Staphylococcus epidermidis 2251 and its applications

Abstract

The present invention discloses Staphylococcus epidermidis 2251 and its applications. Staphylococcus epidermidis 2251 has a preservation number of CGMCC NO. 30987. The applications of Staphylococcus epidermidis 2251 in preparing a biocontrol preparation or feed for preventing and treating aquatic diseases; the application of Staphylococcus epidermidis 2251 in inhibiting the growth of Pseudomonas plecoglossicida, and a biocontrol preparation or feed for preventing and treating aquatic diseases containing Staphylococcus epidermidis 2251. A strain of Staphylococcus epidermidis isolated and cultured in the present invention has verified the disease resistance of the strain through in vitro and in vivo experiments, and preliminarily explored its disease resistance mechanism, providing a reference for the prevention and treatment research of the visceral white spot disease of small yellow croaker.

Description

Technical Field

[0001] The present invention belongs to the technical field of microbiology, and particularly relates to Staphylococcus epidermidis 2251 and its application. Background Art

[0002] Small yellow croaker is an important catch fish in China. Together with large yellow croaker, hairtail and cuttlefish, it is known as the "four major marine products" in China. It has high nutritional value and is deeply loved by the people.

[0003] Since the realization of full artificial breeding, the frequent occurrence of diseases has become an important bottleneck restricting the further development of the breeding industry. Among them, visceral white spot disease has become the main disease type in small yellow croaker breeding due to its frequent occurrence, high lethality and difficult treatment, causing great economic losses to the small yellow croaker breeding industry.

[0004] At present, Pseudomonas plecoglossicida, namely pps, has developed resistance to a variety of commonly used antibiotics in aquaculture, and the use of antibiotic drugs is likely to affect the environment and food safety. In large yellow croaker, it can survive, replicate and release in macrophages. The use of probiotics to resist diseases has been successful in many other fish, but the technology of using probiotics to resist diseases in small yellow croaker is extremely rare. Summary of the Invention

[0005] Aiming at the problems existing in the prior art, the purpose of the present invention is to design and provide a technical solution for Staphylococcus epidermidis 2251 and its application.

[0006] The present invention is specifically implemented by the following technical solutions:

[0007] In the first aspect of the present invention, there is provided Staphylococcus epidermidis ( Staphylococcus epidermidis ) 2251, whose preservation number is CGMCC NO.30987.

[0008] In the second aspect of the present invention, there is provided the application of the above-mentioned Staphylococcus epidermidis 2251 in the preparation of a biocontrol preparation or feed for preventing and treating aquatic diseases.

[0009] Furthermore, the biocontrol preparation or feed for preventing and treating aquatic diseases contains the cells of Staphylococcus epidermidis 2251.

[0010] Furthermore, the aquatic disease is visceral white spot disease of small yellow croaker caused by Pseudomonas plecoglossicida.

[0011] In the third aspect of the present invention, there is provided the application of the above-mentioned Staphylococcus epidermidis 2251 in inhibiting the growth of Pseudomonas plecoglossicida.

[0012] In the fourth aspect of the present invention, there is provided a biocontrol preparation or feed for preventing and treating aquatic diseases containing the above-mentioned Staphylococcus epidermidis 2251.

[0013] Furthermore, the biocontrol agent or feed contains the cells of Staphylococcus epidermidis 2251.

[0014] The fifth aspect of the present invention provides the application of the above biocontrol agent or feed for preventing and treating aquatic diseases in inhibiting the growth of Pseudomonas plecoglossicida.

[0015] The present invention isolated a strain of Staphylococcus epidermidis ( Staphylococcus epidermidis ) 2251 from the intestine of healthy small yellow croakers. It was found in in vitro verification experiments that it could inhibit the growth and reproduction of the pathogenic bacterium Pseudomonas plecoglossicida, and its own number increased when coexisting with Pseudomonas plecoglossicida. In the in vivo verification experiment of the disease resistance ability of Staphylococcus epidermidis, deaths began to occur in the control challenge group from the 6th day, and the mortality rate reached 100% on the 14th day; deaths began to occur in the bacteria-fed challenge group from the 7th day, and the overall survival rate was greater than that of the control challenge group, and the difference was significant. There was still 30.56% survival on the 14th day, proving that mixing and feeding Staphylococcus epidermidis was significantly helpful for small yellow croakers to resist visceral white spot disease caused by Pseudomonas plecoglossicida. Detection of the bacterial load in tissues found that the content of Pseudomonas plecoglossicida in the bacteria-fed challenge group was significantly lower than that in the control challenge group, and it was proved that Staphylococcus epidermidis could significantly inhibit the growth of the pathogenic bacterium Pseudomonas plecoglossicida. Using the extracellular metabolites of Staphylococcus epidermidis for antibacterial experiments, it was found that in addition to inhibiting Pseudomonas plecoglossicida, its metabolites also had an obvious inhibitory effect on Vibrio harveyi.

[0016] In summary, a strain of Staphylococcus epidermidis isolated and cultured in the present invention verified the disease resistance ability of the bacterium through in vitro and in vivo experiments, and preliminarily explored its disease resistance mechanism, providing a reference for the prevention and treatment research of visceral white spot disease and other diseases of small yellow croakers. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] 图1 Figure 18 shows the results of co-culturing four experimental bacteria with Pseudomonas plecoglossicida (a: Brevibacillus brevis cultured alone; b: Pseudomonas plecoglossicida pps cultured alone; c: Brevibacillus brevis and pps co-cultured; d: Sphingomonas sp. cultured alone; e: pps cultured alone; f: Sphingomonas sp. and pps co-cultured; g: Klebsiella oxytoca cultured alone; h: pps cultured alone; i: Klebsiella oxytoca and pps co-cultured; j: Staphylococcus epidermidis cultured alone; k: pps cultured alone; l: Staphylococcus epidermidis and pps co-cultured);

[0018] 图2 Co - culture results of lysates of four experimental bacteria and Pseudomonas plecoglossicida (a: culturing Pps alone; b: effect of Brevibacillus brevis lysate on Pps; c: effect of Klebsiella oxytoca lysate on Pps; d: effect of Staphylococcus epidermidis lysate on Pps; e: effect of Sphingomonas lysate on Pps);

[0019] 图3 Relative quantification of Staphylococcus epidermidis in tissues of four groups of samples after Pps challenge;

[0020] 图4 Relative quantification of Pseudomonas plecoglossicida in tissues of four groups of samples after Pps challenge;

[0021] 图5 Tissue sections of the intestines of the bacteria - fed group and the non - bacteria - fed group in the in - vivo verification experiment (a - d: tissue sections of the bacteria - fed group at weeks 1 - 4 respectively; e - h: tissue sections of the non - bacteria - fed group at weeks 1 - 4 respectively);

[0022] 图6 Photos of tissue sections, scanning electron microscopy and transmission electron microscopy of the challenged and non - challenged groups of the bacteria - fed group and the challenged and non - challenged groups of the non - bacteria - fed group after Pps challenge in the in - vivo verification experiment (a. Tissue section of the challenged non - bacteria - fed group; b. Tissue section of the non - challenged non - bacteria - fed group; c. Tissue section of the challenged bacteria - fed group; d. Tissue section of the non - challenged bacteria - fed group; e. Scanning electron microscopy of the challenged non - bacteria - fed group; f. Scanning electron microscopy of the non - challenged non - bacteria - fed group; g. Scanning electron microscopy of the challenged bacteria - fed group; h. Scanning electron microscopy of the non - challenged bacteria - fed group; i. Transmission electron microscopy of the challenged non - bacteria - fed group; j. Transmission electron microscopy of the non - challenged non - bacteria - fed group; k. Transmission electron microscopy of the challenged bacteria - fed group; l. Transmission electron microscopy of the non - challenged bacteria - fed group);

[0023] 图7 Results of the inhibition of Pseudomonas plecoglossicida by extracellular metabolites of Staphylococcus epidermidis (a: Culturing results after mixing 100 μL of extracellular metabolites with 10 μL of bacterial solution; b: Culturing results of 10 μL of Pseudomonas plecoglossicida (10 3 cfu / mL); c: Culturing results of 40 μL of extracellular metabolites);

[0024] 图8 Analysis of the ability of extracellular metabolites of Staphylococcus epidermidis to inhibit Vibrio harveyi (a: Culturing results after mixing 100 μL of extracellular metabolites with 20 μL of bacterial solution; b: Culturing results of 20 μL of Vibrio harveyi (10 2 cfu / mL); c: Culturing results of 50 μL of extracellular metabolites). Detailed implementation manners

[0025] The present invention will be further described below in conjunction with embodiments.

[0026] Based on previous research findings: Lactobacillus exists in the intestine of healthy small yellow croakers Lactobacillus , Bifidobacterium Bifidobacterium , Streptococcus Streptococcus , Lachnospira Lachnospira , Escherichia Escherichia , Shigella Shigella , Sphingomonas Sphingomonas , Klebsiella Klebsiella , Collinsella Collinsella , Rothia Romboutsia , Staphylococcus Staphylococcus , Empedobacter Empedobacter , Corynebacterium Corynebacterium , Ruminococcus Ruminococcus , Christensenella Christensenellaceae , Eubacterium eligens Blautia , Eubacterium Eubacterium , Sutterella Sutterella , Anaerobaculum Allobaculum , Fusobacterium Fusobacterium , Prevotella Prevotellaceae and other potentially beneficial bacteria.

[0027] Example 1: Isolation, culture and functional verification of potentially beneficial bacteria in the intestine of small yellow croakers

[0028] 1 Experimental materials and methods

[0029] 1.1 Experimental materials

[0030] The culture media involved in this example include MRS medium, SS medium, PYG medium, GAM medium, ATCC Medium 1365, ATCC Medium 1490, 2216E medium, Lactobacillus medium, Bifidobacterium medium and nutrient broth medium. The above culture media are all existing culture media. Among them, MRS medium and SS medium are produced and sold by Hangzhou Best Biotechnology Co., Ltd., PYG medium, GAM medium and 2216E medium are produced and sold by Haibo Biotechnology Co., Ltd., ATCC Medium 1365 and ATCC Medium 1490 are produced and sold by ELITE-MEDIA, and Lactobacillus medium, Bifidobacterium medium and nutrient broth medium are produced and sold by Shanghai Shifeng Biotechnology Co., Ltd.

[0031] 1.2 Isolation and culture of bacteria in the digestive tract of small yellow croakers

[0032] Use sterile tweezers and scissors to dissect out the digestive tract of small yellow croaker, wash it with sterile saline, flush the inside of the intestine with a needle, cut the intestine into pieces and break it with a fully automatic sample rapid grinder, and use a sterile inoculation loop to streak the above-mentioned culture plates in an ultra-clean bench. Each plate was cultured at 28°C, 37°C, in aerobic or anaerobic environments for 48 hours.

[0033] Pick a single colony from the culture plate, put it into the corresponding liquid culture medium, and culture it in a constant temperature shaker (200r / min). Then use the DNA extraction kit to extract DNA according to the instructions, and then use primers 27F and 1492R for PCR. The PCR program and system are shown in Table 1. The PCR product was sent to Qingke Biotechnology Co., Ltd. for sequencing.

[0034] The sequencing results were compared with the NCBI database by Blast to determine the strain type. Common pathogenic bacteria and harmful bacteria were removed, and 1400 μL of the remaining strains were placed in a sterile 1.5 mL centrifuge tube, centrifuged at 3000 rpm for 5 min using an ultracentrifuge, and after removing the supernatant, 400 μL of 20% sterile glycerol and 1 mL of the original liquid culture medium were added, and the mixture was blown with a pipette tip and then frozen in a -80°C refrigerator.

[0035] Table 1 PCR procedures and systems

[0036] 1.3 Co-culture test of potential beneficial bacteria and Pseudomonas aeruginosa

[0037] Potential beneficial bacteria and Pseudomonas aeruginosa were cultured in nutrient broth at 28°C for 24 h, and the OD 600 Adjust to 0.6 and dilute 100,000 times for later use.

[0038] 30 μl of a 100,000-fold dilution of potential beneficial bacteria was spread on a nutrient agar medium as a control. Similarly, 30 μl of a 100,000-fold dilution of Pseudomonas aeruginosa was spread on a nutrient agar medium as a control.

[0039] Take 30 microliters of a 100,000-fold dilution of potential beneficial bacteria and spread it on a nutrient agar medium, and then take 30 microliters of a 100,000-fold dilution of Pseudomonas aeruginosa and spread it on the same medium to observe the results of the co-culture of live bacteria.

[0040] All the above culture media were cultured at 28°C for 24 hours, and all single colonies on the culture media were picked and cultured in nutrient broth medium at 28°C overnight. DNA was extracted using a DNA extraction kit according to the instructions, and then PCR was performed using primers 27F and 1492R. The PCR program and system are shown in Table 1. The PCR products were sent to Qingke Biotechnology Co., Ltd. for sequencing to determine the number of each bacteria on the co-culture plate.

[0041] 1.4 Effect of potential beneficial bacteria lysate on Pseudomonas aeruginosa

[0042] Potential beneficial bacteria and Pseudomonas aeruginosa were cultured in nutrient broth at 28°C for 24 h, and the OD 600 Adjust to 0.6 and dilute 100,000 times for later use.

[0043] After enrichment, the potential beneficial bacteria are repeatedly frozen and thawed and ultrasonically disrupted, and filtered through a 0.22-micron filter for later use.

[0044] Take 30 microliters of the 100,000-fold dilution of Pseudomonas aeruginosa and spread it on the nutrient agar medium as a control.

[0045] 30 μl of a 100,000-fold dilution of Pseudomonas aeruginosa was spread on a nutrient agar medium, and 30 μl of a lysate of potential beneficial bacteria was spread on a nutrient agar medium to observe the effect of the lysate of potential beneficial bacteria on Pseudomonas aeruginosa.

[0046] All the above culture media were cultured at 28°C for 24 hours, and all single colonies on the culture media were picked and cultured in nutrient broth medium at 28°C overnight. DNA was extracted using a DNA extraction kit according to the instructions, and then PCR was performed using primers 27F and 1492R. The PCR program and system are shown in Table 1. The PCR products were sent to Qingke Biotechnology Co., Ltd. for sequencing to determine the number of each bacteria on the co-culture plate.

[0047] 2 Experimental results

[0048] 2.1 Results of bacterial isolation and culture in the digestive tract of small yellow croaker

[0049] After exploration and more than 300 batches of experiments and tests, Bacillus subtilis, Photobacterium mermanii, Vibrio navarroa, Vibrio harveyi, Aeromonas caviae, Aeromonas versii, Citrobacter rodentium, Aeromonas hydrophila, etc. were identified.

[0050] As for the target bacteria, Sphingomonas ( Sphingomonas echinoides ) B18, Klebsiella oxytoca ( Klebsiella oxytoca )G1-2-4, Staphylococcus epidermidis ( Staphylococcus epidermidis ) 2251, Bacillus brevis ( Empedobacter brevis ) HMF6096 four strains.

[0051] Sphingomonas Sphingomonas echinoides ) The sequence fragment of B18 is as shown in SEQ ID NO.1; Klebsiella oxytoca ( Klebsiella oxytoca )G1-2-4, as shown in SEQ ID NO.2; Staphylococcus epidermidis ( Staphylococcus epidermidis ) 2251, as shown in SEQ ID NO.3; Bacillus brevis (E Brevibacterium breve) HMF6096, as shown in SEQ ID NO.4. The above sequence was compared by BLAST and its genus was determined.

[0052] 2.2 Results of co - culture experiments of potentially beneficial bacteria and Pseudomonas plecoglossicida

[0053] The results of co - culture experiments of potentially beneficial bacteria and Pseudomonas plecoglossicida are shown in 图1 and 图2 As shown. When Brevibacterium breve was co - cultured with Pseudomonas plecoglossicida, after picking single colonies from the co - culture plate, shaking the bacteria and sending them for testing, 159 Brevibacterium breve and 59 pps were found, while on the single - culture plate used as a control, there were 94 Brevibacterium breve and 6 pps respectively. When Klebsiella oxytoca was co - cultured with Pseudomonas plecoglossicida, after picking single colonies from the co - culture plate, shaking the bacteria and sending them for testing, 10 Klebsiella oxytoca and 97 pps were found, while on the single - culture plate used as a control, there were 4 Klebsiella oxytoca and 35 pps respectively. When Sphingomonas was co - cultured with Pseudomonas plecoglossicida, after picking single colonies from the co - culture plate, shaking the bacteria and sending them for testing, 1 Sphingomonas and 15 pps were found, while on the single - culture plate used as a control, there were 15 Sphingomonas and 1 pps respectively. When Staphylococcus epidermidis was co - cultured with Pseudomonas plecoglossicida, after picking single colonies from the co - culture plate, shaking the bacteria and sending them for testing, 35 Staphylococcus epidermidis and 4 pps were found, while on the single - culture plate used as a control, there were 45 Staphylococcus epidermidis and 32 pps respectively.

[0054] In summary, after co - culturing four experimental bacteria with Pseudomonas plecoglossicida respectively, only Staphylococcus epidermidis can significantly inhibit the number of Pseudomonas plecoglossicida.

[0055] 2.3 Discussion

[0056] In this example, after obtaining a large number of intestinal bacteria of small yellow croaker, the bacteria that may be harmful to the host reported in the existing literature were excluded, and among the remaining bacteria, Sphingomonas ( Sphingomonas echinoides ), Klebsiella oxytoca ( Klebsiella oxytoca ), Staphylococcus epidermidis ( Staphylococcus epidermidis ), and Brevibacterium breve ( Empedobacter brevis ), four strains, namely B18, G1 - 2 - 4, 2251, and HMF6096, were initially selected for subsequent experiments. In the in vitro experiment of co - culturing live bacteria with Pseudomonas plecoglossicida, we found that only when Staphylococcus epidermidis was co - cultured with Pseudomonas plecoglossicida, the number of Pseudomonas plecoglossicida on the co - culture plate was less than that on the single - culture plate, while the live - bacteria co - culture experiments of Sphingomonas, Klebsiella oxytoca, and Brevibacterium breve did not achieve this effect, indicating that Staphylococcus epidermidis may be able to inhibit Pseudomonas plecoglossicida.

[0057] Finally, Staphylococcus epidermidis ( Staphylococcus epidermidis ) 2251 was deposited in the General Microbiological Center of the China Committee for Culture Collection of Microorganisms on June 18, 2024. The deposit number is CGMCC NO. 30987. The address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, 100101.

[0058] Example 2: In-vivo verification of the anti-visceral white spot disease ability of Staphylococcus epidermidis ( Staphylococcus epidermidis ) 2251

[0059] 1 Experimental design

[0060] 1.1 The experimental site, related facilities and experimental fish were all provided by Xiangshan Bay Aquaculture Seed Co., Ltd. (Ningbo, China). Approximately 1000 healthy small yellow croakers were used. It was planned to be divided into a control group (3 barrels) and an experimental group (3 barrels). Approximately 160 fish were placed in each barrel. Before dividing the fish, the body weight and total length were measured (the average total length was 12.35 ± 0.6 cm; the average body weight was 20.38 ± 2.27 g). The experimental group was fed enrofloxacin (the standard was 50 mg / Kg body weight, used at 2 times the amount in the pre-experiment) and doxycycline (20 mg / Kg, used at 2 times the amount in the pre-experiment) for 1 week. Then, 5 intestinal contents were taken for plating or streak culture to observe the culture results and clarify whether some of the original microorganisms had been cleared, which was beneficial for the colonization of the experimental bacteria after feeding. The feed containing Staphylococcus epidermidis was continuously fed for 4 weeks (1×10 8 cfu / Kg, 1% feeding). Intestines were randomly taken once every 7 days (for both the control group and the experimental group), 6 fish from each barrel each time. Among them, 4 fish were frozen in liquid nitrogen (1 tube per fish), 1 fish was fixed with PFA (the same group at the same time period could be mixed and fixed), and 1 fish was fixed with 2.5% glutaraldehyde fixative for electron microscopy experiment. Four weeks after feeding Klebsiella oxytoca, each barrel of fish was divided into two halves. Half was used for challenge with Pseudomonas pseudocepacia (pps), and half was used as a control. At this time, the control group (3 barrels) and the experimental group (3 barrels) were divided into 4 groups: control challenge group (3 barrels), control non-challenge group (3 barrels), bacteria-fed challenge group (3 barrels), bacteria-fed non-challenge group (3 barrels), with approximately 60 fish in each barrel. The challenge bacterium Pseudomonas pseudocepacia strain XSDHY was isolated and cultured from the liver of small yellow croakers with visceral white spot disease in this laboratory. The volume of water in each barrel was 450 L, the water temperature was heated to 22°C, 300 mL of the challenge bacterium was used per barrel, and the OD of the challenge bacterium 600=0.25, no feeding and no water change during the whole process of the challenge. After the challenge, 6 samples were taken from each barrel, of which 4 were frozen in liquid nitrogen (1 tube for each), 1 was fixed with PFA, and 1 was fixed with 2.5% glutaraldehyde fixative for electron microscopy. The death situation during the challenge was recorded and the mortality rate of each group was calculated. The samples frozen in liquid nitrogen were used to measure the changes in tissue bacterial load, changes in intestinal microbial composition, and changes in intestinal immune factors. The PFA-fixed samples were made into paraffin sections for HE staining, and the intestinal changes were observed under a microscope. For the electron microscopy experiment, the samples fixed with 2.5% glutaraldehyde fixative were dehydrated with ethanol step by step, and then dehydrated with 100% acetone. After that, the embedding agent was infiltrated, embedded, sliced, stained, and observed with a scanning electron microscope and a transmission electron microscope, and photographed and preserved.

[0061] 2 Experimental methods

[0062] 2.1 Measurement of bacterial load in tissues in in vivo validation experiments

[0063] Take out the samples frozen in liquid nitrogen, and use a DNA extraction kit to extract DNA for later use. According to the sequence of Staphylococcus epidermidis, use NCBI's Primer-BLAST to design primers, use the designed primers to perform fluorescent quantitative PCR experiments on the previously extracted sample DNA, and send the products to Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results were Blast aligned in the NCBI database to verify the specific primers for Staphylococcus epidermidis. After verification, a pair of specific primers were obtained, whose sequences were forward AGTACGGCCGCAAGGTTAAA, reverse GCAGCACCTGTCTCAGAGTT, and the product size was 166. Use the primers to perform fluorescent quantitative PCR experiments on sample DNA, and the internal reference gene is small yellow croaker. β-Actin The reaction system is shown in Table 2. According to the results of fluorescence quantitative PCR, the content of Klebsiella oxytoca in the sample tissue was calculated using the qPCR relative quantitative calculation method 2^-(`△△Ct).

[0064] Real-time fluorescence quantitative PCR detection technology was used to detect the content of Pseudomonas aeruginosa in the sample tissues after infection.

[0065] Table 2: Reaction system

[0066] 2.2 Calculation of mortality in in vivo validation experiments

[0067] After four weeks of co-feeding with Staphylococcus epidermidis, each barrel of fish was divided into two halves. Half was used for PPS challenge, and the other half was used as a control. At this time, the control group (3 barrels) and the experimental group (3 barrels) were divided into 4 groups: control challenged group (3 barrels), control non-challenged group (3 barrels), bacteria-fed challenged group (3 barrels), and bacteria-fed non-challenged group (3 barrels). Subsequently, the number of deaths in each barrel was recorded daily, and the recorded data were analyzed for correlation using SPSS 27 and plotted using GraphPad Prism 8.

[0068] 2.3 Tissue sectioning and H.E. staining

[0069] Dehydration and paraffin infiltration: Take out the intestinal tissues stored in 4% paraformaldehyde, cut out 2-mm small segments with a sterile scalpel, put them into embedding cassettes, first dehydrate (3 times with 70% ethanol for 5 minutes each time, 1 time each with 80%, 90%, and 95% ethanol for 5 minutes each time, 3 times with 100% ethanol for 5 minutes each time), then clarify (mix ethanol and xylene in a volume ratio of 1:1 for 10 minutes, 10 minutes each with xylene I and xylene II), and finally infiltrate with wax (mix xylene and paraffin in a volume ratio of 1:1 for 1 hour, paraffin for 2 hours).

[0070] Embedding and sectioning: Take out the intestinal tissues in the embedding cassettes, place them in the middle of the groove of a small metal dish, add wax solution and let it cool and solidify. After removing the wax block and trimming it into a size of 5 mm in length and width with a blade, fix it on a microtome and set the wax strip with a section thickness of 5 μm.

[0071] Spreading and baking the sections: Coat the glass slides with egg white to increase adhesion. Spread the cut wax strips on the water surface at 40 °C, pick them up with glass slides, and put them into a baking oven to dry at a temperature of 40 °C for 3 hours.

[0072] H.E. (hematoxylin-eosin) staining: First, dewax with xylene (10 minutes each with xylene I and xylene II), then rehydrate with gradient ethanol (5 minutes with 100% ethanol, 2 minutes each with 90%, 80%, 70% ethanol, and distilled water), then stain (15 seconds with hematoxylin, rinse with distilled water for 20 minutes, 30 seconds with eosin), and finally dehydrate with gradient ethanol (2 minutes each with 70%, 80%, 90% ethanol, 10 minutes with 100% ethanol).

[0073] Put the stained slides into a microscope (YS-100; Nikon Corporation, Tokyo, Japan) for observation and photography. Measure the intestinal villus width, intestinal villus length, intestinal wall thickness, and intestinal lumen diameter of the challenged group and the control group. Calculate the average intestinal villus width ÷ intestinal lumen diameter = relative intestinal villus width, average intestinal villus length ÷ intestinal lumen diameter = relative intestinal villus length, average intestinal wall thickness ÷ intestinal lumen diameter = relative intestinal wall thickness, and analyze their correlations using SPSS 27.

[0074] 2.4 Transmission Electron Microscopy Experimental Method

[0075] Dehydration: Take out the intestinal tissue preserved in 2.5% glutaraldehyde fixative, dehydrate it with alcohol first (15 minutes each for 50%, 70%, 80%, 90%, 95%, 100%, 100%), and then dehydrate it with 100% acetone for 20 minutes.

[0076] Infiltration and embedding: First infiltrate with a 3:1 ratio of acetone and SPURR embedding agent for 2 hours, then infiltrate with a 1:1 ratio of acetone and SPURR embedding agent for 4 hours, then infiltrate with a 1:3 ratio of acetone and SPURR embedding agent for 4 hours, then change to pure SPURR embedding agent to infiltrate overnight, and finally polymerize at 70 °C in an oven for 24 hours.

[0077] Sectioning and staining: Use an ultramicrotome to set the thickness to 60 nm for sectioning, and then perform double staining with uranium and lead (stain with 2% saturated alcoholic solution of uranyl acetate and lead citrate for 15 minutes each), and dry overnight at room temperature.

[0078] Observation and photography were carried out using a transmission electron microscope Hitachi H7650.

[0079] 2.5 Scanning Electron Microscopy Experimental Method

[0080] Take out the intestinal tissue preserved in 2.5% glutaraldehyde fixative, dehydrate it with alcohol first (15 minutes each for 50%, 70%, 80%, 90%, 95%, 100%, 100%), then infiltrate with a 1:1 ratio of 100% alcohol and isoamyl acetate for 30 minutes, change to pure isoamyl acetate to infiltrate overnight, coat with a film after drying with a dryer, and observe and photograph using a scanning electron microscope Hitachi Regulus8100.

[0081] 2.6 Data Analysis

[0082] The detection results of tissue bacterial load and the statistical data of mortality in each group after pps challenge were analyzed for their correlation using SPSS27, and statistical analysis was performed according to the standard of significant differences (P values less than 0.05, 0.01, 0.001 were marked as *, **, ***, respectively).

[0083] 3. Experimental Results

[0084] 3.1 Detection of Tissue Bacterial Load in In Vivo Verification Experiment

[0085] After pps challenge, the content of Staphylococcus epidermidis in the bacteria-fed and challenged group was significantly higher than that in the bacteria-fed and non-challenged group, as shown in 图3 As shown, this is consistent with the experimental result that Staphylococcus epidermidis increased after co-culturing two live bacteria in vitro.

[0086] When detecting the content of Pseudomonas plecoglossicida in each group after pps challenge, as shown in 图4 As shown, the content of Pseudomonas plecoglossicida in the fed-bacteria challenge group was significantly lower than that in the control challenge group, indicating that pre-mixing and feeding with Staphylococcus epidermidis could significantly inhibit the growth of the pathogenic bacterium Pseudomonas plecoglossicida. This is consistent with the experimental result that the lysate of Staphylococcus epidermidis inhibited Pseudomonas plecoglossicida in vitro.

[0087] 3.2 Results of intestinal histological analysis in in vivo verification experiment

[0088] In the first seven days of the in vivo verification experiment, after the experimental group was pre-mixed and fed with enrofloxacin and doxycycline, the intestinal structure was clear, the cells were intact, the goblet cells on the intestinal villi were arranged tightly, neatly and regularly, and the intestinal wall structure, intestinal villus morphology, goblet cell morphology, etc. were basically the same as those of the control group, which proved that pre-mixing and feeding with enrofloxacin and doxycycline had basically no effect on the intestinal structure of small yellow croaker.

[0089] During the subsequent four weeks of continuous pre-mixing and feeding with the feed containing Staphylococcus epidermidis (as shown in 图5 ), it can be seen from the tissue sections that the intestinal structure of the experimental group was clear, the cells were intact, the goblet cells on the intestinal villi were arranged tightly, neatly and regularly, and the intestinal wall structure, intestinal villus morphology, goblet cell morphology, etc. were basically the same as those of the control group, which proved that continuous pre-mixing and feeding with the feed containing Klebsiella oxytoca for four weeks had basically no effect on the intestinal structure of small yellow croaker.

[0090] After the challenge experiment, the last step of the in vivo verification experiment was completed, and we sampled four groups of fish (the challenged group without pre-mixing and feeding, the non-challenged group without pre-mixing and feeding, the challenged group with pre-mixing and feeding, the non-challenged group with pre-mixing and feeding). Observing the samples through tissue sections, scanning electron microscopy and transmission electron microscopy, as shown in 图6 , it can be seen that the intestinal tissue structure of the challenged group without pre-mixing and feeding and the challenged group with pre-mixing and feeding was unclear, the boundaries of parenchymal cells were blurred, cell disintegration and tissue vacuolization occurred, the intestinal villi were damaged, and obvious breaks appeared at the boundary of the intestinal wall.

[0091] 3.3 Discussion

[0092] The intestine is not only a place for digesting and absorbing nutrients. Since it contains immune cells such as lymphocytes, macrophages, granulocytes, and plasma cells, this organ also plays an important role in non-specific immunity and specific immune responses. Components such as the epithelial layer, mucus layer, microbial community, and intestinal secretions constitute a complex intestinal defense system, which can effectively prevent the transfer of harmful bacteria and their toxins in the intestine to tissues outside the intestinal lumen and the invasion of exogenous pathogenic microorganisms into the body.

[0093] In the in - vivo verification experiment of this embodiment, before the step of challenging with PPS, whether feeding enrofloxacin and doxycycline or feeding Staphylococcus epidermidis, by observing the tissue sections, scanning electron microscopy, and transmission electron microscopy of the intestinal samples, it was found that the intestinal structure was clear, the cells were intact, the goblet cells on the intestinal villi were arranged tightly, neatly and regularly, the intestinal villi were arranged densely and flatly, the intestinal wall boundary was complete, and the intestinal villi were arranged densely, neatly and had similar lengths and thicknesses. It was proved that feeding enrofloxacin, doxycycline, and Klebsiella oxytoca would not damage the intestinal structure and had little impact on small yellow croakers. After the step of challenging with PPS, there was no change in the non - challenged control group and the bacteria - fed non - challenged group. In the challenged control group and the bacteria - fed challenged group, the intestinal tissue structure was not clear, the boundaries of parenchymal cells were blurred, cell disintegration and tissue vacuolization occurred, the intestinal villi were damaged, and obvious breakages appeared at the intestinal wall boundary. It was proved that PPS was the cause of the damage to the intestinal structure of small yellow croakers.

[0094] The detection of tissue bacteria content found that Staphylococcus epidermidis already existed in the digestive tract of small yellow croakers before feeding Staphylococcus epidermidis. As a common bacterium in wild small yellow croakers, it had the advantages of good safety and environmental protection. After feeding Staphylococcus epidermidis, the content of Staphylococcus epidermidis in the experimental group was significantly higher than that in the control group, proving that the amount of this bacterium in the intestine increased significantly after feeding, indicating that the feeding method was feasible. The feeding method through feed could significantly increase its relative content in fish, with the advantage of simple method. After the step of challenging with PPS, the content of Staphylococcus epidermidis in the bacteria - fed challenged group was significantly higher than that in the bacteria - fed non - challenged group, proving that in the co - existence with PPS, the amount of Staphylococcus epidermidis would increase, which was consistent with the experimental result that Staphylococcus epidermidis increased after the co - culture of two live bacteria in vitro experiments. After being challenged with PPS, its own relative content would also increase significantly, with the advantage of good stability.

[0095] When detecting the content of Pseudomonas plecoglossicida in each group after challenging with PPS, the content of Pseudomonas plecoglossicida in the bacteria - fed challenged group was significantly lower than that in the challenged control group, indicating that pre - feeding Staphylococcus epidermidis could significantly inhibit the growth of the pathogenic bacterium Pseudomonas plecoglossicida. This was consistent with the experimental result that the lysate of Staphylococcus epidermidis inhibited Pseudomonas plecoglossicida in vitro experiments.

[0096] Statistical analysis of the survival rates of each group in the in - vivo verification experiment showed that no fish died in the four groups five days before the challenge. No fish died in the non - challenged control group and the bacteria - fed non - challenged group throughout the experiment. Deaths started to occur in the challenged control group on the sixth day, and the mortality rate reached 100% on the 14th day. Deaths started to occur in the bacteria - fed challenged group on the seventh day. The overall survival rate was higher than that of the challenged control group, and the difference was significant. There was still 30.56% survival on the 14th day, proving that feeding Klebsiella oxytoca was significantly helpful for small yellow croakers to resist visceral white - spot disease caused by Pseudomonas plecoglossicida.

[0097] Example 3: Experimental analysis of the extracellular metabolites of Staphylococcus epidermidis against Pseudomonas plecoglossicida and Vibrio harveyi

[0098] 1 Experimental Design and Methods

[0099] To clarify the antibacterial ability of extracellular metabolites of Staphylococcus epidermidis against Pseudomonas piscicida and other pathogens such as Vibrio harveyi, Staphylococcus epidermidis was cultured overnight at 28 °C on TSA medium, diluted, and its OD value was measured at OD 600 , and the OD value was adjusted to OD 600 = 1 (the bacterial concentration was approximately 1×10 7 cfu / mL). After calculation, the concentration of Staphylococcus epidermidis was 1×10 12 cfu / mL. The bacterial solution was filtered through a 0.22 μm pore size sterile filter, and the collected filtrate was the extracellular metabolite mixture. The OD values of the Pseudomonas piscicida and Vibrio harveyi bacterial solutions cultured under the same conditions were measured at OD 600 . The bacterial solution was diluted to make the concentration of Pseudomonas piscicida reach 10 3 cfu / mL and the concentration of Vibrio harveyi bacterial solution reach 10 2 cfu / mL. 40 μL of the extracellular metabolites of Staphylococcus epidermidis was mixed with 20 μL of the diluted Pseudomonas piscicida solution, and a spreading rod was used to evenly coat it on the TSA solid medium and cultured overnight at 28 °C. At the same time, the metabolites of single strains and pathogens were coated separately for comparison.

[0100] 2. Experimental Results

[0101] After culturing, there were 480 colonies in 10 μL of Pseudomonas piscicida, and 300 colonies after mixing with 100 μL of the extracellular metabolites of Staphylococcus epidermidis, indicating a certain antibacterial ability, and the antibacterial efficiency was 37.5% (see 图7 ). Only 13 colonies appeared after culturing the mixture of 100 μL of the extracellular metabolites of Staphylococcus epidermidis and 20 μL of Vibrio harveyi bacterial solution ( 图8 ), and the antibacterial rate reached 89%.

[0102] 3. Discussion

[0103] The experiment proved that both live Staphylococcus epidermidis and its extracellular metabolites have inhibitory effects on Pseudomonas piscicida and Vibrio harveyi.

Claims

1. Staphylococcus epidermidis ( Staphylococcus epidermidis ), with the preservation number of CGMCC NO. 30987 and the preservation date of June 18, 2024.

2. Use of Staphylococcus epidermidis 2251 as claimed in claim 1 in the preparation of a biocontrol agent or feed for preventing and treating aquatic diseases, wherein the aquatic disease is the white spot disease of the viscera of small yellow croaker caused by Pseudomonas plecoglossicida.

3. The application according to claim 2, wherein The biocontrol agent or feed for preventing and treating aquatic diseases contains the cells of Staphylococcus epidermidis 2251.

4. A biocontrol agent or feed for preventing and treating aquatic diseases containing Staphylococcus epidermidis 2251 as claimed in claim 1, wherein the aquatic disease is the white spot disease of the viscera of small yellow croaker caused by Pseudomonas plecoglossicida.

5. The biocontrol preparation or feed for preventing and treating aquatic diseases according to claim 4, characterized in that, The biocontrol agent or feed contains the cells of Staphylococcus epidermidis 2251.

Images