A SNP molecular marker associated with body weight at 12 weeks of age in chickens and its application

Abstract

The present invention discloses a SNP molecular marker associated with the weight of chickens at 12 weeks of age and its application. The position of the SNP site in the genome is nucleotide 26,907,478 on chromosome 5, located on the 3'UTR of the RGS6 gene. GWAS results show that the SNP site presents a G / C polymorphism, and G has a positive effect on the weight at 12 weeks of age. For this site, genotype statistical analysis was performed in other high-weight and low-weight groups to further verify that the GG genotype is the dominant genotype in high-weight chickens, and the proportion of the GG genotype in high-weight chickens is significantly higher than that in low-weight chickens. Therefore, chickens with the GG genotype at this site can be preferred, and it is expected that high-weight chickens can be selected early, thereby accelerating the genetic breeding of chickens.

Description

Technical Field

[0001] The invention belongs to the field of molecular biology, and in particular relates to a SNP molecular marker associated with the weight of chickens at 12 weeks of age and an application thereof. Background Art

[0002] Broiler farming is the most scaled, best-managed, and most well-developed sector of the livestock industry. This industry encompasses a wide range of processes, including breeding stock, livestock equipment, feed processing, veterinary medicine, vaccines, animal health care, slaughtering, and food processing. In recent years, the scale of broiler farming has continued to expand. While large-scale farming enterprises and small-scale farmers coexist, large-scale, intensive farming has become the mainstream. To improve efficiency and reduce costs, farming enterprises generally adopt advanced farming technologies and management models, resulting in the continuous expansion of farming operations.

[0003] In the broiler farming sector, technological progress and innovation are key drivers of industry development. Modern farming equipment, intelligent management systems, and the application of biotechnology are continuously improving the efficiency and quality of broiler farming. Furthermore, with increased investment in scientific research, new breeds and technologies are constantly emerging, providing strong support for the continued development of the broiler farming industry.

[0004] With the rapid growth in demand, increasing yield and improving quality have become key priorities in the chicken breeding field. Traditional methods of selecting chicken breeds for superior traits are labor-intensive, cumbersome, and inefficient. However, advances in genomics research and genetic marker technology have enabled breeders to select genotypes with superior traits for breeding, thereby further improving chicken production and quality.

[0005] SNPs (single nucleotide polymorphisms) are an important form of genetic variation, characterized by abundance, widespread distribution, and high stability. They are widely used in molecular breeding and genetic research. However, in molecular breeding of broiler chickens, markers with clear functions and significant impact on traits remain scarce. Therefore, the in-depth exploration of molecular markers with strong effects and high applicability has become a current research hotspot.

[0006] The weekly weight of chickens is a core trait. By discovering SNP molecular markers that are significantly correlated with the weekly weight of chickens and selecting chicken breeds with fast growth and large weight through molecular markers, the production efficiency of the group can be significantly improved. Summary of the Invention

[0007] The technical problem to be solved by the present invention is to provide a SNP molecular marker related to chicken weight traits and its application.

[0008] The technical solution of the present invention is: a method for breeding chickens with high weight traits, extracting genomic DNA from chicken samples, detecting the genotype of position 26,907,478 on chromosome 5 of the chicken samples, and selecting individuals with a genotype of GG at this site as having a higher weight trait than other genotypes, and the reference genome version is GRCg6a.

[0009] The application of substances for detecting SNP site polymorphism or genotype in assisted breeding for chicken weight traits. The SNP site is located at position 26,907,478 of chicken chromosome 5 and has a G / C polymorphism. Individuals with the GG genotype at this site have a higher weight trait than other genotypes. The reference genome version is GRCg6a.

[0010] Furthermore, the substance is a primer pair, and the nucleotide sequences of the primer pair are shown as SEQ ID No.1 and SEQ ID No.2.

[0011] The invention relates to the use of a substance for detecting SNP site polymorphism or genotype in the preparation of a chicken weight trait assisted breeding kit, wherein the SNP site is located at position 498 of the nucleotide sequence shown in SEQ ID No. 3.

[0012] Furthermore, the substance is a primer pair, and the nucleotide sequences of the primer pair are shown as SEQ ID No.1 and SEQ ID No.2.

[0013] A kit contains the primer pair shown as SEQ ID No. 1 and SEQ ID No. 2.

[0014] Compared with the prior art, the present invention has the following beneficial effects:

[0015] The SNP molecular marker of the present invention is significantly correlated with the weight of chickens at 12 weeks of age. The GG genotype is the dominant genotype in heavier chickens, and the proportion of GG genotypes in heavier chickens is significantly higher than that in lighter chickens. Therefore, chickens with the GG genotype at this locus can be preferred, potentially enabling early selection of heavier chickens, thereby accelerating genetic breeding of chickens. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 Association between chromosome 5 SNP and weight of chickens at 12 weeks of age;

[0017] Figure 2 Genotypic distribution of high- and low-weight chickens. DETAILED DESCRIPTION

[0018] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are purchased from commercial channels unless otherwise specified.

[0019] Example 1 Mining of SNP Molecular Markers

[0020] Resequencing technology was used to sequence the individuals of the hybrid population of chickens, and the identified SNPs were quality-controlled and filtered, from which a SNP site significantly associated with the weight of chickens at 12 weeks of age was selected ( Figure 1 ).

[0021] This SNP is located at position 26,907,478 (SNP name: rs315692422) on chromosome 5 in the GRCg6a genome (https: / / ftp.ensembl.org / pub / release-106 / fasta / gallus_gallus / dna / Gallus_gallus.GRCg6a.dna.chromosome.1.fa.gz). This locus was observed in 1,073 chickens that passed quality filtering. The effect and significance P value are shown in Table 1. The C allele showed a strong negative correlation with body weight (BETA = -40.1152), indicating that the G allele is dominant in heavier chickens.

[0022] Table 1 Allele frequencies and effect sizes

[0023]

[0024] According to the chicken gene annotation, the site was found to be located in the 3'UTR of the chicken RGS6 gene. This site may affect the expression and function of the gene by affecting the activity of the 3'UTR.

[0025] Example 2 Verification of SNP Molecular Markers

[0026] 1. Experimental Materials

[0027] Low-weight chicken breeds: Daweishan small chicken (n=8), Jiangxi silk-feather chicken (n=20), Tibetan chicken (n=1), Tibetan chicken (Aba, n=5), Tibetan chicken (Haiyan, n=6), Tibetan chicken (Lhasa, n=26), Tibetan chicken (Shigatse, n=36), Tibetan chicken (Shannan, n=27).

[0028] High-weight chicken breeds: Luxi fighting chicken (n=9), Nanjiang fighting chicken (n=8), Cornish chicken (n=1), Langshan chicken (n=9), White Plymouth chicken (n=1), Guangxi chicken (n=6), Miyi chicken (n=5), Yuanbao chicken (n=24).

[0029] 2. Test methods

[0030] The genotype data of 928 chickens were downloaded from Galbase (http: / / animal.omics.pro / code / index.php / ChickenVar). The genotypes of the rs315692422 locus in 63 high-weight chicken breeds and 129 low-weight chicken breeds were extracted using a self-written script, and the genotype distribution of each chicken breed was statistically analyzed (Table 2).

[0031] Table 2 Genotype distribution of various chicken breeds

[0032]

[0033] 3. Results Analysis

[0034] The frequency of the G allele at chr5:26,907,478 in high-weight chickens was 0.81, 1.49 times that of low-weight chickens, with a P value of 0.00065. Therefore, the G genotype is the dominant genotype in high-weight chickens. Genotype analysis revealed that the proportion of the GG genotype in high-weight chickens was 0.68, while the proportion of the GG genotype in low-weight chickens was 0.38. The GG genotype in high-weight chickens was significantly higher than that in low-weight chickens, with a P value of 0.00011. Therefore, by comparing the SNP frequency and genotype distribution in populations of high-weight and low-weight chickens, this SNP molecular marker was confirmed. By selecting individuals with the GG allele at this locus, the weight of the breeding population can be increased.

[0035] Example 3 Detection of SNP Molecular Markers

[0036] (1) Based on the upstream and downstream sequence information of the SNP molecular marker, primers were designed to amplify the fragment containing the SNP site; forward primer F: CTTATTACTAGCACACCTTGTGTTG (SEQ ID No. 1)

[0037] Reverse primer R: TTCTCTGAGACAAACATCATGAGAG (SEQ ID No. 2)

[0038] (2) The genomic DNA of the chicken sample to be tested was extracted as a template, and PCR amplification was performed using the primer pair designed in (1) to obtain an amplified product of 869 bp in size containing the SNP site, the sequence of which is shown in SEQ ID No. 3. The SNP site is located at position 498 of the sequence shown in SEQ ID No. 3.

[0039] (3) The amplified product was subjected to Sanger sequencing to obtain the genotype of the SNP site.

Claims

1. A method for breeding high-weight chickens, characterized in that: Genomic DNA of chicken samples was extracted, and the genotype of position 26,907,478 of chromosome 5 of the chicken samples was tested. Individuals with the genotype of GG at this site were selected to have a higher weight trait than other genotypes. The reference genome version was GRCg6a.

2. Application of substances for detecting SNP site polymorphism or genotype in assisting breeding for chicken weight traits. The SNP site is located at position 26,907,478 on chicken chromosome 5 and has a G / C polymorphism. Individuals with the GG genotype at this site have a higher weight trait than those with other genotypes. The reference genome version is GRCg6a.

3. The use according to claim 2, characterized in that The substance is a primer pair, and the nucleotide sequences of the primer pair are shown as SEQ ID No.1 and SEQ ID No.

2.

4. Use of a substance for detecting SNP polymorphism or genotype in the preparation of a kit for assisted breeding of chicken weight traits, wherein the SNP site is located at position 498 of the nucleotide sequence shown in SEQ ID No. 3, and individuals with the GG genotype at this site are selected to have a higher weight trait than those with other genotypes.

5. The use according to claim 4, characterized in that The substance is a primer pair, and the nucleotide sequences of the primer pair are shown as SEQ ID No.1 and SEQ ID No.2.

Images