Application of hsa_circRNA_101231 in the diagnosis, treatment and prognosis of rectal cancer
By detecting and knocking down hsa_circRNA_101231, the shortcomings in early detection and treatment of colorectal cancer have been addressed, achieving highly efficient diagnostic and treatment effects and significantly inhibiting cancer cell growth and invasion metastasis.
Patent Information
- Application Number
- CN202411730221.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-29
- Publication Date
- 2025-10-28
- Estimated Expiration
- 2044-11-29
AI Technical Summary
Existing technologies are not ideal for the early detection and treatment of colorectal cancer, lacking effective molecular markers and therapeutic targets. Traditional methods have limited effectiveness in treating mid-to-late stage colorectal cancer.
We discovered and validated that the 412 nt circular RNA hsa_circRNA_101231 was significantly elevated in the peripheral blood of colorectal cancer patients and was associated with patient prognosis. As a diagnostic biomarker and therapeutic target, we can develop diagnostic products, assess prognosis, and develop therapeutic drugs by detecting and knocking down this circular RNA.
Significantly elevated hsa_circRNA_101231 levels in colorectal cancer patients serve as a diagnostic biomarker for early detection and prognosis assessment, and provide a novel therapeutic target by inhibiting cancer cell growth and invasion metastasis through knockdown.
Smart Images

Figure CN119570932B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of tumor molecular biology technology, specifically involving the application of hsa_circRNA_101231 in the diagnosis, treatment and prognosis of rectal cancer. Background Technology
[0002] Colorectal cancer is a common malignant tumor of the lower digestive tract, ranking third in incidence and second in mortality among malignant tumors worldwide. Malignant growth and metastasis of tumor cells are the main causes of death in colorectal cancer patients. The treatment outcome of colorectal cancer is closely related to the time of diagnosis; the earlier the diagnosis and intervention, the better the cure rate. The 5-year survival rate for early-stage colorectal cancer can reach over 90%, while the 5-year survival rate for late-stage colorectal cancer is less than 20%. Therefore, early detection of colorectal cancer is particularly important. Furthermore, treatment and prognostic assessment are also crucial for colorectal cancer patients. However, traditional chemotherapy and targeted therapy are not very effective for treating mid-to-late-stage colorectal cancer. Therefore, researching new therapeutic targets and diagnostic molecular markers for colorectal cancer is essential.
[0003] Circular RNA (circRNA) is a class of non-coding RNAs distinct from traditional linear RNA. It is formed by reverse splicing of precursor mRNA, resulting in a closed circular structure without a 5' cap and a 3' poly(A) tail, and covalently linked. The absence of a 5' cap and a 3' poly(A) tail allows circRNAs to resist degradation by RNA exonucleases, resulting in high stability, conservation, long half-life, and high abundance, making them ideal biomarkers.
[0004] The formation of circRNAs can be divided into two main mechanisms: exon circularization and intron circularization. Jeck et al. proposed that exon-derived circRNAs (exonic circRNAs, ecircRNAs) can be formed through two pathways: lariat-driven circularization and intron-pairing-driven circularization. In lariat-driven circularization, the 3' end of the exon acts as a splice donor, attacking the 5' splice acceptor. Covalent binding occurs in the Alu region, forming a lariat structure. After internal splicing, the lariat structure expels the intron to form circRNA. Intron-pairing-driven circularization, two introns pair complementary bases to form a circular structure, which is then expels to form circRNA. In fact, introns themselves can also circularize, forming intron-derived circRNAs (circular intronic RNAs, ciRNAs). In recent years, circRNAs have been found to be widely present in mammalian cells and even in some plants. Studies have shown that circRNAs play important roles in various physiological and pathological processes, including cell growth, cell differentiation, cell senescence, and epigenetic regulation, and are closely related to a variety of diseases, including tumors. Discovering more novel circRNAs as biomarkers for tumor diagnosis and prognosis, and ensuring their early and effective patent protection, can significantly enhance my country's international competitiveness in this technological field. Summary of the Invention
[0005] The technical problem solved by this invention is to overcome the defects and deficiencies of the prior art. This invention detects a circular RNA hsa_circRNA_101231 with a length of 412 nt and proposes the application of hsa_circRNA_101231 in the diagnosis, treatment and prognosis of rectal cancer.
[0006] Experiments revealed that the expression of this circular RNA was significantly increased in peripheral blood plasma of colorectal cancer patients; and the expression of this circular RNA in paraffin-embedded tissue samples of colorectal cancer was significantly correlated with the patient's prognosis; at the same time, knocking down this circular RNA could also inhibit the growth and invasion and metastasis of colorectal cancer, and may serve as a biomarker molecule for the diagnosis and prognostic assessment of nasopharyngeal carcinoma as well as a therapeutic target.
[0007] The technical solution adopted in this invention is as follows:
[0008] In a first aspect, the present invention protects the use of reagents for detecting hsa_circRNA_101231 expression in the preparation of colorectal cancer diagnostic products.
[0009] Secondly, the present invention also protects the use of reagents for detecting hsa_circRNA_101231 expression in the preparation of colorectal cancer prognostic assessment products.
[0010] Thirdly, the present invention also protects a kit for the diagnosis and prognostic assessment of colorectal cancer.
[0011] Fourthly, the present invention also protects the use of a substance that knocks down the expression of hsa_circRNA_101231 in the preparation of a drug for treating colorectal cancer.
[0012] Fifthly, the present invention also includes a medicament for treating colorectal cancer.
[0013] In a sixth aspect, the present invention also protects an hsa_circRNA_101231 inhibitor.
[0014] The sequence of hsa_circRNA_101231 mentioned above is shown in SEQ ID NO: 1.
[0015] SEQ ID NO: 1:
[0016] TACACGAGCAAGAAGCCATTAACTCTGACCCAGAGTTGTCTAATTGTGAAAATTTTCAGAAGACTGATGTGAAAGATGATCTGTCTGATCCTCCTGTTGCAAGCAGTTGTATTTCTGAGAAGTCTCCACGTAGTCCACAACTTTCAGATTTTGGACTTGAGCGGTACATCGTATCCCAAGTTCTACCAAACCCTCCACAGGCAGTG AACAACTATAAGGAAGAGCCCGTAATTGTAACCCCACCTACCAAACAATCACTAGTAAAAGTACTAAAAACTCCAAAATGTGCACTAAAAATGGATGATTTTGAGTGTGTAACTCCTAAATTAGAACACTTTGGTATCTCTGAATATACTATGTGTTTAAATGAAGATTACACAATGGGACTTAAAAATGCGAGGAATAATAAAAG
[0017] This invention analyzed the expression of hsa_circRNA_101231 in peripheral blood plasma of healthy adults and rectal cancer patients, finding that hsa_circRNA_101231 expression was significantly elevated in colorectal cancer patients. In situ hybridization was used to detect hsa_circRNA_101231 expression in paraffin-embedded tissue samples from colorectal cancer patients, revealing a significant negative correlation between hsa_circRNA_101231 expression levels and prognosis. Patients with high hsa_circRNA_101231 expression had significantly lower progression-free survival and overall survival than those with low hsa_circRNA_101231 expression. The stability of hsa_circRNA_101231 was confirmed by RNase R digestion and actinomycin D treatment experiments. These results indicate that hsa_circRNA_101231 can serve as a biomarker for the diagnosis and prognostic assessment of colorectal cancer. Knockdown of hsa_circRNA_101231 siRNA could be used as a small molecule drug for the treatment of colorectal cancer.
[0018] Therefore, this invention seeks to protect the following applications of the circRNA marker hsa_circRNA_101231 shown in SEQ ID NO:1:
[0019] Application of reagents for detecting hsa_circRNA_101231 expression in the preparation of colorectal cancer diagnostic / prognostic assessment products.
[0020] As one possible implementation, the reagents for detecting hsa_circRNA_101231 expression are specific primers and probes for hsa_circRNA_101231.
[0021] Preferably, the specific primers include the upstream primer shown in SEQ ID NO: 2, the downstream primer shown in SEQ ID NO: 3, and the Taqman probe shown in SEQ ID NO: 4, as well as the external reference upstream primer shown in SEQ ID NO: 5, the external reference downstream primer shown in SEQ ID NO: 6, and the external reference Taqman probe shown in SEQ ID NO: 7.
[0022] Furthermore, as one possible implementation, the reagents for detecting hsa_circRNA_101231 expression also include PCR amplification enzyme TaqPfu, 10× Buffer, and Mg2+. + And enzyme-free water.
[0023] The reagent kit's detection system for the sample is as follows: 2 μL TaqPfu enzyme, 5 μL 10× Buffer, Mg2+ +1.5 μL upstream primer, 1.5 μL downstream primer, 1 μL Taqman probe, 1.5 μL upstream primer of external reference, 1.5 μL downstream primer of external reference, 1 μL Taqman probe of external reference, 31.5 μL enzyme-free water, 2 μL cDNA, total 50 μL.
[0024] Preferably, the qPCR reaction program for detecting the sample in the kit is as follows: 95℃ for 5 min; 95℃ for 15 sec; 60℃ for 45 sec; repeat 45 cycles; store at 4℃.
[0025] This invention demonstrated through plate colony formation assays, CCK8 assays, and subcutaneous tumorigenesis experiments in nude mice that knocking down hsa_circRNA_101231 significantly inhibits the growth of colorectal cancer. Furthermore, scratch healing assays, transwell assays, and a nude mouse tail vein lung metastasis model experiments confirmed that knocking down hsa_circRNA_101231 significantly inhibits the invasion and metastasis of colorectal cancer. This indicates that hsa_circRNA_101231 is a therapeutic target for colorectal cancer; therefore, this invention seeks to protect the use of hsa_circRNA_101231 expression in the treatment of colorectal cancer.
[0026] Based on this, the present invention provides a drug for treating colorectal cancer, the drug comprising an hsa_circRNA_101231 expression inhibitor.
[0027] As one possible implementation, the hsa_circRNA_101231 expression inhibitor is si-hsa_circRNA_101231, the sequence of which is shown in SEQ ID NO: 8.
[0028] The beneficial effects of this invention are:
[0029] The results of this invention demonstrate that the expression level of the circRNA biomarker hsa_circRNA_101231 is significantly negatively correlated with the prognosis of colorectal cancer patients, and the expression level of hsa_circRNA_101231 in the plasma of colorectal cancer patients is significantly higher than that in healthy individuals. This invention also verifies the stability of hsa_circRNA_101231, proving that knocking down hsa_circRNA_101231 can significantly inhibit the growth and metastasis of colorectal cancer. These results indicate that hsa_circRNA_101231 can serve as a biomarker for the diagnosis and prognostic assessment of colorectal cancer, as well as a target for colorectal cancer treatment. The discovery of this molecule provides a new theoretical basis and direction for further research on the pathogenesis of colorectal cancer and the exploration of treatment options. It can also be applied to the preparation of diagnostic / prognostic kits for colorectal cancer, enriching the diagnostic and treatment methods for colorectal cancer. Attached Figure Description
[0030] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0031] Figure 1 This is a schematic diagram of the structure of hsa_circRNA_101231. A. Agarose gel electrophoresis to detect the amplification of hsa_circRNA_101231; B. Schematic diagram of the structure of hsa_circRNA_101231.
[0032] Figure 2 The results of RNase R and actinomycin D on the detection of hsa_circRNA_101231 are shown. A. RNase R assay to detect the stability of hsa_circRNA_101231; B. Actinomycin D assay to detect the stability of hsa_circRNA_101231.
[0033] Figure 3 The expression of hsa_circRNA_101231 in peripheral blood plasma of healthy individuals and patients with colorectal cancer was investigated.
[0034] Figure 4 This section shows the expression of hsa_circRNA_101231 in colorectal cancer tissue samples. A. In situ hybridization experiments confirmed high expression of hsa_circRNA_101231 in colorectal cancer tissues; B. Statistical analysis of hsa_circRNA_101231 expression in Figure A.
[0035] Figure 5 To investigate the expression of hsa_circRNA_101231 in colorectal cancer samples and its relationship with patient prognosis.
[0036] Figure 6 To investigate the effect of hsa_circRNA_101231 knockdown on the growth of colorectal cancer cells in vitro. A. qRT-PCR was used to detect the expression of the parent gene SKA3 and hsa_circRNA_101231 after hsa_circRNA_101231 knockdown; B. CCK8 assay was used to detect the effect of hsa_circRNA_101231 knockdown on the growth of SW480 and HCT116 cells; C and D. Colony formation assays were used to detect the effect of hsa_circRNA_101231 knockdown on the colony formation ability of SW480 and HCT116 cells.
[0037] Figure 7 To investigate the effect of hsa_circRNA_101231 knockdown on colorectal cancer growth in vivo. A. Schematic diagram of tumor size after hsa_circRNA_101231 knockdown in vivo; B. Effect of hsa_circRNA_101231 knockdown on colorectal cancer tumor growth in vivo; C. Effect of hsa_circRNA_101231 knockdown on tumor weight in vivo.
[0038] Figure 8 To investigate the effect of hsa_circRNA_101231 knockdown on the invasion of colorectal cancer cells in vitro. A. Scratch wound healing assay to detect the effect of hsa_circRNA_101231 knockdown on the migration ability of SW480 and HCT116 cells; B. Transwell assay to detect the effect of hsa_circRNA_101231 knockdown on the invasive ability of SW480 and HCT116 cells.
[0039] Figure 9 To investigate the effect of hsa_circRNA_101231 knockdown on the invasion and metastasis of colorectal cancer cells in vivo. A. In vivo, colorectal cancer metastasis results after hsa_circRNA_101231 knockdown; B. Statistical results of metastatic nodules in Figure A; CH&E staining was used to detect the effect of hsa_circRNA_101231 knockdown on lung metastasis of colorectal cancer. Detailed Implementation
[0040] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings.
[0041] Unless otherwise specified, all experimental materials used in the following examples were purchased from conventional biochemical reagent stores.
[0042] The SW480 and HCT116 cells used in this invention are colorectal cancer cell lines maintained by the Central Laboratory of Hunan Cancer Hospital. The cell culture conditions were as follows: DMEM liquid medium containing 10% fetal bovine serum (FBS) and 1% penicillin and streptomycin, and cultured in a constant temperature incubator at 37°C, 95% humidity, and 5% CO2 concentration.
[0043] Plasma sample sources: With the approval of the Ethics Committee of Hunan Cancer Hospital and with the informed consent of the patients, plasma samples were collected from healthy individuals undergoing physical examinations and colorectal cancer patients, including plasma samples from 30 healthy individuals and 51 colorectal cancer patients.
[0044] In this invention, the primers for detecting circular RNA differ from those for linear RNA. The circular RNA primers are designed based on both sides of the splice site and are designed online using the Primer 3.0 website. The TaqMan probe used for detection is designed at the splice site. Simultaneously, the knockdown sequence of circRNA hsa_circRNA_101231 is also designed at the splice site to ensure that the expression of its linear parent gene SKA3 is not affected while knocking down circRNA hsa_circRNA_101231. The synthesis of the primers and probes was commissioned to Shanghai Sangon Biotech Co., Ltd., while the siRNA of circRNA hsa_circRNA_101231 was synthesized by Guangzhou Ruibo Biotechnology Co., Ltd.
[0045] The primers and probes used in the PCR reactions in the following examples, along with their sequences, are shown in the table below:
[0046] Table 1 Primer sequences
[0047]
[0048]
[0049] Example 1: Sanger sequencing confirms the structure of hsa_circRNA_101231
[0050] 1. Extraction of total RNA from cells
[0051] Preparation: Sterilized RNase-free water, 75% ethanol (prepared without RNase), chloroform, isopropanol, 1×PBS, enzyme-free tip and EP tube. Pre-cool to 4°C in a high-speed low-temperature centrifuge. Wipe the lab bench and pipette with 75% alcohol before starting the experiment.
[0052] 1) Take the cells from which RNA is to be extracted and wash them twice with 1×PBS or D-hanks;
[0053] 2) Add 500 μL of Trizol lysis buffer to each well of a 12-well plate and lyse at room temperature for 1-2 minutes. Gently pipette the cells off the plate, invert it 10 times, and let it stand at room temperature for 5 minutes.
[0054] 3) Add 100 μL of chloroform (in the ratio of 1 mL Trizol: 0.2 mL chloroform: 0.5 mL isopropanol), shake vigorously for 15-30 seconds, and place on ice for 5 minutes;
[0055] 4) 4℃, 12000rpm / 20min;
[0056] 5) Take the upper aqueous phase into a pre-cooled Tube tube, add 250 μL of isopropanol, and mix well using a vortex mixer or pipette.
[0057] (-20℃>1h);
[0058] 6) At 4℃, 12000rpm / 30min, discard the supernatant;
[0059] 7) Add 1 mL of 75% ethanol (pre-cooled) and mix well;
[0060] 8) 4℃, 7600rpm / 5min; discard the supernatant and repeat steps 8 and 9;
[0061] 9) Flash away for 10 seconds, aspirate as much supernatant as possible, and invert to dry for 10 minutes;
[0062] 10) Add 20-30 μL DEPC and measure RNA concentration and OD value.
[0063] 2. circRNA reverse transcription PCR reaction
[0064] (Procedure according to the instruction manual of abm 5×All-In-One RT Master Mix (with AccuRT Genomic DNA Removal Kit) (#G492))
[0065] Configure the following reaction system:
[0066]
[0067]
[0068] The reverse transcription PCR reaction procedure is as follows:
[0069] 25℃ for 10 minutes,
[0070] 42℃ for 15 minutes,
[0071] 85℃ for 5 minutes.
[0072] After the reaction is complete, store the product at -20℃ for later use.
[0073] 3. Quantitative Real-Time PCR Reaction
[0074] First, dilute the reverse transcription product 5-fold, and then follow the instructions in the abm EvaGreen qPCR MasterMix (MasterMix-R) manual to prepare the following reaction system:
[0075]
[0076] The reaction program on a real-time quantitative PCR instrument is as follows: (Cycle×39)
[0077]
[0078] After the above reaction was performed using the Bio-RadIQ5 real-time quantitative PCR instrument, the melting curve of the amplification products was analyzed using the instrument's built-in software to confirm the amplification specificity, and the PCR amplification products were collected.
[0079] 4. Agarose gel electrophoresis and Sanger sequencing
[0080] The PCR products amplified in step 3 were subjected to agarose gel electrophoresis to further confirm the product's uniqueness. The remaining PCR products were then sent for Sanger sequencing, and the structure of circRNAhsa_circRNA_101231 was confirmed by comparison with the circbase database. Figure 1 A and Figure 1 B).
[0081] Example 2: Detection of hsa_circRNA_101231 characteristics
[0082] 1. RNase R digestion experiment
[0083] 1) Reaction system
[0084] RNase R digestion reaction system
[0085]
[0086] 2) Reaction conditions:
[0087] 37℃, 10-30 min.
[0088] Note: 1) The digestion time can be appropriately extended as the amount of RNA increases. Generally, 10-30 minutes is sufficient to digest most of the linear RNA, resulting in a several hundred-fold decrease in linear RNA abundance detected by PCR. Digestion for more than 1 hour is unnecessary, as excessive time may lead to the digestion of a small number of less tolerant circRNAs. 2) After incubation, the enzyme can be purified and recovered first, or it can be inactivated at 70℃ for 10 minutes before proceeding directly to downstream experiments.
[0089] 3) Purification and recovery:
[0090] 1. Digested RNA can be extracted using a phenol:chloroform:isoamyl alcohol (25:24:1, V:V) solution, followed by ethanol precipitation and recovery; or it can be purified and recovered using an RNA purification column and magnetic beads. qRT-PCR was used to detect hsa_circRNA_101231 and linear mRNA SKA3 (see...). Figure 2 A).
[0091] 2. Note: The phenol:chloroform:isoamyl alcohol (25:24:1, V:V) solution is best prepared fresh and used immediately. If the reagent is unavailable, Trizol Reagent can be used as a substitute.
[0092] 2. Actinomycin D test
[0093] To assess the stability of circRNA and linear RNA, nasopharyngeal carcinoma cells were seeded at approximately 50% density into 12-well plates. After cell adhesion, actinomycin D was added at a final concentration of 1 μg / mL for 0, 8, 16, and 24 hours. RNA was extracted from the cells, reverse transcribed into cDNA, and the expression of hsa_circRNA_101231 and its parent gene SKA3 was detected by qRT-PCR, using 18S rRNA as an internal control (see [link to qRT-PCR]). Figure 2 B).
[0094] Example 3: Expression of hsa_circRNA_101231 in peripheral blood plasma
[0095] RNA was extracted from peripheral blood plasma of healthy individuals and colorectal cancer patients. After reverse transcription, the expression of hsa_circRNA_101231 in plasma was detected by quantitative real-time PCR. The results showed that the expression of hsa_circRNA_101231 in the plasma of colorectal cancer patients was significantly higher than that in healthy individuals (see...). Figure 3 ).
[0096] 3.1 Plasma RNA Extraction
[0097] 1. Centrifuge peripheral blood at 500 rpm for 10 minutes until the blood separates into layers.
[0098] 2. Transfer 250 μL of plasma to a 1.5 mL RNase-free centrifuge tube and add 1 ng of exogenous plasmid DNA as an external control. [Note]: If the plasma volume is less than 250 μL, it needs to be supplemented with PBS or physiological saline.
[0099] 3. Add 750 μL of lysis buffer LB, repeatedly blow and shake vigorously to mix, and let stand at room temperature for 5 min.
[0100] 4. Add 200 μL of chloroform (prepared by the customer), shake vigorously for 15 seconds to mix, and let stand at room temperature for 2 minutes.
[0101] Centrifuge at 12,000 rpm for 10 min at 5.4℃ to separate the sample into layers. Transfer the upper aqueous phase to a 1.5 mL RNase-free centrifuge tube. [Note]: The sample will separate into three layers: a bottom organic phase, a middle layer, and a colorless upper aqueous phase. RNA is present in the upper aqueous phase. [Note]: The upper layer volume is approximately 70% of the total volume of the added lysis buffer (LB). For example, if 750 μL of lysis buffer (LB) is added, the upper aqueous phase will be approximately 525 μL. It is recommended to aspirate 500 μL to prevent DNA contamination from the middle layer.
[0102] 6. Add 0.5 times the volume of anhydrous ethanol (prepared by the customer), and mix by inverting. [Note]: Precipitation is normal.
[0103] 7. Insert the RNA adsorption column B3 into the 2mL collection tube for later use.
[0104] 8. Add the above pretreatment mixture to RNA adsorption column B3, centrifuge at 12,000 rpm for 1 min, and discard the waste liquid.
[0105] 9. Add 500 μL of protein removal solution (PL), centrifuge at 12,000 rpm for 30 seconds, and discard the waste liquid.
[0106] 10. Place the RNA adsorption column B3 back into the collection tube, add 500 μL of wash buffer W*, centrifuge at 12,000 rpm at room temperature for 30 seconds, and discard the waste liquid. [Note]: Ensure that anhydrous ethanol has been added to the wash buffer W*.
[0107] 11. Repeat step 10.
[0108] 12. Place the RNA adsorption column B3 back into the collection tube, and centrifuge the empty column at 12,000 rpm at room temperature for 2 min to remove residual wash buffer W*.
[0109] 13. Place RNA adsorption column B3 into a new 1.5 mL RNase-free centrifuge tube. Add 30-50 μL of RNase-free H2O to the center of RNA adsorption column B3 and incubate at room temperature for 2 min. Then centrifuge at 12,000 rpm for 1 min. Collect the filtrate, which is the RNA solution.
[0110] Reverse transcription reaction
[0111] The extracted RNA was reverse transcribed into cDNA using the Thermo Fisher Scientific RevertAid First Strand cDNA Synthesis Kit. The reaction system is as follows:
[0112]
[0113]
[0114] Mix thoroughly, incubate at 42°C for 60 min for reverse transcription, incubate at 70°C for 5 min to inactivate reverse transcriptase, and then quickly place in an ice bath and store the sample at -20°C.
[0115] Real-time fluorescence quantitative PCR
[0116] This experiment detects the relative expression of the target gene in cells. The specific reaction system is configured as follows:
[0117]
[0118] qRT-PCR was performed using a Roche 480 Real-Time PCR Detection System PCR instrument. The specific reaction conditions are as follows:
[0119]
[0120] Standardization was performed using exogenous genes as external references, with 2 -△△CT The relative expression level of genes is represented by a value, and the differential expression of genes is analyzed using a t-test.
[0121] Example 4: Expression of hsa_circRNA_101231 in colorectal cancer tissue samples
[0122] The expression of hsa_circRNA_101231 in paraffin-embedded nasopharyngeal carcinoma tissue and adjacent normal tissue was analyzed. The expression of hsa_circRNA_101231 in paraffin-embedded nasopharyngeal carcinoma tissue and adjacent normal tissue was detected using an in situ hybridization kit (BOSTER, Wuhan, China). Probe sequences were designed to span the hsa_circRNA_101231 splice site (~30 nt). Staining density and depth were assessed using a semi-quantitative scoring system. Double-blind scoring was performed by two experienced pathologists. (1) Staining intensity: 0, unstained; 1, light brown; 2, brown without background or dark brown with a light brown background (moderately positive); 3, dark brown without non-specific background (strongly positive). (2) Fractional positive signal based on proportion of total cells: 0, no positive cells; 1, 0–25%; 2, 25–50% positive rate; 3, 50–70% positive rate; 4, 70–100% positive rate.
[0123] In situ hybridization experiment
[0124] 1) Baking: Place the slices in a 65℃ constant temperature oven and bake for 2 hours to melt the paraffin wax.
[0125] 2) Dewaxing: Quickly place the sections in xylene twice for 20 minutes each time to allow the xylene to fully dissolve the paraffin in the tissue. Then hydrate the sections according to the following procedure: 100% ethanol I for 2 minutes, 100% ethanol II for 2 minutes, 95% ethanol I for 2 minutes, 85% ethanol for 2 minutes, 75% ethanol for 2 minutes, 50% ethanol for 2 minutes, and wash once with enzyme-free water.
[0126] 3) Block endogenous peroxidase: 3% H2O2 for 15 min, wash twice with 1×PBS for 5 min each time.
[0127] 4) Digestion: Pepsin diluted with 3% citric acid was incubated at room temperature for 20 min, digestion was stopped with 0.1M glycine, washed 3 times with 1×PBS for 5 min each time, and washed once with enzyme-free water.
[0128] 5) Prehybridization: Remove excess water, add prehybridization solution, and incubate at 37°C for 3 hours.
[0129] 6) Hybridization: Discard the pre-hybridization solution, add the diluted probe, and incubate overnight at 37°C.
[0130] 7) Washing after hybridization: Wash as follows: 2×SSC solution for 10 min at room temperature 3 times; 0.5×SSC solution for 15 min at room temperature; 0.2×SSC solution for 15 min at room temperature (repeat once if necessary).
[0131] 8) Sealing: Add sealing solution at 37℃ for 30 minutes. Shake off excess liquid, do not wash.
[0132] 9) Add biotinylated mouse anti-digoxin: 37℃ for 60 min, wash 4 times with 0.5M PBS for 5 min each time.
[0133] 10) Add SABC: 30 min at room temperature. Wash 3 times with 0.5 M PBS for 5 min each time.
[0134] 11) Add biotinylated peroxidase: 30 min at room temperature. Wash 4 times with 0.5M PBS for 5 min each time.
[0135] 12) DAB color development: Prepare the color development working solution according to the DAB kit instructions, mix well and drop it onto the specimen, observe and control the color development under a microscope, and wash away the excess color with distilled water.
[0136] 13) Hematoxylin staining of the nucleus: Add hematoxylin to the section, stain at room temperature for 1-2 min, differentiate with 0.5% hydrochloric acid alcohol for 1-2 sec, and then rinse with running water for 30 min. Observe the staining of the nucleus under a microscope.
[0137] 14) Dehydration: Place the slices in a gradient of 50%, 70%, 80%, 95% and 100% alcohol to dehydrate, and then air dry in a fume hood for 30 minutes.
[0138] 15) Mounting: Add an appropriate amount of neutral resin to the slide and mount it. Let it air dry in a fume hood, then observe and photograph it under a microscope.
[0139] The hsa_circRNA_101231 was scored by the intensity and extent of staining, confirming its high expression in colorectal cancer tissues. Figure 4 ).
[0140] Example 5: Correlation between hsa_circRNA_101231 expression and patient prognosis in colorectal cancer.
[0141] Colorectal cancer patients were grouped according to the expression levels of hsa_circRNA_101231 in paraffin-embedded tissue samples, and the relationship between hsa_circRNA_101231 expression and patient prognosis was analyzed. It was found that patients with high hsa_circRNA_101231 expression had relatively poor progression-free survival and overall survival, while patients with low hsa_circRNA_101231 expression had relatively good progression-free survival and overall survival. Figure 5 ).
[0142] Example 6: In vitro, knockdown of hsa_circRNA_101231 inhibited the growth of colorectal cancer cells.
[0143] In this embodiment, siNC and si-hsa_circRNA_101231 were first transfected into SW480 and HCT116 cells using Hiperfect. After culturing for 24 hours, the expression of the parent gene SKA3 and the circular RNA has_circRNA_101231 was detected by qRT-PCR, and cell growth was assessed by plate colony formation assay and CCK8 assay. The results showed that in vitro, knockdown of hsa_circRNA_101231 significantly inhibited the growth of SW480 and HCT116 cells. Figure 6 ).
[0144] Plate colony formation experiment
[0145] 1) Digest the cells used in the experiment and count them. Seed 1500 cells / well into a 6-well plate and change the medium every two days.
[0146] 2) After 14 days, discard the supernatant, wash the cells with PBS, and fix them with 4% paraformaldehyde at room temperature for 20 min.
[0147] 3) Discard the paraformaldehyde, wash once with PBS, and stain with crystal violet for 20 minutes;
[0148] 4) Discard the crystal violet staining solution, wash several times with PBS until a clear clonal morphology can be seen, discard the PBS, and air dry.
[0149] 5) After the PBS has completely dried, use a scanner to scan and photograph it.
[0150] CCK8 Experiment
[0151] 1) Digest the cells used for the experiment and count them. Seed 1500 cells / well into a 96-well plate, with 5 replicates per group of cells.
[0152] 2) After incubating in a cell culture incubator for 12 hours, add 10 μl of CCK8 solution per well, incubate at 37°C for 1 hour, and detect the absorbance of each well at 450 nm wavelength using an enzyme-linked immunosorbent assay (ELISA) reader.
[0153] 3) Repeat the addition of CCK8 and measurement of absorbance values every 24 hours for a total of 6 times.
[0154] Example 7: In vivo, knockdown of hsa_circRNA_101231 inhibits the growth of colorectal cancer cells.
[0155] After knocking down hsa_circRNA_101231 in colorectal cancer cells HCT116, a subcutaneous tumorigenesis model was constructed in nude mice, and the growth of subcutaneous tumors in nude mice was observed. The results showed that knocking down hsa_circRNA_101231 significantly inhibited the growth of colorectal cells in vivo (see...). Figure 7 ).
[0156] siRNA transfection
[0157] (1) Seed cells in the logarithmic growth phase into 6-well plates and culture them in a 37°C cell culture incubator. When the cell confluence reaches 40%-50%, siRNA transfection can be performed.
[0158] (2) Prepare the siRNA solution in a clean bench according to the siRNA instructions. Take a sterile 1.5mL EP tube, add 200μl of OPTI-MEM serum-free medium, add 2.5μl of transfected siRNA (20nM), and finally add 2.5μl of Hiperfect transfection reagent. Mix well and incubate at room temperature for 10-15 minutes. Next, change the medium in a 6-well plate, add the prepared mixture to each 6-well plate, and incubate at 37℃ for 48 hours.
[0159] (3) Collect cells, extract RNA, and perform qRT-PCR to identify the knockdown efficiency or extract protein and perform Western blot to identify the protein knockdown effect.
[0160] Construction of a subcutaneous tumorigenesis model in nude mice
[0161] (1) Preparation of nude mice: Ten 4-week-old female BALB / C nude mice were purchased from Hunan Slack Jingda Experimental Animal Co., Ltd., and randomly divided into two groups of 5 mice each. They were housed in the animal room of the Affiliated Cancer Hospital of Xiangya Medical College of Central South University (Hunan Cancer Hospital) under specific pathogen-free (SPF) conditions. The experiment was conducted one week later.
[0162] (2) Cell preparation: Two types of HCT116 cells in logarithmic growth phase (cells transfected with pcDNA3.1 control plasmid and pcDNA3.1-hsa_circRNA_101231 overexpression vector) were taken. The cells were digested from the culture dish using trypsin digestion solution, and then washed, resuspended, and counted with physiological saline. Finally, the cell concentration was adjusted to 2.5 × 10⁻⁶ cells / mL with physiological saline. 7 5 × 10⁶ cells / mL, each mouse was injected with 5 × 10⁶ cells / mL. 6 One cell (approximately 200 μl of cell suspension).
[0163] (3) Subcutaneous injection: Pinch the neck of the nude mouse with the index finger and thumb of the left hand, and at the same time use the little finger, ring finger and fingertip of the left hand to hold the tail of the nude mouse to fix it. Gently wipe the right upper limb axilla of the mouse with an alcohol cotton ball, and slowly inject the cells into the subcutaneous tissue of the right upper limb axilla using a syringe.
[0164] (4) After the subcutaneous injection of cells is completed, observe the growth of nude mice every day, and record the weight changes and tumor size of nude mice every three days.
[0165] (5) Sacrifice the nude mice: After observing that the subcutaneous tumor tissue has grown to a suitable size, the experiment was terminated. All 10 nude mice were euthanized by cervical dislocation and dissected. The subcutaneous tumor tissue was removed and photographed.
[0166] Example 8: In vitro, knockdown of hsa_circRNA_101231 inhibited the invasion and migration of colorectal cancer cells.
[0167] In this embodiment, siNC and si-hsa_circRNA_101231 were first transfected into SW480 and HCT116 cells using Hiperfect. After culturing for 24 hours, cell migration and invasion were detected by scratch healing assay and transwell assay. It was found that knocking down hsa_circRNA_101231 could significantly inhibit the invasion and migration of colorectal cancer cells (see...). Figure 8 ).
[0168] Scratch healing assay
[0169] Scratch healing assays were performed using 6-well plates. After cell transfection and cell growth to the bottom of the plate (approximately 24-36 hours), cells were gently scratched with a 10 μL colorless pipette tip, washed twice with 1×PBS, and then infused with complete culture medium containing 2% FBS. The scratch width at this point was photographed and recorded as the width at 0 hours. Cells were then cultured in a cell culture incubator, and the scratch width was photographed at 24 hours and 48 hours. The migration rate of cells in different treatment groups was analyzed based on the obtained images.
[0170] Transwell chamber invasion experiment
[0171] BD Matrigel gel was thawed at 4°C and prepared for use. The Matrigel gel was diluted with serum-free medium at a ratio of 1:14. After thorough mixing, 60 μL was added to the upper chamber of each Transwell plate and incubated at 37°C for 1 hour to solidify. Cells for the experiment were digested, washed twice with serum-free medium, resuspended in serum-free medium, and counted. Cells were added to the upper chamber of each Transwell plate at a ratio of 100,000 cells / well / 200 ml. 800 μL of medium containing 20% fetal bovine serum was added to the lower chamber of each Transwell plate, and the plates were incubated at 37°C for 48 hours. After removing the Transwell chamber, wash it three times with physiological saline, fix the cells with 4% paraformaldehyde at room temperature for 30 min, wash the chamber three times with physiological saline, stain with 0.1% crystal violet at room temperature for 10 min, wash away excess crystal violet with physiological saline, wipe the Matrigel gum on the upper surface of the chamber with a cotton swab, observe and photograph under an inverted microscope and count the number of cells.
[0172] Example 9: In vivo, knockdown of hsa_circRNA_101231 inhibited the invasion and metastasis of colorectal cancer cells.
[0173] After knocking down hsa_circRNA_101231 in HCT116 colorectal cancer cells, a nude mouse lung metastasis model was constructed to observe the effect of hsa_circRNA_101231 knockdown on invasion and metastasis. It was found that compared with the control group, mice in the hsa_circRNA_101231 knockdown group had significantly fewer lung metastatic nodules and significantly fewer tumor metastatic lesions, indicating that hsa_circRNA_101231 knockdown can significantly inhibit the invasion and metastasis of colorectal cancer cells (see...). Figure 9 ).
[0174] Construction of a nude mouse lung metastasis model
[0175] Nude mice were first acclimatized to a barrier environment for one week after arriving at the Cancer Hospital Affiliated to Xiangya School of Medicine, Central South University (Hunan Cancer Hospital). During this period, colorectal cancer cells for model construction were prepared. HCT116 cells in logarithmic growth phase (transfected with siNC and si-hsa_circRNA_101231) were digested, washed three times with physiological saline, resuspended in physiological saline, and counted. Finally, the cell concentration was adjusted to 1×10⁻⁶ cells with physiological saline. 7 2 × 10⁶ cells / mL, 2 × 10⁶ cells / mL per nude mouse 6 Each nude mouse was injected with one cell (approximately 200 μL of cell suspension). Nude mice were randomly divided into 3 groups of 5 mice each. Tumor cells were injected into the nude mice via the tail vein. The weight of the nude mice was recorded every 3 days. After 60 days, the nude mice were sacrificed and lung tissue was collected, fixed, and the tumor formation was observed.
[0176] The above-described embodiments are merely preferred embodiments of the present invention, and the scope of protection of the present invention is not limited thereto. Any simple changes or equivalent substitutions of the technical solutions that can be obviously obtained by those skilled in the art within the scope of the technology disclosed in the present invention shall fall within the scope of protection of the present invention.
Claims
1. Application of reagents for detecting hsa_circRNA_101231 expression in the preparation of colorectal cancer diagnostic products, wherein the sequence of the circular RNA is shown in SEQ ID NO:
1.
2. Application of reagents for detecting hsa_circRNA_101231 expression in the preparation of colorectal cancer prognostic assessment products, wherein the sequence of the circular RNA is shown in SEQ ID NO:
1.
3. The application as described in claim 1 or 2, characterized in that, The reagents used to detect hsa_circRNA_101231 expression were specific primers and probes for detecting circular RNA.
4. The application as described in claim 3, characterized in that, The specific primers include the upstream primer shown in SEQ ID NO: 2 and the downstream primer shown in SEQ ID NO: 3; the probe is shown in SEQ ID NO:
4.
5. The application of a substance that knocks down the expression of hsa_circRNA_101231 in the preparation of a drug for the treatment of colorectal cancer; The substance that knocks down hsa_circRNA_101231 expression is a siRNA that specifically interferes with the expression of the hsa_circRNA_101231 gene, and the sequence of the siRNA is shown in SEQ ID NO: 8.