground parts, but the xylem sap decreased to 80%, 79%, and 80%, respectively. This indicates that the BnaAMT1;10 mutation affects the assimilation of ammonium in the roots and inhibits the transport of ammonium from the roots to the aboveground parts.

[0092] Example 8: Yield analysis of BnaAMT1;10 transgenic rapeseed under different nitrogen treatments

[0093] Pot Experiment Method: The soil for the rapeseed pot experiment was taken from Shizishan, Huazhong Agricultural University. The soil type was yellow-brown soil, and its basic physicochemical properties were as follows: organic matter 6.30 mg / g, available nitrogen: 9.46 mg / g, available phosphorus: 5.98 mg / g, available potassium: 213 mg / kg, pH: 7.04. Two nitrogen treatments were set up: normal nitrogen (CK, N = 0.3 g / kg) and low nitrogen (LN, 0.03 g / kg). The application rates of other mineral nutrients were as follows: KH₂PO₄·2H₂O 0.38 g / kg, KCl 0.11 g / kg, and MgSO₄·7H₂O 0.25 g / kg. Micronutrients were applied using Arnon's formula, with 7 mL of 1000× stock solution added to each pot. During application, dissolve and mix the macro-element fertilizer, magnesium salts and micro-elements in pure water and then evenly pour the mixture into each pot of soil (approximately 1.0-1.5L of water per pot).

[0094] like Figure 10 and 11 As shown, under normal nitrogen conditions, none of the indicators changed significantly. However, under low nitrogen conditions, the mutant lines were significantly shorter than the wild type, while the overexpression lines showed no significant difference. The number of siliques per plant in the mutant lines was significantly lower than that in the wild type, while the number of siliques per plant in the overexpression lines was significantly higher than that in the wild type. The yield of the mutant lines decreased to 73% and 60% of that of the wild type, while the yield of the overexpression lines increased by 37%. This indicates that BnaAMT1;10 is beneficial to the growth and yield of rapeseed under LN conditions.

[0095] Example 9: BnaAMT1; Example 10: Candidate Gene Association Analysis

[0096] 1. Candidate gene association analysis

[0097] SNPs were extracted from the BnaAMT1;10 genome and its preceding and following 2000 bp sequences using VCFtools software. Association analysis was then performed on the relative fresh weight trait using Tassel 5.0 software based on a general linear model, with the threshold typically set to 1 / the number of SNPs within the BnaAMT1;10 sequence. Visualization of candidate gene association analysis and haplotype analysis were performed using LDblockshow 1.33 and Haploview 4.2 software, respectively.

[0098] 2. MeA treatment for different haplotypes

[0099] The light culture chamber has a light cycle of 16 hours of light / 8 hours of darkness, a temperature of 22°C, a humidity of 60%–75%, and a light density of 300 μmol / m³. 2 / s~320μmol / m 2Seeds were placed in seedling dishes and soaked in deionized water in the dark for 2 days, then transferred to a net floating on a nutrient solution (pH=5.8) for 4 days of growth. The nutrient solution for normal treatment contained 5.0 mM KNO3, 1.0 mM KH2PO4, 2.0 mM MgSO4, 46.0 μM H3BO3, 9.0 μM MnCl2, 0.3 μM CuCl2, 0.8 μM ZnCl2, 0.32 μM Na2MoO4, and 50.0 μM EDTA-Fe. The MeA toxicity treatment was performed by adding an additional 20 mM / L MeA to the nutrient solution used for normal treatment.

[0100] 3. Low ammonium treatment of different haplotypes of rapeseed

[0101] Rapeseed seeds were incubated in 0.5 mM CaCl2 for 5 days, then transferred to normal and low-nitrogen treatments: normal treatment with 3 mM NH4NO3 and low-nitrogen treatment with 0.1 mM NH4NO3. + Three biological replicates were set up for each treatment. After 12 days of treatment, samples were collected from aboveground and belowground samples, dried, and their relative dry weight was determined.

[0102] 4. Short-term N of different haplotypes of rapeseed 15 tracer experiment

[0103] First, the rapeseed was cultured normally for 6 days, then it was transplanted into a nitrogen-deficient environment (0mM NH4+). + After 3 days of treatment, the plants were washed in 0.1 mM CaSO4 for 1 minute, and then different haplotypes of rapeseed materials were transferred into... 15 0.1 mM N-labeled NH4 + Processing for 10 minutes ( 15 Nitrogen abundance: 10.38%. After treatment, roots from different strains were sampled, washed in 0.1 mM CaSO4, and then dried in an oven. Elemental analysis with isotope mass spectrometry (EA-Delta VMS, Thermo, USA) was used to obtain the results. 15 Based on N and total nitrogen content, the ammonium uptake rate of rapeseed roots in different haplotypes was calculated.

[0104] 5. qPCR expression analysis of different haplotypes BnaAMT1;10

[0105] Using Prometheus (Beijing) Biotechnology Co., Ltd. The Super Total RNA Extraction Kit (LS1040) was used to extract RNA from plants; specific operating procedures were followed according to the kit's instruction manual. RNA reversal was performed using reagents from Yisheng Biotechnology Co., Ltd. The Ⅱ1st Strand cDNA first-strand synthesis kit converts the DNA into cDNA. The total amount of reverse RNA is 500 ng, and the volume is 10 μL diluted 10-fold before use.

[0106] The real-time quantitative PCR (RT-qPCR) assay was performed using samples from Yisheng Biotechnology Co., Ltd. qPCR using the SYBR GreenMaster Mix kit was performed on a QuantStudio™ 6Flex System (Applied Biosystems, Foster City, CA). Based on 2 -ΔΔCt Relative gene expression levels were calculated using a method with EF1-α (accession number: DQ312264) as an internal reference gene. The RT-qPCR reaction system was as follows: 2 μL cDNA template, 0.2 μL each of specific primers, 5 μL Hieff-qPCRSYBR Green Master Mix (Low Rox) dye, and 2.6 μL ddH2O, totaling 10 μL. The reaction program was as follows: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 10 s, 60℃ annealing for 20 s, 72℃ extension for 20 s, for 40 cycles. The melting curve was set to the instrument's default settings: 95℃ for 15 s, 60℃ for 1 min, and 95℃ for 15 s.

[0107] The results are as follows Figure 12 As shown in Table 1, the BnaAMT1;10 genome contains 49 SNP sites within 2000 bp before and after it.

[0108] Table 1

[0109]

[0110]

[0111] There are five significant SNPs, the locations of which are shown in Table 2. Four of them are located in the non-coding region and one is located in the CDS region.

[0112] Table 2

[0113]

[0114] like Figure 12 As shown, based on these five SNPs, BnaAMT1;10 can be divided into two haplotypes, CGCAG and TAAGC, and the phenotypic differences in sensitivity to methylammonium between the two haplotypes in the population are extremely significant. Haplotype 1 has a smaller biomass under methylammonium treatment, indicating that it is more sensitive to methylammonium and more susceptible to methylammonium toxicity. Compared with normal nutrient solution, the relative fresh weight of haplotype 1 is significantly higher than that of haplotype 2 under low ammonium conditions. Simultaneously, short-term N... 15Tracer experiments demonstrated that haplotype 1 exhibited a significantly higher ammonium uptake rate than haplotype 2. qPCR analysis of BnaAMT1;10 expression levels in the roots of haplotype 1 was significantly higher than that of haplotype 2. This indicates that haplotype 1 possesses stronger ammonium uptake capacity and is a superior candidate haplotype.

[0115] Therefore, the above-mentioned SNP molecular marker combinations can be screened together for breeding to screen rapeseed's ammonium uptake and utilization capacity, which has good application prospects. Specifically, direct amplification and sequencing can be used, or corresponding primers or probes can be designed using conventional primer design tools for the above-mentioned SNP molecular marker combinations for molecular marker-assisted breeding of rapeseed with high ammonium utilization capacity.

[0116] Example 10: Effect of significant SNPs of BnaAMT1;10 on ammonium absorption capacity

[0117] Construct PDR196-BnaAMT1; 10(Hap1) G Hap2 C Hap1 G→C Hap2 C→G The fusion vector was used to combine PDR196 (negative control), PDR196-AtAMT1;1 (positive control), and PDR196-BnaAMT1;10 (Hap1). G Hap2 C Hap1 G→C Hap2 C→G The vector was transformed into yeast strain 31019b, and then inoculated into 100 mL Erlenmeyer flasks containing 0.17% YNB, 0.1% L-proline, and 2% glucose, and incubated at 28°C for 200 rpm. -1 Shake the bacterial suspension until the OD600 is 1-1.2. Then, take 1 mL of the bacterial suspension and centrifuge at 4000 rpm for 2 min, wash twice, and resuspend in 0.17% YNB. ​​Dilute all the bacterial suspensions with 0.17% YNB to an OD600 of 0.5. Then, divide the yeast into four concentration gradients by a factor of ten using sterile water, and incubate on plates containing 0.2M and 2M ammonium sulfate until colonies appear.

[0118] like Figure 13As shown, all yeasts grew normally on proline-added medium, while haplotype 1 yeast grew stronger than haplotype 2 yeast on ammonium-only nitrogen source medium. The CDS region of BnaAMT1;10 contains only one SNP (ChrC06:13883423), suggesting that this site plays an important role in ammonium uptake by BnaAMT1;10. Therefore, the G mutation in haplotype 1 was changed to C, and the C mutation in haplotype 2 was changed to G. The results showed that the yeast transformed with the haplotype 2 point mutant grew stronger, while the yeast transformed with the haplotype 1 point mutant grew weaker, indicating that this site is crucial for the transport activity of BnaAMT1;10.

[0119] The above detailed embodiments describe the implementation of the present invention; however, the present invention is not limited to the specific details described in the above embodiments. Within the scope of the claims and technical concept of the present invention, various simple modifications and changes can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.

Claims

1. The application of a combination of SNP molecular markers significantly associated with rapeseed ammonium utilization in any of the following: B1) Identification or auxiliary identification of rapeseed nitrogen utilization; B2) Preparation, identification, or auxiliary identification of rapeseed nitrogen utilization products; The molecular marker combinations mentioned are ChrC06:13880756, ChrC06:13880762, ChrC06:13880785, ChrC06:13880795, and ChrC06:13883423, with the rapeseed genome version: Westar.v0 as a reference. When the base sequence of the molecular marker combination is CGCAG or TAGG, rapeseed exhibits a phenotype with high ammonium utilization capacity, and when the base sequence is TAGC, rapeseed exhibits a phenotype with low ammonium utilization capacity.

2. A method for detecting, identifying, or assisting in the identification of, and predicting the ammonium utilization capacity or high ammonium utilization capacity of rapeseed in rapeseed-assisted breeding, characterized in that, Using the rapeseed genome version Westar.v0 as a reference, the base sequences of ChrC06:13880756, ChrC06:13880762, ChrC06:13880785, ChrC06:13880795, and ChrC06:13883423 in rapeseed were detected. When the sequence was CGCAG or TAGG, rapeseed showed high ammonium utilization capacity, while when the sequence was TAGC, rapeseed showed low ammonium utilization capacity.

Images