RNAi agent for inhibiting AGT gene expression and application thereof

Abstract

Relates to an AGT-targeted double-stranded RNAi agent, a pharmaceutical composition containing the AGT-targeted double-stranded RNAi agent and application of the AGT-targeted double-stranded RNAi agent to preparation of drugs for treating diseases related to AGT expression, such as hypertension.

Description

RNAi agent for inhibiting AGT gene expression and its application

[0001] Cross-references

[0002] This application claims priority to the Chinese patent application filed with the Patent Office of China on July 6, 2023, with application number 202310826984.8, and invention name “A RNAi agent for inhibiting AGT gene expression and its application”, and the Chinese patent application filed with the Patent Office of China on April 19, 2024, with application number 202410478014.8, and invention name “A RNAi agent for inhibiting AGT gene expression and its application”, the entire contents of which are incorporated by reference into this disclosure. Technical Field

[0003] The present application belongs to the field of molecular biology and relates to a modified double-stranded RNAi agent and its application, specifically to a double-stranded RNAi agent for inhibiting AGT gene expression and its pharmaceutical composition, as well as the application of the double-stranded RNAi agent or its pharmaceutical composition for treating diseases mediated by AGT expression. Background Art

[0004] RNA interference (RNAi) is widespread in nature. Since Andrew Fire, Craig Mello, and others first discovered RNAi in the nematode Caenorhabditis elegans (C. elegans) in 1998, and Tuschl, Phil Sharp, and others confirmed its existence in mammals in 2001, research has made significant progress in understanding its mechanisms, gene functions, and clinical applications. RNAi plays a key role in various protective mechanisms, including defense against viral infection and transposon jumping (Hutvágner et al., 2001; Elbashir et al., 2001; Zamore 2001). Products developed based on RNAi mechanisms are promising drug candidates. Small interfering RNA (siRNA), capable of RNAi interference, is the primary tool for achieving RNAi.

[0005] Hypertension is a serious cardiovascular disease that significantly increases the risk of heart, brain, kidney and other diseases and is the leading cause of premature death worldwide. Hypertension is diagnosed based on two systolic blood pressure (SBP) readings of ≥140 mmHg and / or two diastolic blood pressure (DBP) readings of ≥90 mmHg on two different days.

[0006] An estimated 1.28 billion adults aged 30-79 worldwide suffer from hypertension. Of these, 46% are unaware of their condition, only 42% receive diagnosis and treatment, and only about one-fifth (21%) of hypertensive patients have their blood pressure under control. In my country, the latest disease survey data shows that over a quarter of residents aged 18 and over have hypertension, but the control rate is only 16.9%. The prevention and treatment of hypertension is a critical issue. Hypertension can damage vital organs such as the heart, brain, and kidneys, earning it the nickname "the silent killer."

[0007] Chronic overactivity of the renin-angiotensin-aldosterone system (RAAS) pathway is considered a major factor in the pathogenesis of cardiovascular diseases, including hypertension and heart failure. Although inhibition of the RAAS pathway with angiotensin-converting enzyme inhibitors (ACEis) or type I angiotensin receptor blockers (ARBs), such as the commonly used sartan or pril antihypertensive drugs, is one of the most effective treatments for hypertension and heart failure with reduced ejection fraction, this approach has limited efficacy in preventing target organ damage and cardiovascular death. It is also associated with a high risk of on-target toxicity, primarily manifested as hyperkalemia and renal insufficiency, necessitating the use of lower clinical doses, limiting its ability to achieve greater inhibition of these pathways and clinical benefits. Furthermore, downstream inhibition of the RAAS pathway may also lead to compensatory increases in upstream pathways, further limiting its therapeutic efficacy.

[0008] In rodents and humans, angiotensin (1-12) has been identified as a renin-independent substrate for angiotensin II production. Therefore, a team of researchers from the United States designed a monoclonal antibody targeting the C-terminus of the human angiotensin (1-12) sequence. Using a rat model of hypertension in which the human angiotensinogen (AGT) gene is expressed in the rat genome, the researchers investigated the effectiveness of immunoneutralization of endogenous human angiotensin (1-12) in controlling elevated blood pressure and reversing hypertension-induced target organ damage. They concluded that angiotensin (1-12) is an endogenous substrate for angiotensin II production that participates in arterial pressure control in a humanized hypertension model, and that selective immunoneutralization of this alternative substrate is a promising new therapeutic approach for treating hypertension and preventing its adverse cardiovascular sequelae.

[0009] Targeting the upstream RAAS pathway by silencing hepatic AGT represents a novel mechanism of RAAS inhibition. This approach offers two potential advantages over current RAAS inhibitors. First, by inhibiting AGT production in the liver and minimizing RAAS inhibition in the kidney, it could exhibit a better safety profile by allowing renal homeostasis and glomerular feedback to remain intact, thereby mitigating increases in potassium (K+) and renal dysfunction. Second, it could minimize escape mechanisms that could restore angiotensin II levels or maintain angiotensin II signaling. More complete inhibition of angiotensin II produced locally in the vasculature or cardiac tissue could benefit patients with refractory hypertension or heart failure. Therefore, the development of a highly effective inhibitor that silences AGT would provide an effective means of treating subjects with angiotensinogen-related diseases with improved efficacy, specificity, stability, targeting, or tolerability.

[0010] Summary of the Invention

[0011] The purpose of the present application is to provide a double-stranded RNAi agent for inhibiting AGT gene expression, and a pharmaceutical composition thereof, as well as methods and uses of the double-stranded RNAi agent and its pharmaceutical composition for inhibiting or reducing AGT gene expression or treating AGT gene-mediated diseases or symptoms.

[0012] In one embodiment of the present application, a double-stranded RNAi agent is provided, which is capable of inhibiting the expression of AGT in a cell, wherein the double-stranded RNAi agent comprises a sense strand and an antisense strand, wherein the sense strand is complementary to the antisense strand, and the antisense strand comprises a sequence complementary to a portion of the sequence of the mRNA encoding AGT, wherein each strand is 14 to 30 nucleotides in length.

[0013] For example, each strand (sense or antisense) can be between 14-30 nucleotides in length, 17-30 nucleotides in length, 25-30 nucleotides in length, 27-30 nucleotides in length, 17-23 nucleotides in length, 17-21 nucleotides in length, 17-19 nucleotides in length, 19-25 nucleotides in length, 19-23 nucleotides in length, 19-21 nucleotides in length, 21-25 nucleotides in length, or 21-23 nucleotides in length.

[0014] The duplex region of the double-stranded RNAi agent can, for example, be between 14-30 nucleotide pairs in length, 17-30 nucleotide pairs in length, 27-30 nucleotide pairs in length, 17-23 nucleotide pairs in length, 17-21 nucleotide pairs in length, 17-19 nucleotide pairs in length, 19-25 nucleotide pairs in length, 19-23 nucleotide pairs in length, 19-21 nucleotide pairs in length, 21-25 nucleotide pairs in length, or 21-23 nucleotide pairs in length.

[0015] In another embodiment, the duplex region has a length selected from 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, and 27 nucleotide pairs.

[0016] In one embodiment of the present application, the double-stranded RNAi agent is capable of inhibiting the expression of AGT gene in humans, monkeys, rats or mice.

[0017] The RNAi agents of the present application include those having a nucleotide overhang at one end (ie, an agent having one overhang and one blunt end) or those having nucleotide overhangs at both ends.

[0018] In one embodiment, the double-stranded RNAi agent may contain one or more overhang regions and / or blocking groups at the 3' end, 5' end, or both ends of one or both chains. The overhang may be 1-6 nucleotides in length, for example, 2-6 nucleotides in length, 1-5 nucleotides in length, 2-5 nucleotides in length, 1-4 nucleotides in length, 2-4 nucleotides in length, 1-3 nucleotides in length, 2-3 nucleotides in length, or 1-2 nucleotides in length, and the overhang is arbitrarily selected from U, A, G, C, and T.

[0019] In one embodiment, the sense strand of the double-stranded RNAi agent has 21 nucleotides and the antisense strand has 23 nucleotides.

[0020] In the present application, the nucleotide sequence of the double-stranded RNAi agent is shown in any dsRNA sequence in Table 2.

[0021] In one embodiment, the sense strand of the double-stranded RNAi agent consists of the nucleotide sequence of GUCAUCCACAAUGAGAGUACA (SEQ ID NO: 1) (5'-3' direction), and / or the antisense strand of the double-stranded RNAi agent consists of the nucleotide sequence of UGUACUCUCAUUGUGGAUGACGA (SEQ ID NO: 2) (5'-3' direction). In one embodiment, the sense strand of the double-stranded RNAi agent consists of the nucleotide sequence of GUCAUCCACAAUGAGAGUACC (SEQ ID NO: 3) (5'-3' direction), and / or the antisense strand of the double-stranded RNAi agent consists of the nucleotide sequence of GGUACUCUCAUUGUGGAUGACGA (SEQ ID NO: 4) (5'-3' direction).

[0022] In one embodiment, the sense strand of the double-stranded RNAi agent consists of the nucleotide sequence of CUUCUAAUGAGUCGACUUUGA (SEQ ID NO: 5) (5'-3' direction), and / or the antisense strand of the double-stranded RNAi agent consists of the nucleotide sequence of UCAAAGUCGACUCAUUAGAAGAA (SEQ ID NO: 6) (5'-3' direction).

[0023] In another embodiment, one or more nucleotides of the sense strand and the antisense strand of the double-stranded RNAi agent have one or more modifications selected from the following group: 2′-methoxyethyl, 2′-O-alkyl, 2′-O-allyl, 2′-C-allyl, 2′-fluoro, 2′-deoxy, 2′-hydroxyl, locked nucleic acid modification, open ring or non-locked nucleic acid modification, DNA modification, fluorescent probe modification.

[0024] In one embodiment of the present application, both the sense and antisense strands of the double-stranded RNAi agent contain 2'-O-methyl and / or 2'-fluoro modifications. In another embodiment of the present application, the double-stranded RNAi agent further comprises at least one phosphorothioate or methylphosphonate internucleotide linkage, preferably at least one phosphorothioate linkage.

[0025] In another embodiment of the present application, in the double-stranded RNAi agent, the phosphorothioate or methylphosphonate internucleotide linkages are at the 5' and 3' ends of one chain, preferably, the internucleotide linkages are at the 5' and 3' ends of the sense chain and the antisense chain; more preferably, the internucleotide linkages are between the three nucleotides at the 5' and 3' ends of the sense chain and the antisense chain.

[0026] In another embodiment of the present application, the double-stranded RNAi agent comprises: (1) the antisense chain has a protruding end with a 5'(s)mN(s)mN3' structure at the 3' end; (2) the antisense chain is fluorinated at least at positions 2, 14, and 16 from the 5' end, and methoxy is used as much as possible at other positions; (3) the antisense chain has at least two thio modifications from the 3' and 5' ends, and preferably, at least the first and second internucleotide linkages from the 3' and 5' ends of the antisense chain include thiophosphate backbone modifications; (4) the sense chain is fluorinated at position 7 and positions 9-11 from the 5' end, and methoxy is used as much as possible at other positions; (5) the sense chain has at least two thio modifications from the 5' end, and preferably, at least the first and second internucleotide linkages from the 5' end of the sense chain include thiophosphate backbone modifications, and preferably, GalNAc is covalently coupled to the 3' end.

[0027] In another embodiment of the present application, the double-stranded RNAi agent comprises: (1) a sense strand comprising 21 nucleotides, consisting of alternating 2′-fluoro modified regions and 2′-O-methyl modified regions, each modified region being 1 to 3 nucleotides in length; the modification manner of the first modified region from the 5′ end and the 3′ end is the same; (2) an antisense strand comprising 23 nucleotides, consisting of alternating 2′-O-methyl modified regions and 2′-fluoro modified regions, each modified region being 1 to 3 nucleotides in length, and the consecutive nucleotide regions from the 1st to the 3rd position from the 5′ end and the 3′ end are all connected by a thiophosphate backbone.

[0028] In one embodiment of the present application, the double-stranded RNAi agent is conjugated to at least one ligand selected from the group consisting of cholesterol, biotin, vitamins, galactose derivatives or analogs, lactose derivatives or analogs, N-acetylgalactosamine derivatives or analogs, and N-acetylglucosamine (GalNAc) derivatives or analogs.

[0029] In some embodiments, the ligand is linked to the 3' end, the 5' end, and / or in the middle of the sequence of the double-stranded RNAi agent.

[0030] In some embodiments, the 3' end, 5' end and / or the middle of the double-stranded RNAi agent are modified with 1-5, 2-4 or 3 N-acetylgalactosamine derivatives or analogs. Specifically, the structure of a single N-acetylgalactosamine derivative is as shown in Formula I:

[0031] Formula I, wherein n is an integer of 1-15.

[0032] Preferably, the ligand is linked to the 3' end of the sense strand of the double-stranded RNAi agent.

[0033] In one embodiment of the present application, in the double-stranded RNAi agent, the ligand is one or more GalNAc derivatives connected to a monovalent or trivalent branched linker.

[0034] In one embodiment of the present application, the double-stranded RNAi agent comprises:

[0035] (1) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence UmsGfsUmAmCmUfCmUmCmAmUmUmGmUfGmGfAmUmGmAmCmsGmsAm (SEQ ID NO: 7) and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence GmsUmsCmAmUmCmCfAmCfAfAfUmGmAmGmAmGmUmAmCmAm (SEQ ID NO: 8);

[0036] (2) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence GmsGfsUmAmCmUmCmUmCmAmUmUmGmUfGmGfAmUmGmAmCmsGmsAm (SEQ ID NO: 9) and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence GmsUmsCmAmUmCmCfAmCfAfAfUmGmAmGmAmGmUmAmCmCm (SEQ ID NO: 10);

[0037] (3) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence GmsAfsAmCmCmUmGmUmCmAmUmCmUfUmCfUmCmAmGmCmsAmsGm (SEQ ID NO: 11) and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence GmsCmsUmGmAmGmAfAmGfAfUfUmGmAmCmAmGmGmUmUmCm (SEQ ID NO: 12);

[0038] (4) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence UmsGfsAmAmCmCmUmGmUmCmAmAmUmCfUmUfCmUmCmAmGmsCmsAm (SEQ ID NO: 13) and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence CmsUmsGmAmGmAmAfGmAfUfUfGmAmCmAmGmGmUmUmCmAm (SEQ ID NO: 14);

[0039] (5) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence UmsGfsAmUmCmAmUmAmCmAmCmAmGmCfAmAfAmCmAmGmGmsAmsAm (SEQ ID NO: 15) and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence CmsCmsUmGmUmUmUfGmCfUfGfUmGmUmAmUmGmAmUmCmAm (SEQ ID NO: 16);

[0040] (6) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence UmsGfsAmCmAmCmAmUmCmGmCmUmGmAfUmUfUmGmUmCmCmsGmsGm (SEQ ID NO: 17) and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence GmsGmsAmCmAmAmAfUmCfAfGfCmGmAmUmGmUmGmUmCmAm (SEQ ID NO: 18);

[0041] (7) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence AmsGfsAmAmGmAmAmAmAmGmGmUmGmGfGmAfGmAmCmUmGmsGm (SEQ ID NO: 19) and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence CmsAmsGmUmCmUmCfCmCfAfCfCmUmUmUmUmCmUmUmCmUm (SEQ ID NO: 20);

[0042] (8) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence CmsAfsUmUmAmGmAmAmGmAmAmAmAmGfGmUfGmGmGmAmGmsAmsCm (SEQ ID NO: 21) and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence CmsUmsCmCmCmAmCfCmUfUfUfUmCmUmUmCmUmAmAmUmGm (SEQ ID NO: 22);

[0043] (9) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence UmsCfsAmAmAmGmUmCmGmAmCmUmCmAfUmUfAmGmAmAmGmsAmsAm (SEQ ID NO: 23) and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence CmsUmsUmCmUmAmAfUmGfAfGfUmCmGmAmCmUmUmUmGmAm (SEQ ID NO: 24);

[0044] (10) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence AmsCfsAmCmUmUmAmGmAmCmCmAmAmGfGmAfGmAmAmAmCmsGmsGm (SEQ ID NO: 25) and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence GmsUmsUmUmCmUmCfCmUfUfGfGmUmCmUmAmAmGmUmGmUm (SEQ ID NO: 26); or

[0045] (11) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence UmsUfsUmUmUmGmUmUmUmCmAmCmAfAmAfCmAmAmGmCmsUmsGm (SEQ ID NO: 27) and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence GmsCmsUmUmGmUmUfUmGfUfGfAmAmAmCmAmAmAmAmAmAmAm (SEQ ID NO: 28);

[0046] Among them, Am, Um, Cm and Gm represent 2′-O-methyl modified ribonucleotides A, U, C and G, respectively; Af, Uf, Cf and Gf represent 2′-fluoro modified ribonucleotides A, U, C and G, respectively; (s) indicates that the two nucleotides are connected by a thiophosphate backbone.

[0047] Furthermore, the present application provides a double-stranded RNAi agent, comprising a sense strand and an antisense strand, wherein:

[0048] (1) the sense strand comprises UmsGfsUmAmCmUfCmUmCmAmUmUmGmUfGmGfAmUmGmAmCmsGmsAm (SEQ ID NO: 7), and the antisense strand comprises GmsUmsCmAmUmCmCfAmCfAfAfUmGmAmGmAmGmUmAmCmAm (SEQ ID NO: 8);

[0049] (2) the sense strand comprises GmsGfsUmAmCmUmCmUmCmAmUmUmGmUfGmGfAmUmGmAmCmsGmsAm (SEQ ID NO: 9), and the antisense strand comprises GmsUmsCmAmUmCmCfAmCfAfAfUmGmAmGmAmGmUmAmCmCm (SEQ ID NO: 10);

[0050] (3) the sense strand comprises GmsAfsAmCmCmUmGmUmCmAmAmUmCmUfUmCfUmCmAmGmCmsAmsGm (SEQ ID NO: 11), and the antisense strand comprises GmsCmsUmGmAmGmAfAmGfAfUfUmGmAmCmAmGmGmUmUmCm (SEQ ID NO: 12);

[0051] (4) the sense strand comprises UmsGfsAmAmCmCmUmGmUmCmAmAmUmCfUmUfCmUmCmAmGmsCmsAm (SEQ ID NO: 13), and the antisense strand comprises CmsUmsGmAmGmAmAfGmAfUfUfGmAmCmAmGmGmUmUmCmAm (SEQ ID NO: 14);

[0052] (5) the sense strand comprises UmsGfsAmUmCmAmUmAmCmAmCmAmGmCfAmAfAmCmAmGmGmsAmsAm (SEQ ID NO: 15), and the antisense strand comprises CmsCmsUmGmUmUmUfGmCfUfGfUmGmUmAmUmGmAmUmCmAm (SEQ ID NO: 16);

[0053] (6) the sense strand comprises UmsGfsAmCmAmCmAmUmCmGmCmUmGmAfUmUfUmGmUmCmCmsGmsGm (SEQ ID NO: 17), and the antisense strand comprises GmsGmsAmCmAmAmAfUmCfAfGfCmGmAmUmGmUmGmUmCmAm (SEQ ID NO: 18);

[0054] (7) the sense strand comprises AmsGfsAmAmGmAmAmAmAmGmGmUmGmGfGmAfGmAmCmUmGmsGmsG m (SEQ ID NO: 19), and the antisense strand comprises CmsAmsGmUmCmUmCfCmCfAfCfCmUmUmUmUmCmUmUmCmUm (SEQ ID NO: 20);

[0055] (8) the sense strand comprises CmsAfsUmUmAmGmAmAmGmAmAmAmAmAmGfGmUfGmGmGmAmGmsAmsCm (SEQ ID NO: 21), and the antisense strand comprises CmsUmsCmCmCmAmCfCmUfUfUfUmCmUmUmCmUmAmAmUmGm (SEQ ID NO: 22);

[0056] (9) the sense strand comprises UmsCfsAmAmAmGmUmCmGmAmCmUmCmAfUmUfAmGmAmAmGmsAmsAm (SEQ ID NO: 23), and the antisense strand comprises CmsUmsUmCmUmAmAfUmGfAfGfUmCmGmAmCmUmUmUmGmAm (SEQ ID NO: 24);

[0057] (10) the sense strand comprises AmsCfsAmCmUmUmAmGmAmCmCmAmAmGfGmAfGmAmAmAmCmsGmsGm (SEQ ID NO: 25), and the antisense strand comprises GmsUmsUmUmCmUmCfCmUfUfGfGmUmCmUmAmAmGmUmGmUm (SEQ ID NO: 26); or

[0058] (11) the sense strand comprises UmsUfsUmUmUmUmGmUmUmUmCmAmCmAfAmAfCmAmAmGmCmsUmsGm (SEQ ID NO: 27), and the antisense strand comprises GmsCmsUmUmGmUmUfUmGfUfGfAmAmAmCmAmAmAmAmAmAmAm (SEQ ID NO: 28);

[0059] Among them, Am, Um, Cm and Gm represent 2′-O-methyl modified ribonucleotides A, U, C and G, respectively; Af, Uf, Cf and Gf represent 2′-fluoro modified ribonucleotides A, U, C and G, respectively; (s) indicates that the two nucleotides are connected by a thiophosphate backbone.

[0060] In some embodiments, the double-stranded RNAi agent comprises a sense strand and an antisense strand, wherein:

[0061] (1) the nucleic acid sequence of the sense strand consists of UmsGfsUmAmCmUfCmUmCmAmUmUmGmUfGmGfAmUmGmAmCmsGmsAm (SEQ ID NO: 7) and 0, 1, 2, 3 or 4 nucleotides, and the nucleotide sequence of the antisense strand consists of GmsUmsCmAmUmCmCfAmCfAfAfUmGmAmGmAmGmUmAmCmAm (SEQ ID NO: 8) and 0, 1, 2, 3 or 4 nucleotides;

[0062] (2) the nucleic acid sequence of the sense strand consists of GmsGfsUmAmCmUmCmUmCmAmUmUmGmUfGmGfAmUmGmAmCmsGmsAm (SEQ ID NO: 9) and 0, 1, 2, 3 or 4 nucleotides, and the nucleic acid sequence of the antisense strand consists of GmsUmsCmAmUmCmCfAmCfAfAfUmGmAmGmAmGmUmAmCmCm (SEQ ID NO: 10) and 0, 1, 2, 3 or 4 nucleotides;

[0063] (3) the nucleic acid sequence of the sense strand consists of GmsAfsAmCmCmUmGmUmCmAmAmUmCmUfUmCfUmCmAmGmCmsAmsGm (SEQ ID NO: 11) and 0, 1, 2, 3 or 4 nucleotides, and the nucleic acid sequence of the antisense strand consists of GmsCmsUmGmAmGmAfAmGfAfUfUmGmAmCmAmGmGmUmUmCm (SEQ ID NO: 12) and 0, 1, 2, 3 or 4 nucleotides;

[0064] (4) the nucleic acid sequence of the sense strand consists of UmsGfsAmAmCmCmUmGmUmCmAmAmUmCfUmUfCmUmCmAmGmsCmsAm (SEQ ID NO: 13) and 0, 1, 2, 3 or 4 nucleotides, and the nucleic acid sequence of the antisense strand consists of CmsUmsGmAmGmAmAfGmAfUfUfGmAmCmAmGmGmUmUmCmAm (SEQ ID NO: 14) and 0, 1, 2, 3 or 4 nucleotides;

[0065] (5) the nucleic acid sequence of the sense strand consists of UmsGfsAmUmCmAmUmAmCmAmCmAmGmCfAmAfAmCmAmGmGmsAmsAm (SEQ ID NO: 15) and 0, 1, 2, 3 or 4 nucleotides, and the nucleic acid sequence of the antisense strand consists of CmsCmsUmGmUmUmUfGmCfUfGfUmGmUmAmUmGmAmUmCmAm (SEQ ID NO: 16) and 0, 1, 2, 3 or 4 nucleotides;

[0066] (6) the nucleic acid sequence of the sense strand consists of UmsGfsAmCmAmCmAmUmCmGmCmUmGmAfUmUfUmGmUmCmCmsGmsGm (SEQ ID NO: 17) and 0, 1, 2, 3 or 4 nucleotides, and the nucleic acid sequence of the antisense strand consists of GmsGmsAmCmAmAmAfUmCfAfGfCmGmAmUmGmUmGmUmCmAm (SEQ ID NO: 18) and 0, 1, 2, 3 or 4 nucleotides;

[0067] (7) the nucleic acid sequence of the sense strand consists of AmsGfsAmAmGmAmAmAmAmGmGmUmGmGfGmAfGmAmCmUmGmsGmsG m (SEQ ID NO: 19) and 0, 1, 2, 3 or 4 nucleotides, and the nucleic acid sequence of the antisense strand consists of CmsAmsGmUmCmUmCfCmCfAfCfCmUmUmUmUmCmUmUmCmUm (SEQ ID NO: 20) and 0, 1, 2, 3 or 4 nucleotides;

[0068] (8) the nucleic acid sequence of the sense strand consists of CmsAfsUmUmAmGmAmAmGmAmAmAmAmGfGmUfGmGmGmAmGmsAmsCm (SEQ ID NO: 21) and 0, 1, 2, 3 or 4 nucleotides, and the nucleic acid sequence of the antisense strand consists of CmsUmsCmCmCmAmCfCmUfUfUfUmCmUmUmCmUmAmAmUmGm (SEQ ID NO: 22) and 0, 1, 2, 3 or 4 nucleotides;

[0069] (9) the nucleic acid sequence of the sense strand consists of UmsCfsAmAmAmGmUmCmGmAmCmUmCmAfUmUfAmGmAmAmGmsAmsAm (SEQ ID NO: 23) and 0, 1, 2, 3 or 4 nucleotides, and the nucleic acid sequence of the antisense strand consists of CmsUmsUmCmUmAmAfUmGfAfGfUmCmGmAmCmUmUmUmGmAm (SEQ ID NO: 24) and 0, 1, 2, 3 or 4 nucleotides;

[0070] (10) the nucleic acid sequence of the sense strand consists of AmsCfsAmCmUmUmAmGmAmCmCmAmAmGfGmAfGmAmAmAmCmsGmsGm (SEQ ID NO: 25) and 0, 1, 2, 3 or 4 nucleotides, and the nucleic acid sequence of the antisense strand consists of GmsUmsUmUmCmUmCfCmUfUfGfGmUmCmUmAmAmGmUmGmUm (SEQ ID NO: 26) and 0, 1, 2, 3 or 4 nucleotides; or

[0071] (11) the nucleic acid sequence of the sense strand consists of UmsUfsUmUmUmUmGmUmUmUmCmAmCmAfAmAfCmAmAmGmCmsUmsGm (SEQ ID NO: 27) and 0, 1, 2, 3 or 4 nucleotides, and the nucleic acid sequence of the antisense strand consists of GmsCmsUmUmGmUmUfUmGfUfGfAmAmAmCmAmAmAmAmAmAmAm (SEQ ID NO: 28) and 0, 1, 2, 3 or 4 nucleotides;

[0072] Among them, Am, Um, Cm and Gm represent 2′-O-methyl modified ribonucleotides A, U, C and G, respectively; Af, Uf, Cf and Gf represent 2′-fluoro modified ribonucleotides A, U, C and G, respectively; (s) indicates that the two nucleotides are connected by a thiophosphate backbone.

[0073] Furthermore, in some embodiments, the 3' end of the sense strand of the double-stranded RNAi agent is linked to 1-5, 2-4 or 3 N-acetylgalactosamine derivatives or analogs. Specifically, the structure of a single N-acetylgalactosamine derivative is shown in Formula I:

[0074] Formula I, wherein n is an integer from 1 to 15.

[0075] In some embodiments of the present application, in the double-stranded RNAi agent, the 3' end of the sense strand of the double-stranded RNAi agent is linked to 1-5, 2-4 or 3 one or more GalNAc derivatives linked to a monovalent or trivalent branched linker.

[0076] In some embodiments of the present application, in the double-stranded RNAi agent, the GalNAc structure is as shown in Formula II:

[0077] Formula II.

[0078] In some embodiments of the present application, the nucleotide at the 3' end of the sense strand of the double-stranded RNAi agent is linked to L96, and the structural formula of L96 is shown in Formula III:

[0079] Formula III.

[0080] In one embodiment of the present application, the double-stranded RNAi agent comprises:

[0081] (1) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence UmsGfsUmAmCmUfCmUmCmAmUmUmGmUfGmGfAmUmGmAmCmsGmsAm (SEQ ID NO: 7) and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence GmsUmsCmAmUmCmCfAmCfAfAfUmGmAmGmAmGmUmAmCmAm-L96 (SEQ ID NO: 29);

[0082] (2) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence GmsGfsUmAmCmUmCmUmCmAmUmUmGmUfGmGfAmUmGmAmCmsGmsAm (SEQ ID NO: 9) and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence GmsUmsCmAmUmCmCfAmCfAfAfUmGmAmGmAmGmUmAmCmCm-L96 (SEQ ID NO: 30);

[0083] (3) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence GmsAfsAmCmCmUmGmUmCmAmUmCmUfUmCfUmCmAmGmCmsAmsGm (SEQ ID NO: 11) and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence GmsCmsUmGmAmGmAfAmGfAfUfUmGmAmCmAmGmGmUmUmCm-L96 (SEQ ID NO: 31);

[0084] (4) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence UmsGfsAmAmCmCmUmGmUmCmAmAmUmCfUmUfCmUmCmAmGmsCmsAm (SEQ ID NO: 13) and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence CmsUmsGmAmGmAmAfGmAfUfUfGmAmCmAmGmGmUmUmCmAm-L96 (SEQ ID NO: 32);

[0085] (5) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence UmsGfsAmUmCmAmUmAmCmAmCmAmGmCfAmAfAmCmAmGmGmsAmsAm (SEQ ID NO: 15) and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence CmsCmsUmGmUmUmUfGmCfUfGfUmGmUmAmUmGmAmUmCmAm-L96 (SEQ ID NO: 33);

[0086] (6) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence UmsGfsAmCmAmCmAmUmCmGmCmUmGmAfUmUfUmGmUmCmCmsGmsGm (SEQ ID NO: 17) and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence GmsGmsAmCmAmAmAfUmCfAfGfCmGmAmUmGmUmGmUmCmAm-L96 (SEQ ID NO: 34);

[0087] (7) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence AmsGfsAmAmGmAmAmAmAmGmGmUmGmGfGmAfGmAmCmUmGmsGm (SEQ ID NO: 19) and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence CmsAmsGmUmCmUmCfCmCfAfCfCmUmUmUmUmCmUmUmCmUm-L96 (SEQ ID NO: 35);

[0088] (8) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence CmsAfsUmUmAmGmAmAmGmAmAmAmAmGfGmUfGmGmAmGmsAmsC m (SEQ ID NO: 21), and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence CmsUmsCmCmAmCfCmUfUfUfUmCmUmUmCmUmAmAmUmGm-L96 (SEQ ID NO: 36);

[0089] (9) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence UmsCfsAmAmAmGmUmCmGmAmCmUmCmAfUmUfAmGmAmAmGmsAmsAm (SEQ ID NO: 23) and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence CmsUmsUmCmUmAmAfUmGfAfGfUmCmGmAmCmUmUmUmGmAm-L96 (SEQ ID NO: 37);

[0090] (10) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence AmsCfsAmCmUmUmAmGmAmCmCmAmAmGfGmAfGmAmAmAmCmsGmsGm (SEQ ID NO: 25) and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence GmsUmsUmUmCmUmCfCmUfUfGfGmUmCmUmAmAmGmUmGmUm-L96 (SEQ ID NO: 38);

[0091] (11) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence UmsUfsUmUmUmGmUmUmUmCmAmCmAfAmAfCmAmAmGmCmsUmsGm (SEQ ID NO: 27) and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence GmsCmsUmUmGmUmUfUmGfUfGfAmAmAmCmAmAmAmAmAmAmAm-L96 (SEQ ID NO: 39);

[0092] Wherein, Am, Um, Cm and Gm represent 2′-O-methyl modified ribonucleotides A, U, C and G, respectively; Af, Uf, Cf and Gf represent 2′-fluoro modified ribonucleotides A, U, C and G, respectively; (s) indicates that the two nucleotides are connected by a thiophosphate backbone, and L96 is connected to the 3′ end of the sense strand of the double-stranded RNAi agent. The structural formula of L96 is shown in Formula III:

[0093] Formula III.

[0094] In one embodiment of the present application, the double-stranded RNAi agent has a structure of Formula IV:

[0095] Formula IV.

[0096] The present application provides the following examples of double-stranded RNAi agents: AGT203-EG, AGT202-EG, AGT814-EG, AGT815-EG, AGT1452-EG, AGT1613-EG, AGT1638-EG, AGT1642-EG, AGT1654-EG, AGT1689-EG, AGT1854-EG.

[0097] The present application also includes a DNA molecule capable of producing the above-mentioned double-stranded RNAi agent, a vector capable of expressing the double-stranded RNAi agent, and a reagent or kit containing the double-stranded RNAi agent, the DNA molecule, or the vector.

[0098] The present application also provides cells comprising the double-stranded RNAi agent.

[0099] The present application further provides a pharmaceutical composition comprising the above-mentioned double-stranded RNAi agent.

[0100] The pharmaceutical composition comprises a pharmacologically effective amount of the double-stranded RNAi agent of the present application and other pharmaceutically acceptable components. "Effective amount" refers to a double-stranded RNAi dosage that can effectively produce the desired pharmacological therapeutic effect. "Other components" include water, saline, glucose, buffer (such as PBS), excipients, diluents, disintegrants, binders, lubricants, sweeteners, flavorings, preservatives, or combinations thereof.

[0101] The present application also provides a method for inhibiting AGT expression in a cell, the method comprising: (a) contacting the cell with the above-mentioned double-stranded RNAi agent or its pharmaceutical composition; (b) maintaining the cell produced in step (a) for a period of time sufficient to obtain degradation of the mRNA transcript of the AGT gene, thereby inhibiting the expression of the AGT gene in the cell.

[0102] The present application provides the use of the above-mentioned double-stranded RNAi agent or its pharmaceutical composition in inhibiting AGT gene expression or preparing a product for inhibiting AGT gene expression, wherein the inhibition of AGT gene expression is to inhibit or reduce the expression level of the AGT gene in human, monkey, rat or mouse cells in vivo or in vitro. The cells are mammalian cells that express AGT, such as primate cells or human cells. Preferably, the AGT gene is expressed at a high level in the target cells. More preferably, the cells are derived from the brain, salivary gland, heart, spleen, lung, liver, kidney, intestine, or tumor. Further preferably, the cells are liver cancer cells or cervical cancer cells. Even further preferably, the cells are selected from HepG2, Hep3B, Huh7, COS7, 293T, MHCC97H, Hela, primary mouse hepatocytes, and primary human hepatocytes. In some embodiments of the present application, the final cell concentration of the double-stranded RNAi agent is 0.1-1000nM, such as 10-500nM, 25-300nM or 50-100nM.

[0103] In some embodiments of the present application, the double-stranded RNAi agent and its pharmaceutical composition can be administered by any suitable means, such as parenteral administration, including intramuscular, intravenous, intraarterial, peritoneal, or subcutaneous injection. The mode of administration includes but is not limited to single administration or multiple administration.

[0104] The present application also provides use of the above-mentioned double-stranded RNAi agent or its pharmaceutical composition in the preparation of a drug for preventing and / or treating diseases mediated by AGT expression or alleviating the symptoms of diseases mediated by the AGT gene.

[0105] The present application also provides the above-mentioned double-stranded RNAi agent or a pharmaceutical composition thereof for use in preventing and / or treating diseases mediated by AGT expression or for alleviating the symptoms of diseases mediated by the AGT gene.

[0106] The present application also provides a method for preventing and / or treating a disease mediated by AGT expression or a method for alleviating the symptoms of a disease mediated by the AGT gene, which comprises administering the double-stranded RNAi agent described in the present application or a pharmaceutical composition thereof to a subject in need.

[0107] In the present application, the diseases mediated by the AGT gene include hypertension, critical hypertension, essential hypertension, secondary hypertension, hypertensive crisis, hypertensive emergency, isolated systolic and diastolic hypertension, pregnancy-related hypertension, diabetic hypertension, resistant hypertension, refractory hypertension, paroxysmal hypertension, renovascular hypertension, Goldblatt's hypertension, ocular hypertension, glaucoma, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, unstable hypertension; hypertensive heart disease, hypertensive nephropathy, atherosclerosis, arteriosclerosis, Atherosclerosis, vascular disease, diabetic nephropathy, diabetic retinopathy, chronic heart failure, cardiomyopathy, diabetic cardiomyopathy, glomerulosclerosis, coarctation of the aorta, aortic aneurysm, ventricular fibrosis, Cushing's syndrome and other glucocorticoid excess states (including chronic steroid therapy), pheochromocytoma, nephroblastoma, secondary aldosteronism and other mineralocorticoid excess states, sleep apnea, thyroid / parathyroid disease, heart failure, myocardial infarction, angina pectoris, stroke, diabetes mellitus, kidney disease, renal failure, systemic sclerosis, intrauterine growth restriction (IUGR), and fetal growth restriction.

[0108] In some embodiments, a single dose of the pharmaceutical composition can be long-lasting, with the reduction in AGT expression lasting for at least 4, 7, 11, 14, 18, 21, 25, 28, 32, 35, 39, 42, 49, 56 days or longer.

[0109] The innovations of this application are as follows: 1. RNAi molecules screened through high-throughput screening exhibit comparable or even higher inhibitory activity than AD85481 (a positive control compound). 2. The modified RNAi molecules exhibit high stability and high inhibitory activity. 3. Pharmacodynamic studies in rhesus monkeys demonstrate that the candidate sequences can reduce serum AGT protein levels by more than 90% compared to the positive control, AD85481-EG, with a longer-lasting effect, demonstrating a significant improvement.

[0110] It should be noted that, although many modifications can be attempted to improve the performance of double-stranded RNAi, these attempts are generally difficult to demonstrate both RNA interference and improved stability in serum (e.g., increased resistance to nucleases and / or prolonged duration). The modified double-stranded RNAi of the present application has high stability while maintaining high inhibitory activity.

[0111] definition

[0112] "AGT" refers to the angiotensinogen gene or protein. AGT is also known as ANHU, hFLT1, or SERPINA8. Examples of AGT mRNA sequences are readily available using, for example, GenBank.

[0113] "G," "C," "A," and "U" generally represent nucleotides comprising guanine, cytosine, adenine, and uracil as bases, respectively. However, it will be understood that the term "ribonucleotide" or "nucleotide" or "deoxyribonucleotide" may also refer to a modified nucleotide or an alternative replacement moiety. The skilled artisan will be well aware that guanine, cytosine, adenine, and uracil may be replaced by other moieties without substantially altering the base pairing properties of an oligonucleotide (including a nucleotide having such a replacement moiety). Sequences comprising such replacement moieties are embodiments of the present application.

[0114] "RNAi agents" refer to agents that mediate targeted cleavage of RNA transcripts through the RNA-induced silencing complex (RISC) pathway. RNAi agents direct sequence-specific degradation of mRNA through a process known as RNA interference (RNAi). RNAi agents modulate, e.g., inhibit, expression of AGT in cells, such as cells in a subject (e.g., a mammalian subject).

[0115] In one embodiment, the RNAi agent of the present application includes a single-stranded RNA that interacts with a target RNA sequence, such as an AGT target mRNA sequence, to guide cleavage of the target RNA.

[0116] In another embodiment, the RNAi agent can be a single-stranded siRNA that is introduced into a cell or organism to inhibit a target mRNA.

[0117] In another embodiment, the "RNAi agent" used in the compositions, uses, and methods of the present application is double-stranded RNA, and is referred to herein as a "double-stranded RNAi agent". The term "double-stranded RNAi agent" refers to a complex of ribonucleic acid molecules having a double-stranded structure, comprising two antiparallel and substantially complementary nucleic acid strands, which are referred to as having "sense" and "antisense" orientations relative to the target RNA, i.e., the AGT gene. In some embodiments of the present application, the double-stranded RNA triggers the degradation of the target RNA, such as mRNA, through a post-transcriptional gene silencing mechanism (referred to herein as RNA interference or RNAi).

[0118] "Antisense strand" refers to the strand of a double-stranded RNAi agent that includes a region that is substantially complementary to a target sequence (eg, a human AGT mRNA).

[0119] "Sense strand" refers to the strand of a dsRNA that contains a region that is substantially complementary to a region of the antisense strand.

[0120] "Complementarity" refers to the region on the antisense strand that is completely or substantially complementary to the target mRNA sequence. Where the complementary region is not completely complementary to the target sequence, mismatches may be located in the interior or terminal regions of the molecule. As used herein, the term "complementarity" refers to the ability of a first polynucleotide to hybridize to a second polynucleotide under certain conditions, such as stringent conditions.

[0121] A "nucleotide overhang" refers to one or more unpaired nucleotides that protrude from the duplex structure of a RNAi agent when a 3' end of one strand of the RNAi agent extends beyond the 5' end of the other strand, or vice versa. "Blunt end" or "blunt end" means that there are no unpaired nucleotides at that end of the double-stranded RNAi agent, i.e., no nucleotide overhang. A "blunt-ended" RNAi agent is a dsRNA that is double-stranded throughout its length, i.e., has no nucleotide overhangs at either end of the molecule.

[0122] "Inhibiting AGT expression in a cell" includes inhibiting the expression of any AGT gene (e.g., a mouse AGT gene, a rat AGT gene, a monkey AGT gene, or a human AGT gene), as well as variants (e.g., naturally occurring variants) or mutants of an AGT gene. Thus, the AGT gene can be a wild-type AGT gene, a mutant AGT gene, or a transgenic AGT gene in the context of a genetically manipulated cell, cell group, or organism.

[0123] The cells are mammalian cells expressing AGT, such as primate cells or human cells. Preferably, the target cells express the AGT gene at high levels. More preferably, the cells are derived from the brain, salivary glands, heart, spleen, lungs, liver, kidneys, intestines, or tumors. Even more preferably, the cells are hepatocellular carcinoma cells or cervical cancer cells. Even more preferably, the cells are selected from HepG2, Hep3B, Huh7, COS7, 293T, MHCC97H, Hela, primary mouse hepatocytes, and primary human hepatocytes.

[0124] "Inhibiting AGT gene expression" includes any level of inhibition of the AGT gene, such as at least partial inhibition of the expression of the AGT gene, such as inhibition of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.

[0125] "Contacting a cell with a double-stranded RNAi agent" includes contacting the cell by any possible means. Contacting the cell with a double-stranded RNAi agent includes contacting the cell with the RNAi agent in vitro or contacting the cell with the RNAi agent in vivo. The contact can be performed directly or indirectly. Thus, for example, the RNAi agent can be brought into physical contact with the cell by the individual performing the method, or alternatively, the RNAi agent can enter a situation that permits or results in its subsequent contact with the cell.

[0126] "Diseases mediated by AGT expression" are intended to include any disease associated with the AGT gene or protein. Such diseases can be caused, for example, by overproduction of AGT protein, by mutations in the AGT gene, by abnormal cleavage of the AGT protein, or by abnormal interactions between AGT and other proteins or other endogenous or exogenous substances.

[0127] A wide variety of entities can be coupled to the RNAi agents of the present application. Preferred moieties are ligands that are covalently coupled, preferably directly or indirectly via an intervening tether.

[0128] Ligands can generally include therapeutic modifiers, e.g., for enhancing uptake; diagnostic compounds or reporter groups, e.g., for monitoring distribution; cross-linking agents; and moieties that confer nuclease resistance. Common examples include lipids, steroids, vitamins, sugars, proteins, peptides, polyamines, and peptidomimetics.

[0129] The ligand can include a naturally occurring substance, such as a protein (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), high-density lipoprotein (HDL), or globulin); a carbohydrate (e.g., a dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, or hyaluronic acid); or a lipid. The ligand can also be a recombinant or synthetic molecule, such as a synthetic polymer, for example, a synthetic polyamino acid, an oligonucleotide (e.g., an aptamer). Examples of polyamino acids include the following polyamino acids: polylysine (PLL), poly-L-aspartic acid, poly-L-glutamic acid, styrene-maleic anhydride copolymer, poly(L-lactide-co-glycolide) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide polymer, or polyphosphazene. Examples of polyamines include polyethyleneimine, polylysine (PLL), spermine, spermidine, polyamines, pseudopeptide-polyamines, peptidomimetic polyamines, dendrimer polyamines, arginine, amidine, protamine, cationic lipids, cationic porphyrins, quaternary salts of polyamines, or alpha helical peptides.

[0130] The ligand can also include a targeting group, such as a cell or tissue targeting agent that binds to a specified cell type, such as a kidney cell, such as a lectin, glycoprotein, lipid, or protein, such as an antibody. The targeting group can be thyrotropin, melanocyte stimulating hormone, a lectin, a glycoprotein, surfactant protein A, a mucin carbohydrate, a multivalent lactose, a multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine multivalent mannose, a multivalent trehalose, a glycosylated polyamino acid, a multivalent galactose, transferrin, a bisphosphonate, polyglutamate, polyaspartate, a lipid, cholesterol, a steroid, bile acid, folate, vitamin B12, biotin, RGD peptide, RGD peptide mimetic, or an aptamer.

[0131] Other examples of ligands include dyes, intercalating agents (e.g., acridine), cross-linking agents (e.g., psoralen, mitomycin C), porphyrins (TPPC4, texaphyrin, sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases or chelating agents (e.g., EDTA), lipophilic molecules, e.g., cholesterol, bile acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyl, cetylglycerol, borneol, menthol, 1,3-propylene glycol, heptadecyl, palmitic acid, carnitine, thiazolinone ... myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine peptide conjugates (e.g., antennapedia peptide, Tat peptide), alkylating agents, phosphates, amino groups, sulfhydryl groups, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (e.g., biotin), transport / absorption enhancers (e.g., aspirin, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, tetraazamacrocycles of Eu 3+ complex), dinitrophenyl, HRP or AP.

[0132] The ligand can be a protein, such as a glycoprotein, or a peptide, such as a molecule with a specific affinity for a co-ligand, or an antibody, such as an antibody that binds to a specific cell type (such as a cancer cell, endothelial cell, or bone cell). Ligands can also include hormones and hormone receptors. They can also include non-peptide species, such as lipids, lectins, carbohydrates, vitamins, cofactors, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine multivalent mannose, multivalent fucose, or aptamers. The ligand can be, for example, a lipopolysaccharide, an activator of p38 MAP kinase, or an activator of NF-κB.

[0133] The ligand can be a substance, e.g., a drug, that can increase the uptake of the iRNA agent into the cell, e.g., by disrupting the cytoskeleton of the cell (e.g., by disrupting cellular microtubules, microfilaments, and / or intermediate filaments). The drug can be, for example, taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, limnid A, phalloidin, swinholide A, indanocine, or myoservin.

[0134] The ligand can be any ligand capable of targeting a specific receptor. Examples are: folate, GalNAc, galactose, mannose, mannose-6P, sugar clusters (such as GalNAc clusters, mannose clusters, galactose clusters) or an aptamer. A cluster is a combination of two or more sugar units. These targeting ligands also include integrin receptor ligands, chemokine receptor ligands, transferrin, biotin, serotonin receptor ligands, PSMA, endothelin, GCPII, somatostatin, LDL and HDL ligands. These ligands can also be based on nucleic acids, such as an aptamer. The aptamer can be unmodified or have any combination of modifications disclosed herein. BRIEF DESCRIPTION OF THE DRAWINGS

[0135] Fig. 1 Effects of DLR high-throughput screening of candidate sequences on AGT gene expression.

[0136] Fig. 2 Effects of Top10 candidate sequences on AGT gene expression in Hep3B cells.

[0137] Fig. 3 Effects of top 10 candidate modification sequences on AGT gene expression in Hep3B cells.

[0138] Figure 4 Effects of candidate sequences on humanized mouse serum AGT protein.

[0139] Fig. 5 Effects of candidate sequences on AGT gene mRNA at PHH level.

[0140] Figure 6 Effects of candidate sequences on humanized mouse serum AGT protein.

[0141] Figure 7 Effects of candidate sequences on rhesus monkey serum AGT protein.

[0142] Figure 8 Effects of candidate sequences on serum AGT protein in hypertensive cynomolgus monkeys. DETAILED DESCRIPTION

[0143] Example 1. AGT-siRNA activity screening

[0144] 1. siRNA Design

[0145] Based on the human AGT mRNA sequence, multiple AGT siRNAs were designed at different sites. All designed individual siRNAs targeted all transcripts of the target gene (Table 1). Sequence similarity analysis (Table 2) revealed minimal homology with all other non-target gene sequences. Sequence design methods were based on those of Elbashir et al., 2002; Paddison et al., 2002; Reynolds et al., 2004; and Ui-Tei et al., 2004.

[0146] Table 1 Target genes

[0147] Table 2 High-throughput screening sequences

[0148] 2. siRNA Synthesis (Natural RNA / 2'-Methoxy or 2'-Fluoro-Modified RNA / GalNAc-RNA)

[0149] In this application, only ribonucleotides or 2'-methoxy or 2'-fluoro modified oligonucleotides were synthesized according to the theoretical yield of 1 μmol, and 1 μmol of the universal Frit vector ( All oligonucleotides were prepared on an LK-192X synthesizer using either Comma Biotech or GalNAc CPG (WuXi AppTec / Glen Research, loading capacity 30 μmol / g). All phosphoramidite monomers (Shanghai Zhaowei / Chengdu Pioneer) were diluted 1:20 (g / mL) in anhydrous acetonitrile, and the coupling time was 3 min, with two couplings performed. Deprotection was performed using 3% TCA, activation was performed using 0.3 M benzylthiotetrazolyl in acetonitrile, and capping and oxidation were performed using CAPA / CAPB and 50 mM I2 solutions, respectively. After trityl-off synthesis, the solid support was transferred to a 2 mL centrifuge tube and heated in a 65°C oven for 3 h with the addition of 1.2 mL of aqueous ammonia to remove protecting groups. The oligonucleotide was then cooled to room temperature and concentrated under vacuum for 30 minutes. The solution was filtered through a 0.22 μm filter into a vial and purified using a semi-preparative reverse-phase purification system with a 7% to 30% elution gradient (ACN:100 mM TEAA) over 10 minutes at a flow rate of 5 mL / min. After purification and preparation, the product was concentrated under vacuum and dried at room temperature. Finally, the sample was dissolved in water, and each solution was desalted on a GE Hi-Trap desalting column to elute the final oligonucleotide product. All identities and purity were confirmed using ESI-MS and IEX HPLC, respectively. Concentration was determined using a microplate reader under UV light. Equimolar amounts of the sense and antisense strands were mixed and transferred to a new shipping tube. The product was heated at 95°C for 5 minutes and slowly annealed to room temperature. Finally, the product was dried using a vacuum concentrator at room temperature to obtain the final product.

[0150] 3. Detection of the inhibitory activity of AGT-siRNA in the in vitro psicheck-2 system

[0151] 1. Construction of detection plasmid

[0152] The psicheck-2 plasmid was used to construct the recombinant plasmid (Shanghai Jierui Bioengineering Co., Ltd.), which contained the target sequences of all the AGT siRNAs to be tested, and the cloning sites were the 5'XhoI and 3'NotI sites of the psicheck-2 plasmid.

[0153] 2. Co-transfection of AGT siRNA and recombinant plasmid into different cells

[0154] All cells were obtained from the collection of the Chinese Academy of Sciences or from other publicly available sources; other reagents were commercially available.

[0155] Table 3 Cell names and types

[0156] The cells were cultured in DMEM medium containing 10% fetal bovine serum in a 5% CO2, 37°C constant temperature incubator. When the cells were in the logarithmic growth phase and in good condition (70% confluence), they were plated for transfection. The cell density was adjusted to 1.5×10 cells per well. 5 Plate cells into a 24-well plate. Prepare the transfection complex: Mix 250 μL of Opti-MEM, 40 ng of recombinant plasmid, and 5 μL of 10 nM siRNA, then 250 μL of Opti-MEM and 2.5 μL of Lipofectamine 2000 transfection reagent. Let stand for 5 minutes, then combine the two mixtures and let stand for 20 minutes. Add the transfection complex to the 24-well plate and incubate in a 5% CO2, 37°C incubator for 6 hours. Aspirate the supernatant, add 1 mL of complete culture medium to each well, and continue incubation for an additional 24 hours.

[0157] In addition to the experimental group, each cell transfection also included the following control groups: NC (irrelevant siRNA) as a negative control group and Lipo as a transfection reagent control group. Both the experimental and control groups were replicated three times. The nucleotide sequence of the NC control group was as follows:

[0158] Sense strand: UUCUCCGAACGUGUCACGUTT (SEQ ID NO: 186)

[0159] Antisense strand: ACGUGACACGUUCGGAGAATT (SEQ ID NO: 187)

[0160] 3. DLR detection and analysis

[0161] Detection was performed using the Dual-Luciferase Reporter Assay System kit (Promega). Cells were lysed, collected, and processed according to the kit instructions. The fluorescence intensities of firefly (Photinus pyralis) luciferase and Renilla (Renilla reniformis) luciferase were measured sequentially using an Infinite Eplex microplate reader (TECAN). The ratio of Renilla (Renilla reniformis) to firefly (Photinus pyralis) luciferase fluorescence intensity was calculated and normalized to the NC group. The nucleotide sequence of the positive control AD85481 is as follows:

[0162] Sense strand: GUCAUCCACAAUGAGAGUACA (SEQ ID NO: 188)

[0163] Antisense strand: UGUACUCUCAUUGUGGAUGACGA (SEQ ID NO: 189).

[0164] Table 4 DLR test results

[0165] As shown in Figure 1, the AGT siRNA DLR screening in 293T cells identified the top 30 siRNA molecules with the highest cellular activity based on relative luciferase activity. Table 1 shows the results of the DLR assay, showing the average expression levels of the dual-luciferase reporter gene in the AGT siRNA test group relative to the NC group.

[0166] IV. AGT siRNA qPCR Screening

[0167] 1. AGT siRNA transfection into Hep3B cells

[0168] Hep3B cells were cultured in DMEM medium containing 10% fetal bovine serum in a 5% CO2, 37°C constant temperature incubator. When the cells were in the logarithmic growth phase and in good condition (70% confluence), they were plated for transfection. The cell density was adjusted to 1.5×10 cells per well. 5 Cells were plated into 24-well plates. Prepare transfection complex: Mix 250μL Opti-MEM and 5μL 10nM siRNA, mix 250μL Opti-MEM and 2.5μL Lipofectamine 2000 transfection reagent, let it stand for 5 minutes, then mix the above two mixtures and let it stand for 20 minutes. Add the above transfection complex to a 24-well plate and incubate in a 5% CO2, 37°C constant temperature incubator for 6 hours. Aspirate the supernatant, add 1mL complete culture medium to each well, and continue to culture for 24 hours. In addition to the experimental group, the following control groups are also set up for each cell transfection: NC group is a negative control (irrelevant siRNA) and Lipo group is a transfection reagent control (no siRNA added).

[0169] 2. Real-time fluorescence quantitative PCR analysis:

[0170] 24 hours after transfection, cells were lysed and total RNA was extracted using a column extraction kit (Novagen). Real-time fluorescence quantitative PCR was performed using a CFX96 fluorescence quantitative PCR instrument (Bio-Rad) using the β-actin gene as an internal reference gene and Taqman probes. The primers used were:

[0171] Table 5 Primer sequence information

[0172] 3. Data Analysis

[0173] After the PCR reaction, relative quantitative analysis was performed using the 2-ΔΔCt method (Livak) with a reference gene as the standard. The results in Table 6 and Figure 2 show that among the top 30 siRNAs screened by DLR, the top 10 siRNA sequences identified by qPCR showed better inhibition of AGT mRNA levels than the positive control AD85481.

[0174] Table 6 Inhibitory activity of the top 10 siRNA sequences

[0175] Example 2, Optimization of AGT-siRNA

[0176] 1. Detection of the inhibitory activity of modified siRNA on ANGPTL3 gene

[0177] We modified the candidate sequences obtained in the early screening (Table 7) and performed a combination of fluorination and methoxy modification on different positions of the sense and antisense strands. The antisense strand was replaced with methoxy modification whenever possible. The synthesis, transfection into Hep3B cells, and quantitative PCR analysis steps were the same as in Example 1, and the final transfection concentration was 0.1 nM.

[0178] Table 7 The top 11 highly active siRNA modified sequences

[0179] Note: Am, Um, Cm and Gm represent 2′-O-methyl modified ribonucleotides A, U, C and G, respectively; Af, Uf, Cf and Gf represent 2′-fluoro modified ribonucleotides A, U, C and G, respectively; (s) represents the two nucleotides connected by a thiophosphate backbone, and (Tgn) represents (s)-GNA-T. The specific chemical formula is as follows:

[0180] As shown in Figure 3, the modification scheme is important, and some modifications can reduce the inhibitory activity. The preferred modification scheme has high inhibitory activity: (1) The antisense strand has a 5'(s)mN(s)mN3' overhang at the 3' end, which facilitates the loading of the antisense strand into RISC and enhances the interference activity of RNAi without affecting stability. (2) Fluoro-modification is used at least at positions 2, 14, and 16 of the antisense chain from the 5' end, and methoxy-modification is used as much as possible at other positions, which is beneficial to RISC binding; (3) At least two thio-modifications are used at the 3' and 5' ends of the antisense chain, which is beneficial to maintaining the stability of the nucleic acid; (4) Continuous fluorine-modification is used at positions 7 and 9-11 of the sense chain from the 5' end, and methoxy-modification is used as much as possible at other positions, which is beneficial to RISC binding; (5) At least two thio-modifications are used at the 5' end of the sense chain, and GalNAc is covalently coupled at the 3' end. In the 5'(s)mN(s)mN3' structure, N represents any nucleotide, m indicates that the nucleotide represented by N to the right is modified with 2'-O-methyl, and (s) indicates that the two nucleotides before and after are connected by a thiophosphate backbone. The results in Table 8 show that among the 11 candidate siRNA sequences with a final transfection concentration of 0.1 nM, the inhibitory activity of AGT202-EG, AGT814-EG, AGT1613-EG, AGT1638-EG, AGT1642-EG, AGT1654-EG, AGT1689-EG, and AGT203-EG in Hep3B cells was comparable to that of the positive control AD85481, and all of them could knock down the mRNA level of AGT to below 10%.

[0181] Table 8 Inhibitory activity of the first 8 modified siRNA sequences

[0182] Example 3: In vivo effectiveness test in mice

[0183] A total of 72 humanized AGT male and female mice (Jiangsu Jicui Pharmaceutical Kang Biotechnology Co., Ltd.) aged 6-8 weeks were randomly divided into 8 groups (4 males and 4 females) based on body weight. AGT1654-EG, AGT202-EG, AGT1638-EG, AGT814-EG, AGT1613-EG, AGT1642-EG, AGT1689-EG, and AGT203-EG were administered subcutaneously at a single 3 mg / kg dose. Blood was collected on days -3, 7, 14, 21, and 28 (fasting for 4-5 hours before blood collection, with the day of dosing designated as day 0). Serum was separated and AGT protein expression in serum was measured using the Human Total Angiotensinogen Assay Kit (IBL, #27412), and group comparisons were made.

[0184] Table 9 Average AGT protein from Example 3 (normalized to pre-treatment AGT level as 1)

[0185] The efficacy results in mice showed (Figure 4, Table 9) that AGT1654-EG, AGT202-EG, AGT1638-EG, and AGT203-EG could reduce the level of serum AGT by about 70% or even more than 80%, and the efficacy was maintained for at least 28 days.

[0186] Example 4. Detection of the efficacy of siRNA in primary human hepatocytes (PHH)

[0187] 4.1 The compounds were taken up freely into human primary hepatocytes as follows:

[0188] 1) Dilute the compound to 10 times the final concentration with nuclease-free water.

[0189] 2) Take out two frozen cells from the liquid nitrogen tank, shake gently in a water bath until the freezing solution is thawed, and transfer the cells to cell culture medium containing 10% fetal bovine serum. Adjust the cell density to 6.7*10 5 cells / mL.

[0190] 3) Dispense 25 μL of compound into the cell plate and add 225 μL of the cell suspension from step 2). Final compound concentration: 2 concentration points (100 nM and 500 nM), 3 replicates. Blank is a nuclease-free water control group.

[0191] The above experiment was repeated 3 times.

[0192] 4.2 Fluorescence quantitative PCR

[0193] 1) RT-PCR was used to detect total RNA in cells. The method was based on the instructions for the HiScript III RT SuperMix for qPCR (+gDNA wiper) kit. Commercial qPCR primers and probes were purchased from Thermo Fisher Scientific (Catalog #4331182). The qPCR reaction system was configured as follows:

[0194] Table 10 qPCR reaction system

[0195] 2) GAPDH was used as an internal reference gene. The target gene RNA expression level in each sample was calculated using the ΔΔCt relative quantification method. The relative expression of the target gene was expressed as 2-ΔΔCT.

[0196] 3) The qPCR reaction program was: 95°C for 10 min, followed by 95°C for 15 s and 60°C for 1 min, for 40 cycles.

[0197] 4) Data Analysis

[0198] ΔCT = average Ct value of target gene - average Ct value of reference gene;

[0199] ΔΔCT = ΔCT (sample group) - ΔCT (nuclease-free water control group);

[0200] Relative expression of target gene mRNA = 2 -ΔΔCT

[0201] Inhibition percentage (%) = (1-relative expression level of sample / average relative expression level of control group) × 100

[0202] 4.3 Data Analysis

[0203] Table 11 Inhibition rate of AGT gene mRNA at PHH level by siRNA

[0204] The PHH uptake assay better represents siRNA entry into the liver and its knockdown effect. The experimental results (Table 11, Figure 5) show that at final concentrations of 100nM and 500nM, AGT203-EG and AD85481-EG achieved comparable inhibition rates on AGT gene mRNA, both exceeding 90%.

[0205] Example 5: In vivo effectiveness test in mice

[0206] The experiment used 40 humanized AGT male mice (Jiangsu Jicui Pharmaceutical Kang Biotechnology Co., Ltd.) aged 6-8 weeks. They were randomly divided into groups according to body weight, with 10 mice in each group. They were given a single subcutaneous injection of 3 mg / kg (normal saline, AGT202-EG, AD85481-EG, AGT203-EG). Blood was collected on days -3, 7, 14, 21, 28... (fasting for 4-5 hours before blood collection, and the day of administration was day 0). The blood was collected and serum was separated. The expression level of AGT protein in the serum was detected using the Human Total Angiotensinogen Assay Kit (IBL, #27412), and the expression level of AGT protein in the serum was compared among the groups.

[0207] Table 12 Average AGT protein levels from Example 5 (normalized to AGT level before treatment as 1)

[0208] Results from mouse efficacy studies (Figure 6, Table 12) showed that both AD85481-EG and AGT203-EG reduced serum AGT levels to their lowest point on day 14 after administration, with a reduction of over 90% and maintaining the effect at a low level. Compared to the AD85481-EG group, the efficacy of AGT202-EG was more prolonged.

[0209] Example 6: In vivo effectiveness test in rhesus monkeys

[0210] Eight rhesus monkeys (Beijing Zhaoyinyuan Technology Co., Ltd.) were randomly assigned according to body weight to a positive control group and an experimental test group (four test compounds: AD85481-EG, AGT202-EG, AGT1638-EG, and AGT1654-EG). Each group consisted of two animals, one male and one female. Each group received a single subcutaneous injection of 3 mg / kg of the drug. Blood was collected from the cephalic vein of the forelimb on days -1, 4, 7, 11, 14, 18, 21, 28, 32, 35, 39, 42, 49, and 56 (after fasting overnight before blood collection, with the first dose designated as day 0). Serum was separated and serum AGT protein expression was measured using the Human Total Angiotensinogen Assay Kit (IBL, #27412). Intergroup comparisons were made.

[0211] Table 13 Average AGT protein from Example 6 Average AGT protein amount

[0212] (Normalized to the AGT level before treatment as 1)

[0213] The results (Figure 7, Table 13) showed that compared with pre-dose levels, the AGT202-EG group reduced serum AGT protein levels by approximately 80% on day 11 after administration, and this effect continued, reaching a reduction of more than 90% on day 28. The 90% reduction in serum AGT protein levels was maintained until at least day 63. In the AGT1638-EG group, serum AGT protein levels dropped to approximately 80% on day 11, and the efficacy was maintained until day 63, with the reduction rate remaining at 73%. In the positive control group, serum AGT protein levels did not reach their lowest value of approximately 80% until day 32. The 80% reduction lasted for approximately 10 days before rebounding. Therefore, the AGT202-EG and AGT1638-EG groups were significantly superior to the positive control group, AD85481-EG, in both efficacy and duration of efficacy.

[0214] Example 7: In vivo effectiveness testing in hypertensive cynomolgus monkeys

[0215] Six spontaneously hypertensive cynomolgus macaques (Kunming Keling Biotechnology Co., Ltd.) were randomly assigned according to body weight to either a low-dose AGT203 EG group (1.5 mg / kg) or a high-dose AGT203 EG group (3 mg / kg), with three animals per group. Blood was collected from a peripheral vein on days -9, -2, 4, 7, 14, 21, 28, 42, and 56 (after overnight fasting, with the day of the next injection designated as day 0). Serum was isolated for AGT protein analysis. Blood pressure (SBP) and DBP were measured at the wrist or base of the tail using a high-definition oscilloscope (HDO) on days -7, 23, and 54, and mean arterial pressure (MAP) was calculated.

[0216] Table 14 Average AGT protein from Example 7 Average AGT protein amount

[0217] (Normalized to the AGT level before treatment as 1)

[0218] Table 15 Average AGT protein reduction in blood pressure (BP) from Example 7

[0219] (Normalized to pre-treatment AGT level as 100%)

[0220] The results (Figure 8, Tables 14-15) show that compared to pre-dose levels, serum AGT protein levels in both the high- and low-dose AGT203 EG groups decreased by over 90% on day 14 after administration. This effect persisted, remaining low until 56 days after administration. Fifty-four days after administration, SBP and DBP decreased by 16.6% and 19.1%, respectively, in the low-dose AGT203 EG group. Fifty-four days after administration, SBP and DBP decreased by 16.1% and 30.2%, respectively, in the high-dose AGT203 EG group. These results demonstrate that AGT203 EG is highly effective, with a significant reduction in target gene protein and relief of hypertension. Combined with Figures 7 and 8 , it can be seen that AGT203-EG can reduce AGT to a lower level faster than AGT202-EG and AGT1638-EG, and maintain the AGT level at a low level more persistently, so AGT203-EG has better AGT mRNA inhibition efficiency than AGT202-EG and AGT1638-EG.

Claims

1. A double-stranded RNAi agent, comprising a sense strand and an antisense strand, wherein the nucleotide sequences of the sense strand and the antisense strand are as shown in any dsRNA sequence in Table 2.

2. The double-stranded RNAi agent according to claim 1, comprising a sense strand and an antisense strand, (1) the sense strand comprises a nucleotide sequence of GUCAUCCACAAUGAGAGUACA (SEQ ID NO: 1) (5'-3' direction), and / or the antisense strand comprises a nucleotide sequence of UGUACUCUCAUUGUGGAUGACGA (SEQ ID NO: 2) (5'-3' direction); (2) the sense strand comprises the nucleotide sequence of GUCAUCCACAAUGAGAGUACC (SEQ ID NO: 3) (5'-3' direction), and / or the antisense strand comprises the nucleotide sequence of GGUACUCUCAUUGUGGAUGACGA (SEQ ID NO: 4) (5'-3' direction); or (3) The sense strand comprises a nucleotide sequence of CUUCUAAUGAGUCGACUUUGA (SEQ ID NO: 5) (5'-3' direction), and / or the antisense strand comprises a nucleotide sequence of UCAAAGUCGACUCAUUAGAAGAA (SEQ ID NO: 6) (5'-3' direction).

3. The double-stranded RNAi agent according to claim 1 or 2, characterized in that One or more nucleotides of the sense strand and the antisense strand of the double-stranded RNAi agent have one or more modifications selected from the following group: 2′-methoxyethyl, 2′-O-alkyl, 2′-O-allyl, 2′-C-allyl, 2′-fluoro, 2′-deoxy, 2′-hydroxyl, locked nucleic acid modification, open-ring or non-locked nucleic acid modification, DNA modification, fluorescent probe modification; preferably, the sense strand and the antisense strand of the double-stranded RNAi agent both contain 2′-O-methyl and / or 2′-fluoro modifications.

4. The double-stranded RNAi agent according to claim 3, characterized in that The double-stranded RNAi agent further comprises at least one phosphorothioate or methylphosphonate internucleotide linkage, preferably comprises at least one phosphorothioate linkage; further preferably, the internucleotide linkage is at the 5' and 3' ends of the sense strand and the antisense strand; more preferably, the internucleotide linkage is between 3 nucleotides at the 5' and 3' ends of the sense strand and the antisense strand.

5. The double-stranded RNAi agent according to any one of claims 1 to 4, characterized in that The double-stranded RNAi agent comprises: (1) the antisense chain has a protruding end with a 5'(s)mN(s)mN3' structure at the 3' end; (2) at least the 2nd, 14th and 16th positions of the antisense chain from the 5' end are fluorinated, and other positions are methoxy-modified; (3) the antisense chain has at least two thio-modified from the 3' end and the 5' end, and preferably, at least the first and second nucleotide bonds from the 3' end and the 5' end of the antisense chain include thiophosphate backbone modifications; (4) the sense chain has fluorinated modifications at the 7th position and 9-11 positions from the 5' end, and other positions are methoxy-modified; (5) the sense chain has at least two thio-modified from the 5' end, and preferably, at least the first and second nucleotide bonds from the 5' end of the sense chain include thiophosphate backbone modifications.

6. The double-stranded RNAi agent according to any one of claims 1 to 5, characterized in that The double-stranded RNAi agent is conjugated to at least one ligand selected from the group consisting of cholesterol, biotin, vitamins, galactose derivatives or analogs, lactose derivatives or analogs, N-acetylgalactosamine derivatives or analogs, N-acetylglucosamine (GalNAc) derivatives or analogs; preferably, the ligand is an N-acetylglucosamine (GalNAc) derivative or analog.

7. The double-stranded RNAi agent according to claim 6, characterized in that The ligand is linked to the 3' end, 5' end and / or the middle of the sequence of the double-stranded RNAi agent; preferably, the ligand is linked to the 3' end of the sense strand of the double-stranded RNAi agent.

8. A double-stranded RNAi agent comprising: (1) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence UmsGfsUmAmCmUfCmUmCmAmUmUmGmUfGmGfAmUmGmAmCmsGmsAm (SEQ ID NO:7) and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence GmsUmsCmAmUmCmCfAmCfAfAfUmGmAmGmAmGmUmAmCmAm (SEQ ID NO:8); (2) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence GmsGfsUmAmCmUmCmUmCmAmUmUmGmUfGmGfAmUmGmAmCmsGmsAm (SEQ ID NO: 9) and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence GmsUmsCmAmUmCmCfAmCfAfAfUmGmAmGmAmGmUmAmCmCm (SEQ ID NO: 10); (3) with the nucleotide sequence GmsAfsAmCmCmUmGmUmCmAmAmUmCmUfUmCfUmCmAmGmCmsAmsGm (SEQ ID NO: 11) having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, 100% identity to the antisense strand of the nucleotide sequence and the sense strand having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, 100% identity to the nucleotide sequence GmsCmsUmGmAmGmAfAmGfAfUfUmGmAmCmAmGmGmUmUmCm (SEQ ID NO: 12); (4) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence UmsGfsAmAmCmCmUmGmUmCmAmAmUmCfUmUfCmUmCmAmGmsCmsAm (SEQ ID NO: 13) and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence CmsUmsGmAmGmAmAfGmAfUfUfGmAmCmAmGmGmUmUmCmAm (SEQ ID NO: 14); (5) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence UmsGfsAmUmCmAmUmAmCmAmCmAmGmCfAmAfAmCmAmGmGmsAmsAm (SEQ ID NO: 15) and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence CmsCmsUmGmUmUmUfGmCfUfGfUmGmUmAmUmGmAmUmCmAm (SEQ ID NO: 16); (6) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence UmsGfsAmCmAmCmAmUmCmGmCmUmGmAfUmUfUmGmUmCmCmsGmsGm (SEQ ID NO: 17) and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence GmsGmsAmCmAmAmAfUmCfAfGfCmGmAmUmGmUmGmUmCmAm (SEQ ID NO: 18); (7) having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, 117%, 118%, 119%, 120%, 121%, 122%, 123%, 124%, 125%, 126%, 127%, 128%, 129%, 130%, 131%, 132%, 133%, 134%, 135%, 136%, 137%, 138%, 139%, 140%, 141%, 142%, 143%, 144 an antisense strand consisting of a nucleotide sequence that is 100% identical to the nucleotide sequence CmsAmsGmUmCmUmCfCmCfAfCfCmUmUmUmUmCmUmUmCmUm (SEQ ID NO: 20) and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, 100% identical to the nucleotide sequence CmsAmsGmUmCmUmCfCmCfAfCfCmUmUmUmUmCmUmUmCmUm (SEQ ID NO: 20); (8) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence CmsAfsUmUmAmGmAmAmGmAmAmAmAmGfGmUfGmGmGmAmGmsAmsCm (SEQ ID NO: 21) and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence CmsUmsCmCmAmCfCmUfUfUfUmCmUmUmCmUmAmAmUmGm (SEQ ID NO: 22); (9) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence UmsCfsAmAmAmGmUmCmGmAmCmUmCmAfUmUfAmGmAmAmGmsAmsAm (SEQ ID NO: 23) and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence CmsUmsUmCmUmAmAfUmGfAfGfUmCmGmAmCmUmUmUmGmAm (SEQ ID NO: 24); (10) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence AmsCfsAmCmUmUmAmGmAmCmCmAmAmGfGmAfGmAmAmAmCmsGmsGm (SEQ ID NO:25) and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence GmsUmsUmUmCmUmCfCmUfUfGfGmUmCmUmAmAmGmUmGmUm (SEQ ID NO:26); or (11) an antisense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identity to the nucleotide sequence UmsUfsUmUmUmGmUmUmUmCmAmCmAfAmAfCmAmAmGmCmsUmsGm (SEQ ID NO: 27) and a GmsCmsUmUmGmUmUfUmGfUfGfAmAmAmCmAmAmAmAmAmAmAm (SEQ ID NO: 28) has a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, 100% identical; Among them, Am, Um, Cm and Gm represent ribonucleotides A, U, C and G modified by 2′-O-methyl, respectively; Af, Uf, Cf and Gf represent ribonucleotides A, U, C and G modified by 2′-fluoro, respectively; (s) means that the two nucleotides before and after are connected by a thiophosphate backbone.

9. The double-stranded RNAi agent according to claim 8, characterized in that The double-stranded RNAi agent is conjugated to at least one ligand.

10. The double-stranded RNAi agent according to claim 9, characterized in that The ligand is an N-acetylglucosamine (GalNAc) derivative or analog; preferably, the N-acetylglucosamine (GalNAc) derivative or analog is connected to the 3' end of the sense strand of the double-stranded RNAi agent; more preferably, the GalNAc structure is as shown in Formula II:

11. The double-stranded RNAi agent of any one of claims 8 to 10, comprising: (1) an antisense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identity to the nucleotide sequence UmsGfsUmAmCmUfCmUmCmAmUmUmGmUfGmGfAmUmGmAmCmsGmsAm (SEQ ID NO: 7) and a GmsUmsCmAmUmCmCfAmCfAfAfUmGmAmGmAmGmUmAmCmAm-L96 (SEQ ID NO: 29) has a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, 100% identical; (2) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence GmsGfsUmAmCmUmCmUmCmAmUmUmGmUfGmGfAmUmGmAmCmsGmsAm (SEQ ID NO:9) and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence GmsUmsCmAmUmCmCfAmCfAfAfUmGmAmGmAmGmUmAmCmCm-L96 (SEQ ID NO:30); (3) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence GmsAfsAmCmCmUmGmUmCmAmAmUmCmUfUmCfUmCmAmGmCmsAmsGm (SEQ ID NO: 11) and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence GmsCmsUmGmAmGmAfAmGfAfUfUmGmAmCmAmGmGmUmUmCm-L96 (SEQ ID NO: 31); (4) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence UmsGfsAmAmCmCmUmGmUmCmAmAmUmCfUmUfCmUmCmAmGmsCmsAm (SEQ ID NO: 13) and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence CmsUmsGmAmGmAmAfGmAfUfUfGmAmCmAmGmGmUmUmCmAm-L96 (SEQ ID NO: 32); (5) an antisense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identity to the nucleotide sequence UmsGfsAmUmCmAmUmAmCmAmCmAmGmCfAmAfAmCmAmGmGmsAmsAm (SEQ ID NO: 15) and a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identity to the nucleotide sequence CmsCmsUmGmUmUmUfGmCfUfGfUmGmUmAmUmGmAmUmCmAm-L96 (SEQ ID NO:33) having a sense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, 100% identity; (6) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence UmsGfsAmCmAmCmAmUmCmGmCmUmGmAfUmUfUmGmUmCmCmsGmsGm (SEQ ID NO: 17) and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence GmsGmsAmCmAmAmAfUmCfAfGfCmGmAmUmGmUmGmUmCmAm-L96 (SEQ ID NO: 34); (7) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence AmsGfsAmAmGmAmAmAmAmGmGmUmGmGfGmAfGmAmCmUmGmsGmsGm (SEQ ID NO: 19) and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence CmsAmsGmUmCmUmCfCmCfAfCfCmUmUmUmUmCmUmUmCmUm-L96 (SEQ ID NO: 35); (8) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence CmsAfsUmUmAmGmAmAmGmAmAmAmAmGfGmUfGmGmGmAmGmsAmsCm (SEQ ID NO:21), and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence CmsUmsCmCmAmCfCmUfUfUfUmCmUmUmCmUmAmAmUmGm-L96 (SEQ ID NO:36); (9) an antisense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identity to the nucleotide sequence UmsCfsAmAmAmGmUmCmGmAmCmUmCmAfUmUfAmGmAmAmGmsAmsAm (SEQ ID NO: 23) and a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identity to the nucleotide sequence CmsUmsUmCmUmAmAfUmGfAfGfUmCmGmAmCmUmUmUmGmAm-L96 (SEQ ID NO:37) having a sense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, 100% identity; (10) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence AmsCfsAmCmUmUmAmGmAmCmCmAmAmGfGmAfGmAmAmAmCmsGmsGm (SEQ ID NO:25) and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence GmsUmsUmUmCmUmCfCmUfUfGfGmUmCmUmAmAmGmUmGmUm-L96 (SEQ ID NO:38); or (11) an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence UmsUfsUmUmUmGmUmUmUmCmAmCmAfAmAfCmAmAmGmCmsUmsGm (SEQ ID NO:27) and a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence GmsCmsUmUmGmUmUfUmGfUfGfAmAmCmAmAmAmAmAmAm-L96 (SEQ ID NO:39); Wherein, Am, Um, Cm and Gm represent ribonucleotides A, U, C and G modified by 2′-O-methyl, respectively; Af, Uf, Cf and Gf represent ribonucleotides A, U, C and G modified by 2′-fluoro, respectively; (s) represents that the two nucleotides before and after are connected by a thiophosphate backbone, L96 is connected to the 3′ end of the sense strand of the double-stranded RNAi agent, and the structural formula of L96 is shown in Formula III:

12. The double-stranded RNAi agent according to claim 11, characterized in that The double-stranded RNAi agent has the structure of Formula IV:

13. A reagent or kit comprising the double-stranded RNAi agent according to any one of claims 1 to 12 or the DNA molecule according to claim 12.

14. A pharmaceutical composition comprising the double-stranded RNAi agent according to any one of claims 1 to 12.

15. Use of the double-stranded RNAi agent according to any one of claims 1 to 12 or the pharmaceutical composition according to claim 15 in the preparation of a medicament for preventing and / or treating a disease mediated by AGT expression or alleviating the symptoms of a disease mediated by the AGT gene.

16. The use according to claim 15, characterized in that The diseases mediated by the AGT gene include hypertension, critical hypertension, essential hypertension, secondary hypertension, hypertensive crisis, hypertensive emergency state, isolated systolic and diastolic hypertension, pregnancy-related hypertension, diabetic hypertension, resistant hypertension, refractory hypertension, paroxysmal hypertension, renovascular hypertension, Goldblatt's hypertension, ocular hypertension, glaucoma, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, unstable hypertension; hypertensive heart disease, hypertensive nephropathy, atherosclerosis, arteriosclerosis, Vascular disease, diabetic nephropathy, diabetic retinopathy, chronic heart failure, cardiomyopathy, diabetic cardiomyopathy, glomerulosclerosis, coarctation of the aorta, aortic aneurysm, ventricular fibrosis, Cushing's syndrome and other glucocorticoid excess states (including chronic steroid therapy), pheochromocytoma, nephroblastoma, secondary aldosteronism and other mineralocorticoid excess states, sleep apnea, thyroid / parathyroid disease, heart failure, myocardial infarction, angina pectoris, stroke, diabetes mellitus, kidney disease, renal failure, systemic sclerosis, intrauterine growth retardation (IUGR), and fetal growth restriction.

Images