Construction and Application of a Genetically Marked Live Vaccine Strain rMG7-L-V1291I against Newcastle Disease Virus Genotype VII

Abstract

The present invention discloses a genetically attenuated marker vaccine strain rMG7-L-V1291I of Newcastle disease virus genotype VII, with a preservation number of CGMCC No. 46291. The complete gene nucleotide sequence of this vaccine strain is shown as SEQ ID No: 1; among them, the 1291st amino acid valine (V) of the L protein is replaced by isoleucine (I). The present invention utilizes a reverse genetics operation platform for Newcastle disease virus, based on the Newcastle disease virus MG7 strain, mutates different sites, and rescues a genetically attenuated marker vaccine strain rMG7-L-V1291I of Newcastle disease virus genotype VII with low pathogenicity, good growth characteristics, high virus titer, stable passage ability, and excellent immunogenicity. This marker vaccine strain has good immunogenicity, can induce high levels of protective antibodies, achieve complete protection for immunized chickens, can be used for the prevention and control of currently prevalent Newcastle disease virus genotype VII, and lay a foundation for differentiating vaccine immunization and wild virus infection.

Description

Technical Field

[0001] The present invention relates to the field of pharmaceutical technology, and particularly to the construction and application of a genetically attenuated marker vaccine strain rMG7-L-V1291I of Newcastle disease virus genotype VII. Background Art

[0002] Newcastle disease is an acute and highly contagious disease of poultry caused by Newcastle disease virus (NDV), which has caused great economic losses to the poultry industry in China. Commonly used Newcastle disease vaccine strains mainly include LaSota strain and B1 strain, etc. These vaccine strains do not match the genotypes of the main epidemic strains in China. Although they can provide certain immune protection for chicken flocks, they cannot effectively reduce virus excretion, and are prone to cause atypical Newcastle disease symptoms in chicken flocks. Genetically attenuated vaccine strains of genotype VII NDV such as A-VII rDHN3-mF and KBNP-C4152R2L can be used to prevent and control epidemic chicken Newcastle disease and effectively reduce virus excretion in chicken flocks. Among them, A-VII strain has been widely used in the market as an inactivated vaccine, but there is currently no genetically attenuated marker vaccine of genotype VII Newcastle disease.

[0003] The growth performance of NDV is jointly regulated by multiple viral proteins, among which the receptor-binding domain of HN protein, the glycosylation site of F protein, and the functional domain of L protein all play key roles.

[0004] In the prior art, no genetically attenuated marker vaccine strain rMG7-L-V1291I of genotype VII Newcastle disease required to be protected by the present invention has been found. Summary of the Invention

[0005] Based on this, the present invention provides a genetically attenuated marker vaccine strain rMG7-L-V1291I of genotype VII Newcastle disease, and its preservation number is CGMCC No. 46291.

[0006] According to another aspect of the present invention, there is provided a genetically attenuated marker vaccine strain rMG7-L-V1291I of genotype VII Newcastle disease, and the full-genome nucleotide sequence of this vaccine strain is as shown in SEQ ID No: 1;

[0007] Among them, the 1291st amino acid valine (V) of the L protein is replaced by isoleucine (I).

[0008] Furthermore, the hemagglutination titer of this vaccine strain is about 9log2HA, and the virus titer is about 10 9.5 EID 50 / mL.

[0009] According to another aspect of the present invention, there is provided a construction method of the above-mentioned genetically attenuated marker vaccine strain rMG7-L-V1291I of genotype VII Newcastle disease, and this construction method includes the following steps:

[0010] (a) Using the pCAGGS-MG7-cDNA whole genome plasmid as a template, site-directed mutagenesis was performed on the differential amino acid sites of the structural proteins of the MG7 strain to obtain a mutant plasmid;

[0011] (b) The mutant plasmid was subjected to reverse genetic manipulation to construct the attenuated Newcastle disease virus type VII marker vaccine strain rMG7-L-V1291I.

[0012] Furthermore, in the pCAGGS-MG7-cDNA whole genome plasmid, the cleavage site of the F protein of the MG7 strain has been mutated to the cleavage site of the F protein of the La Sota strain, and 18 amino acids are deleted at positions 443-460 of the NP protein of the MG7 strain.

[0013] Furthermore, the upstream primer used for the site-directed mutagenesis is 5’-CAGAGTGTCGCCTTACATACACATATCCAATGATT-3’.

[0014] Furthermore, the downstream primer used for the site-directed mutagenesis is 5’-AATCATTGGATATGTGTATGTAAGGCGACACTCTG-3’.

[0015] Furthermore, the site-directed mutagenesis includes the following steps:

[0016] (1) PCR amplification: Amplify the DNA fragments upstream and downstream of the mutation site. After gel extraction of the upstream and downstream DNA fragments, mix them in equimolar amounts as a template to amplify the full-length DNA mutant fragment to obtain an amplification product;

[0017] (2) Ligation: Double digest the amplification product and the pCAGGS-MG7-cDNA whole genome plasmid, and gel extract to obtain the enzyme digestion product. Use T4 DNA ligase to ligate the enzyme digestion product in a metal bath to obtain a ligation product;

[0018] (3) Transformation: Transform the ligation product into DH5α competent cells, add LB liquid medium and culture for about 30 min, spread on an LB solid medium plate with ampicillin resistance, and culture for 12 hours; and

[0019] (4) Screening: Identify whether the MG7 mutant plasmid is successfully ligated, and screen to obtain the successfully ligated mutant plasmid.

[0020] Furthermore, the temperature of the metal bath is about 16 °C.

[0021] Furthermore, the LB solid medium is an LB solid medium with ampicillin resistance.

[0022] Furthermore, the temperature of the culture is about 37 °C.

[0023] Furthermore, the reverse genetic operation includes the following steps:

[0024] (i) Co-transfect the successfully ligated mutant plasmid and the helper plasmid into BHK-21 cells, culture them, perform freeze-thaw cycles, and filter through a filter to obtain a cell culture; and

[0025] (ii) Inoculate the cell culture into chicken embryos, incubate them, and collect the allantoic fluid of chicken embryos with positive hemagglutination test results to obtain the attenuated live marker vaccine strain rMG7-L-V1291I of Newcastle disease virus genotype VII.

[0026] Furthermore, the helper plasmid is pBSK-NP, pBSK-P, and pBSK-L.

[0027] Furthermore, the BHK-21 cells are BHK-21 cells pre-infected with recombinant vaccinia virus VVT7.

[0028] Furthermore, the multiplicity of infection of the recombinant vaccinia virus VVT7 is 0.001 - 0.1 MOI, for example, about 0.01 MOI.

[0029] Furthermore, the time of pre-infection is 0.5 - 1.5 h, for example, about 1 h.

[0030] Furthermore, the time of culture is 48 - 96 h, for example, about 72 h.

[0031] Furthermore, the temperature of culture is about 37 °C.

[0032] Furthermore, the culture container is a cell culture incubator containing 5% CO2.

[0033] Furthermore, the number of freeze-thaw cycles is 1 time.

[0034] Furthermore, the pore size of the filter is 0.22 μm.

[0035] Furthermore, the chicken embryos are 9 - 11-day-old SPF chicken embryos.

[0036] Furthermore, the time of incubation is 2 - 4 days, for example, about 3 days.

[0037] According to another aspect of the present invention, there is provided the use of the above attenuated live marker vaccine strain rMG7-L-V1291I of Newcastle disease virus genotype VII in the preparation of a vaccine.

[0038] Furthermore, the vaccine is a vaccine having a protective effect against Newcastle disease caused by genotype VII of Newcastle disease virus.

[0039] Furthermore, the vaccine is an avian vaccine.

[0040] Further, the poultry is a chicken.

[0041] Advantages of the present invention:

[0042] Using the reverse genetic operation platform of Newcastle disease virus, based on the Newcastle disease virus MG7 strain, mutations were made at different sites to rescue a weakly virulent strain rMG7-L-V1291I of genotype VII Newcastle disease virus marker vaccine with low pathogenicity, good growth characteristics, high virus titer, stable passage, and excellent immunogenicity. This marker vaccine strain has good immunogenicity, can induce high levels of protective antibodies, provides complete protection for immunized chickens, can be used to prevent and control the currently prevalent genotype VII Newcastle disease virus, and lays a foundation for differentiating vaccine immunity and wild virus infection. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following will briefly introduce the drawings required for the description of the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without exceeding the scope of protection required by the present invention.

[0044] Figure 1 It is a schematic diagram of the genetic stability analysis result of the rescued virus rMG7-F-N471A.

[0045] Figure 2 It is a schematic diagram of the genetic stability analysis result of the rescued virus rMG7-HN-G256E.

[0046] Figure 3 It is a schematic diagram of the genetic stability analysis result of the rescued virus rMG7-L-V1291I.

[0047] Figure 4 It is a schematic diagram of the detection results of HI antibody levels at different time points after immunizing SPF chickens with the live attenuated vaccine.

[0048] Figure 5 It is a schematic diagram of the survival rate results of each group of SPF chickens after immunization with the live attenuated vaccine and challenge. DETAILED DESCRIPTION OF THE INVENTION

[0049] The following will clearly and completely describe the technical solutions in the embodiments of the present invention with reference to the drawings in the embodiments of the present invention. Obviously, the described embodiments are some, but not all, of the embodiments of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts fall within the scope of protection of the present invention.

[0050] Unless otherwise indicated, all technical and scientific terms and abbreviations used herein have the meanings commonly understood by those of ordinary skill in the art of the present invention or in the field in which the term is applied. Although any methods, conditions, substances or materials similar to or equivalent to those disclosed herein may be used in the practice of the present invention, the preferred methods, conditions, substances or materials are described herein.

[0051] The present invention is expected to cover all alternatives, variations and equivalents, which may be included in the existing field of invention as defined by the claims. Those skilled in the art will recognize many methods and substances similar or equivalent to those described herein, which can be applied to the practice of the present invention. The present invention is in no way limited to the description of methods and substances.

[0052] The singular forms "a", "an" and "the" used in the specification and the appended claims include plural referents unless the context clearly dictates otherwise.

[0053] In the present invention, the term "comprising" is synonymous with "including". The terms "including", "comprising", "having", "containing" or any other variation thereof used herein are intended to cover non-exclusive inclusion. For example, a composition, step, method, article or device containing the listed elements need not be limited to those elements, but may include other elements not expressly listed or elements inherent to such composition, step, method, article or device.

[0054] As described in the background art section, the existing Newcastle disease virus vaccine strains do not match the genotypes of the main prevalent strains in China. Although they can provide certain immune protection for chicken flocks, they cannot effectively reduce virus excretion and are prone to causing the problem that chicken flocks show atypical Newcastle disease symptoms. To solve the above problems, the present invention provides a genotype VII Newcastle disease attenuated marker vaccine strain rMG7-L-V1291I, and its deposit number is CGMCC No. 46291.

[0055] The strain of the present invention was obtained by extensive screening by the inventors of the present invention. It was identified as a genotype VII Newcastle disease attenuated marker vaccine strain through morphological and phylogenetic analysis, and was named rMG7-L-V1291I. It was deposited at the General Microbiology Center of the China Microbial Culture Collection Center on November 20, 2024, and its deposit number is CGMCC No. 46291.

[0056] According to another aspect of the present invention, there is provided a genotype VII Newcastle disease attenuated marker vaccine strain rMG7-L-V1291I, and the full gene nucleotide sequence of the vaccine strain is as shown in SEQ ID No: 1;

[0057] Among them, the 1291st amino acid valine (V) of the L protein is replaced by isoleucine (I).

[0058] Among them, the full - gene nucleotide sequence SEQ ID No: 1 of this vaccine strain is shown as follows:

[0059] ACCAAACAGAGAATCTGTGAGGTACGATAAAAGGCGAAGAAGCAATCGAGATCGTACGGGTAGAAGGTGTGAATCCCGAGTGCGAGGCCGAAGCTCGAACCTGAGGGGACCTTCTACCGATATGTCGTCTGTTTTCGACGAGTACGAGCAGCTCCTCGCTGCTCAGACCCGCCCTAACGGAACTCATGGAGGGGGAGAGAAAGGGAGCACTTTAAAAGTTGAGGTCCCAGTATTCACCCTAAACAGTGATGATCCAGAGGATAGATGGAATTTTGCGGTATTCTGTCTTCGGATTGCTGTTAGCGAGGATGCCAACAAACCACTCAGGCAAGGTGCTCTTATATCCCTCTTATGCTCCCATTCTCAGGTGATGAGAAACCATGTTGCCCTTGCAGGGAAACAAAATGAGGCCACACTGGCTGTTCTTGAGATCGATGGTTTTGCTAACAGTGTGCCCCAGTTCAACAATAGGAGTGGAGTGTCTGAGGAAAGAGCACAGAGATTCATGGTAATCGCAGGATCTCTCCCTCGGGCGTGCAGCAACGGTACTCCGTTTGTCACGGCTGGGGTTGAAGATGATGCACCAGAAGATATCACTGACACTCTGGAAAG

[0060] AATCCTATCTATCCAAGTTCAGGTATGG

[0061] GTCACAGTAGCAAAGGCCATGACTGCATATGAGACAGCAGATGAGTCAGAAACAAGAAGAATAAATAAGTATATGCAGCAAGGTCGAGTTCAGAAGAAGTACATCCTTCATCCTGTATGCAGGAGTGCAATTCAACTCACAATCAGACATTCTCTGGCAGTCCGTATCTTCCTAGTTAGTGAGCTCAAGAGGGGCCGCAATACAGCAGGTGGGAGCTCTACATATTACAACTTGGTCGGGGATGTAGACTCATACATCAGGAACACCGGGCTTACTGCATTTTTCCTAACACTCAAATATGGAATCAATACCAAGACGTCAGCCCTCGCACTCAGCAGCCTCACAGGTGATATCCAAAAAATGAAACAGCTCATGCGTTTATATCGGATGAAAGGTGAAAATGCACCATACATGACATTGTTAGGTGACAGTGACCAGATGAGCTTTGCACCTGCTGAGTATGCACAACTTTATTCTTTTGCCATGGGCATGGCATCAGTCTTAGATAAGGGAACTGGCAAGTACCAATTCGCCAGGGACTTTATGAGCACATCATTCTGGAGACTTGGAGTAGAGTATGCTCAGGCCCAGGGAAGTAGCATTAATGAGGACATGG

[0062] CTGCTGAGCTAAAACTAACCCCGG

[0063] CAGCAAGGAGAGGCCTGGCAGCTGCTGCCCAACGAGTATCCGAAGAAATCGGCAGCATGGACATTCCCACTCAACAGGCGGGAGTCCTCACCGGGCTCAGTGATGAAGGCCCCCGAACTCCACAGGGCAGATCAAACAAGCCGCAAGGGCAACCAGATGCTGGGGATGCGCCAAATCCTGTACAGAGCACCACCCATCCAGAGCCTCCCCCAACCCCTGGGGCATCCCAAGACAACGACACTGACTGGGGGTACTGATCGACAACACCCAGCCTGCCTTCACAGGATCACACCAAACCCTCCGACCAAAACCCTCCCACACTCCCTGACCCACAACCCCGCACGACCACACCAACAAAAGCTCCCCCCCACCCTCTCCCCCACTCCCAGCCACACGATCCCGCCCACCCGGGACAACACAGGCACAGCTCAGTTCGTCGACAATCCGCCCAGAGCCCAAGGTATTAGAAAAAAATACGGGTAGAAGAGAGACATCCAGAGACCAGGACGAGTCACCAAGTTCTCTGTTCTCCCTTCTACCCAGTGAATTAGGGTGAAG

[0064] AT

[0065] GGCCACTTTTACAGATGCGGAGATAGATGACATATTTGAGACCAGTGGGACTGTCATTGACAGCATAATTACGGCCCAGGGCAAATCAGCTGAGACCGTTGGAAGAAGTGCGATCCCGCAGGGCAAGACCAAAGCTCTAAGCACAGCATGGGAGAAGCACGGGAGTATCCAGCCACACGCCAGTCAGGACGCCCCTGACCAACAAGACAGAATAGAAAAACAGCCATCCACACCTGAGCAGGCGACTCTACACAACAATCCGCCGATCGCATCCACTGAACCGCCTCCCACTCAGGCCGCAAGCGAGACCAGCGACACACAGCTCAAGACTGGGGCAAGCAACTCCCTTCTGTCCATGCTCGACAAACTGAGTAATAAATCGTCCAATGCTAAAAAGGGCCCATGGTCGGGATCCCAAGAAGGGCATCACCAACCTCCGGCCCAACAACATGGGAACCAGCCG

[0066] AGCTATGGAAGCAACCA

[0067] GGGAAGACCGCAGCATCAGGCCAAGGCCGTCCCTGGAAACCGGGGCACAGACGAGAACACAGCATATCATGGACAGCGGAAGGAGTCACAACCATCAGCTGGTGCAACCCCTCATGCGCCCCAGTCAGGGCAGAGCCAAGACAATACTCCTGCACCTGTGGATCGTGTCCAGCTACCTGCCGACTTTGTGCAGGCGATGATGTCTATGATGGAGGCATTATCACAGAAGGTAAGTAAAGTTGATCATCAGCTGGACCTAGTCTTGAAACAGACATCCTCCATTCCTATGATGCGATCTGAAATCCAACAGCTCAAGACATCTGTTGCGATCATGGAAGCTAACTTAGGCATGATGAAAATTCTGGACCCTGGTTGTGCTAATGTTTCATCCTTAAGTGATCTCCGGGCAGTAGCCCGATCCCATCCAGTCCTAGTTTCAGGCCCTGGAGACCCATCTCCTTACGTGACACAAGGGGGTGAAATGACGCTCAATAAACTCTCACAACCGGTGCAGCACCCCTCTGAATTGATTAAGTCTGCCACTGCAAGCGGGCCTGACATGGGAGTGGAGAAGGACACTGTCCGCGCATTAATCACCTCGCGCCCGATGCAT

[0068] CCAAGCTCCTCGGCTAAGCTCCTGAGC

[0069] AAGCTAGATGCAGCCAGGTCAATTGAAGAGATCAGGAAGATCAAACGCCTTGCGCTGAATGGTTGATGGCCATCACAACTCATAACAGGCTCCCGTCACTTTAGCGTCACACGGAATCCCTCGGGGGCCCTCCCTCGCAAATCTATGCTTCAACACCCAAAACAACAGCCCTCTCTCACCCCCCCCAATCCCTCGAATGACCGCACAACTGCAACCAATCCAGCAGCATTAGAAATTAAGAAAAAATACGGGTAGAATCAAAGTGCCTTGATTGCACCAAAATGGACTCATCCAGGACAATTGGGCTGTACTTTGATTCTGCCCTCCCTTCCAGCAGCCTGTTAGCATTTCCGATTGTCTTACAAGACACGGGAGACGGGAAGAAGCAAATCACCCCACAATACAGGATCCAGCGTCTTGATTCGTGGACAGACAGTAAGGAAGACTCGGTATTCATCACCACCTACGGGTTCATCTTTCAAATTGGGAATGAAGAAACCACCGTCGGTGTGATCAATG

[0070] ACAATCCCAGGCACGAGCTACTCTCTTCCGCAATGCTCTGC

[0071] TTAGGGAGTGTCCCGAACGACGGAGATCTTGTTGAGCTGGCGAGAGCCTGCCTCACCATGGTGGTAACTTGCAAAAAGAGTGCAACTAACACTGAGAGAATAGTCTTTTCAGTAGTGCAGGCTCCTCGGGTGCTGCAAAGCTGTATGGTTGTGGCAAATAGGTACTCATCAGTGAATGCAGTGAAGCATGTGAAGGCGCCAGAAAAGATCCCTGGGAGCGGAACCCTAGAGTA

[0072] TAAAGTG

[0073] AATTTTGTCTCTTTGACCGTGGTGCCAAGAAGGGATGTCTACAGGATCCCAACTGCAGTATTGAAAGTGTCTGGCTCAAGCCTGTACAATCTTGCGCTCAATGTCACTATTGATGTGGACGTGGATCCGAAGAGCCCGTTAGTCAAATCCCTTTCCAAGTCCGATAGCGGATACTATGCGAATCTTTTTCTGCATATCGGGCTTATGTCCACTGTAGATAAGAAGGGAAAGAAAGTGACATTTGACAAGATAGAGGAAAAGATAAGGAGACTCAATCTATCCGTCGGGCTCAGTGATGTGCTCGGACCCTCTGTGCTTGTGAAGGCGAGAGGTGCACGGACTAAGCTACTTGCTCCTTTTTTCTCTAGCAGTGGGACAGCCTGCTATCCTATAGCAAATGCCTCTCCCCAGGTTGCCAAGATACTCTGGAGCCAAACTGCGCACCTGCGGAGTGTGAAAGTCATCATTCAAGCC

[0074] GGCACT

[0075] CAGCGTGCTGTCGCAGTGACCGCTGATCATGAGGTAACCTCCACTAAGATAGAGAGGAGGCATGCCATTGCTAAATACAATCCTTTCAGGAAATAAGTTGCATCCCTAAGACTGCAGTTCACCTGCTTTCCCGAATCACCATTACACCAGACAATGATCCATCTCGACTGCTTATAGTTAGTTCACCTGTCTAGCAAATTAGAAAAAACACGGGTAGAAGAGTCTGGATCCCGACCGGCACACTCAGGACGCAACATGGGCTCCAAACCTTCTACCAGGATCCCAGCACCTCTGATGCTGGTCACCCGGATTATGCTGATATTGGGCTGTATTCGTTCGACAAGCTCTCTTGACGGCAGGCCTCTTGCAGCTGCAGGAATTGTAGTAACAGGAGATAAGGCAGTCAATGTATACACCTCGTCTCAGACAGGGTCAATCATAGTCAAGTTGCTCCCGAATATGCCCAGGGATAAGGAGGCGTGTGCGAAAGCCCCATTAGAGGCATATAACAGAACACTGACTA

[0076] CTTTGCTCACTCCTCTTGGCGACTCCATCCGCAAGAT

[0077] TCAAGGGTCTGTGTCCACGTCTGGAGGAGGGAGACAGGGGCGCCTTATAGGTGCTGTTATTGGCAGTGTAGCTCTTGGGGTTGCAACAGCGGCACAGATAACAGCAGCTGCGGCCCTAATACAAGCCAACAAGAATGCTGCCAACATCCTTCGGCTTAAGGAGAGCATTGCTGCAACCAATGAAGCTGTGCATGAAGTCACCGACGGATTATCACAACTATCAGTGGCAGTTGGGAAGATGCAGCAGTTTGTCAATGACCAGTTTAATAATACGGCGCGAGAATTGGACTGTATAAAAATCACACAACAGGTTGGTGTAGAACTCAACCTATACCTAACTGAATTGACTACAGTATTCGGGCCACAGATCACCTCTCCTGCATTAACTCAGCTGACCATCCAGGCACTTTATAATTTAGCTGGTGGCAATATGGATTACTTATTAACTAAGTTAGGTATAGGGAACAATCAAC

[0078] TCAGCTC

[0079] ATTAATTGGTAGCGGCCTGATCACTGGTTACCCTATACTGTATGACTCACAGACTCAACTCTTGGGCATACAAGTGAATTTGCCCTCAGTCGGGAACTTAAATAATATGCGTGCCACCTATTTGGAGACCTTATCTGTAAGTACAACCAAAGGATATGCCTCAGCACTTGTCCCGAAAGTAGTGACACAAGTCGGTTCTGTGATAGAAGAGCTTGACACCTCATACTGTATAGAGTCCGATCTGGATTTATATTGTACTAGAATAGTGACATTCCCCATGTCCCCAGGTATTTATTCCTGTTTGAGCGGCAACACATCAGCTTGCATGTATTCAAAGACTGAAGGCGCACTCACTACGCCGTATATGGCCCTTAAAGGCTCAGTTATTGCCAATTGTAAGATAACAACATGTAGATGTACAGACCCTCCTGGTATCATATCGCAAAATTATGGAGAAGCTGTATCCCTGATAGATAGACATTCGTGCAATGTCTTATCATTAGACGGGATAACTCTGAGGCTCAGCGGAGAATTTGATGCAACTTATCAAAAGAACATCTCAATACTAGATTCTCAAGTCATCGTGACAGGCAATCTTGATATATCAACTGAACTTGGAAACG

[0080] TCAACAATTCAATCAGC

[0081] AATGCCTTGGATAAGTTGGCAGAAAGCAACAGTAAGATAGAAAAAGTCAATGTCAGATTAACCAGCACATCTGCTCTCATTACCTATATTGTTCTAACTGTCATTTCTCTATTTTTCGGTGCACTTAGTCTGGGTTTAGCGTGTTACCTGATGTACAAACAGAAGGCACAACAAAAGACCTTGCTATGGCTTGGGAATAATGCCCTTGATCAGATGAGAGCCACTACAAGAGCATGAATGCAGATAAGAGGTGGATATATACCCAACAGCAGCCTGTGTGTCAATTCCGATAATCTGTCAAGTAGAAGACTTAAGAAAAAACTACTGGGAACAAGCAACCAAAGAGCAATACACGGGTAGAACGGTCAGAGGAGCCACCCTTCAATCGGAAATTAGGCTTCACAACATCCGTTCTACCACATCACCATCAACAAGAGTCAATCATGGACCGCGCGGTTAACAGAGTCGTGCTGGAGAATGAGGAAAGAGAAGCAAAGAACACATGGCGCCTGGTTTTC

[0082] CGGATCGCAGTCTTACTTTTAATGGTAATGACTCTAGCTATC

[0083] TCCGCAGCTGCCCTGGCATACAGTATGGAGGCCAGTACGCCGCACGACCTTGCAGGCATATCGACTGTGATCTCTAAGACAGAAGATAAGGTTACGTCTTTACTCAGTTCGAGTCAAGATGTGATAGATAGGATATACAAGCAGGTGGCTCTTGAATCCCCGCTGGCGCTACTAAACACTGAATCTACAATTATGAATGCAATAACCTCTCTTTCTTATCAAATTAACGGGGCTGCGAACAATAGCGGATGTGGGGCGCCTGTTCATGACCCAGATTATATCGGGGGGATAGGCAAAGAACTCATAGTGGACGACATCAGTGATGTCACATCATTTTATCCTTCTGCATATCAAGAACACCTGAATTTCATCCCGGCGCCTACTACAGGATCCGGTTGCACTCGGATACCCTCATTTGACATGAGCACCACCCATTATTGTTATACTCACAATGTAATACTATCCGGTTGCAGAGATCACTCACACTCACATCAATACTTAGCGCTTGGTGTGCTTCGGACATCTG

[0084] CAACAGGGAGGGTATTCTTCTCTACTCTGCGCTC

[0085] CATCAATTTAGATGACACCCAAAATCGGAAGTCCTGCAGTGTGAGTGCAACCCCTTTAGGTTGTGATATGCTGTGCTCTAAGGTCACAGGGACTGAAGAGGAGGATTACAAGTCAGCTGCCCCAACATCAATGGTGCACGGAAGGCTAGGGTTTGACGGTCAATACCATGAGAAGGACTTAGACACCACGGTCTTATTTAAGGATTGGGTGGCAAATTACCCAGGAGTGGGAGGAGGGTCTTTTATTGACGACCGTGTATGGTTCCCAGTTTACGGAGGGCTCAAACCCAATTCACCCAGTGACACTGCACAAGAAGGGAAATATGTAATATACAAGCGCCATAACAACACATGCCCCGATGGACAAGATTACCAA

[0086] ATTCGGATGGCTAAATCTTCATAT

[0087] AAACCCGGGCGATTTGGTGGAAAGCGCGTACAGCAAGCCATATTATCCATCAAAGTGTCAACATCCTTGGGTAAGGACCCGGTGCTGACTATTCCACCTAATACAATCACACTCATGGGAGCCGAAGGCAGAATCCTCACAGTAGGGACATCTCACTTCTTGTACCAACGAGGGTCTTCATATTTCTCCCCTGCCTTATTATATCCCATGACAGTAAATAACAAAACGGCTACACTCCATAGTCCTTATACGTTTAATGCTTTCACTCGGCCAGGTAGCGTCCCTTGCCAGGCATCAGCAAGATGCCCCAACTCATGCATCACTGGGGTCTATACTGATCCATATCCCTTAATCTTCCATAGGAATCATACTCTACGAGGGGTCTTTGGGACGATGCTTGATGATGAACAAGCGAGACTTAACCCCGTATCTGCAGTATTCGACAACATATCCCGCAGTCGTGTCACCCGGGTGAGTT

[0088] CA

[0089] AGCAGCACCAAGGCAGCATACACGACATCGACATGTTTTAAAGTTGTCAAGACCAATAAAGCTTATTGTCTTAGTATTGCAGAGATATCCAATACCCTATTCGGGGAATTTAGGATCGTTCCCTTATTAGTTGAGATCCTCAAGGATGATAGAGTTTAAGAAGCTAGACTTGGCCGATTGAGCCAATCATAGGATGGTTGGGAAGACGACACCACATCAATCATCTCCCACAATGCTTAGAGTCAATCTGAATATTAACATAAGCCAGGATCCCATGTTGTTGGGCAGCCACAATCAGACAATACTGACATGATCATTCTGAGTCCTGCCCACTATCACCTTATTAAGAAAAAATACAAAAAGCATTGAGATATAAGGGGAAACAACCAACAAGAGGGAACACGGGTAGGACATGGCGGGCTCCGGTCCCGAAAGGGCAGAGCACCAGATCATCCTACCAGAGTCACATCTATCC

[0090] TCTCC

[0091] ATTGGTCAAGCACAAATTGCTATACTACTGGAAATTGACTGGGCTACCGCTTCCTGATGAATGCGACTTTGATCATCTCATTATCAGCAGGCAATGGAAGAGAATACTGGAGTCGGCCACTCCTGACACAGAGAGAATGATAAAACTCGGGCGGGCAGTGCACCAGACTCTCAACCACAACTCCAAGATAACCGGAGTGCTCCATCCCAGGTGTTTAGAAGAACTGGCTAGTATTGAGGTCCCAGATTCAACTAACAAATTCCGGAAGATTGAAAAGAAGATCCAGATTCACAACACAAGGTATGGAGACCTGTTCACAAAGCTGTGCACGCATGTTGAGAAGAAATTGCTAGGATCATCCCGGTCTAATAATGTCCCACGATCAGAGGAATTCAGTAGCATCCGTACAGATCCGGCATTCTGGTTTCACTCAAAATGGTCCAGAGCTAAGTTCGCGTGGCTCCATATAAAACAAGTCCAAAGGCATCTGATTGTAGCAGCAAGGACAAGGTCTGCAGT

[0092] CAACAAGTTAGTAACATTAAGTCATAAGATAGGCCACGTCT

[0093] TTGTTACTCCTGAGCTTGTCATTGTGACACATACAGACGAGAACA

[0094] AGTTCACATGCCTCACCCAGGAACTTGTATTGATG

[0095] TATGCGGATATGATGGAAGGCAGGGACATGGTCAATATAATATCTT

[0096] CTACAGCAGCACATCTCAGAAACCTATCCGAGAA

[0097] AATTGACGATATTCTGCGGTTAGTAGATGCCCTGGCAAAGGACTT

[0098] AGGTAATCAAGTCTATGACGTTGTAGCATTAATGG

[0099] AGGGATTCGCATACGGTGCTGTTCAGCTGCTTGAGCCATCAGGTA

[0100] CATTTGCAGGAGATTTCTTTGCATTTAACCTACAG

[0101] GAGCTCAAAGACACTTTAATCGAACTTCTCCCAAATAATATAGCG

[0102] GAATCAGTAACTCACGCTATTGCCGCTGTATTCTC

[0103] CGGTTTAGAACAGAATCAAGCAGCTGAGATGTTGTGCTTGCTAC

[0104] GTTTGTGGGGTCATCCTTTGCTTGAGTCTCGTAGTG

[0105] CAGCAAGAGCAGTCAGGAGCCAGATGTGTGCACCGAAGATGGT

[0106] AGACTTCGATATGATCCTCCAGGTACTATCTTTCTTT

[0107] AAAGGAACAATCATCAATGGATACAGAAAGAAGAATTCAGGTGT

[0108] GTGGCCGCGTGTCAAAGTAGATACAATATACGGGAA

[0109] TATCATTGGGCAGCTGTATGCTGATTCAGCAGAGATCTCACATGAT

[0110] GTCATGTTGAAGGAGTACAAGAGTTTATCTGCTT

[0111] TTGAATTTGAGCCATGTATAGACTATGACCCTGTTACCAATCTAAG

[0112] CATGTTCCTAAAAGACAAGGCAATCGCACATCCT

[0113] AGTGATAATTGGCTCGCCTCATTTAGGCGGAACCTACTCTCTGAG

[0114] GACCAGAAGAAACAGATAAAAGAGGCAACTTCAAC

[0115] TAACCGCCTCTTGATAGAGTTCTTAGAATCAAATGATTTTGATCCA

[0116] TATAAAGAAATGGAATACCTGACAACCCTCGAGT

[0117] ACCTAAGAGGTGACAGTGTGGCAGTATCGTACTCACTCAAAGAG

[0118] AAAGAGGTAAAAGTGAATGGGCGGATTTTTGCTAAG

[0119] TTAACAAAGAAACTAAGGAACTGCCAGGTAATGGCAGAAGGAAT

[0120] TCTAGCTGACCAGATTGCACCTTTCTTTCAGGGAAA

[0121] TGGGGTCATTCAAGATAGCATATCCTTGACAAAGAGTATGTTAGC

[0122] GATGAGTCAACTGTCCTTTAACAGCAATAAGAAAC

[0123] GTATCACTGACTGCAAAGAGAGGGTTTCCTCGAACCGCAATCAT

[0124] GATCAGAAGAGCAAGAATCGTAGAAGAGTTGCCACT

[0125] TTTATCACGACTGACCTACAAAAGTATTGTCTTAACTGGAGATATC

[0126] AGACAGTCAAACTATTCGCCCATGCTATCAATCA

[0127] GCTGATGGGCCTACCTCATTTCTTCGAGTGGATTCATCTTAGGCTG

[0128] ATGGACACTACAATGTTTGTAGGGGATCCTTTCA

[0129] ATCCTCCAAGTGACCCGACTGACTGTGATCTATCAAGAGTCCCAA

[0130] ACGATGACATATATATTGTCAGTGCTAGAGGGGGC

[0131] ATTGAGGGACTCTGCCAGAAGCTATGGACGATGATCTCAATTGCT

[0132] GCAATCCAACTTGCTGCAGCAAGATCTCATTGTCG

[0133] AGTTGCCTGCATGGTACAAGGTGACAATCAAGTAATGGCTGTAA

[0134] CGAGAGAGGTAAGATCAGATGATTCCCCGGATATGG

[0135] TGTTGACGCAGTTGCATCAAGCTAGTGATAATTTCTTCAAGGAAT

[0136] TGATTCATGTCAATCATTTGATTGGCCATAATCTG

[0137] AAGGATCGTGAAACCATTAGATCAGACACATTCTTCATATACAGC

[0138] AAACGAATATTCAAGGATGGAGCAATACTCAGTCA

[0139] GGTCCTCAAAAATTCATCTAAATTGGTGCTAATATCAGGCGACCTT

[0140] AGCGAAAACACTGTAATGTCCTGTGCCAACATTG

[0141] CATCCACTGTAGCACGACTATGTGAGAATGGGCTTCCAAAGGATT

[0142] TCTGTTACTATTTGAACTACCTAATGAGTTGTGTG

[0143] CAGACATACTTTGATTCGGAGTTCTCTATTACCCACAGCTCGCAA

[0144] TCAGATTCCAACCAGTCCTGGATCGAGGATATCTC

[0145] TTTCGTACACTCATACGTGTTAACCCCTGCCCAGCTGGGGGGACT

[0146] GAGCAACCTTCAATACTCAAGGCTCTACACAAGGA

[0147] ATATTGGTGACCCAGGGACCACTGCTTTCGCAGAGGTCAAGCGA

[0148] CTGGAAGCAGTGGGGTTGCTGAGTCCCAGCATCATG

[0149] ACTAACATCTTAACCAGGCCACCTGGCAATGGAGACTGGGCCAG

[0150] CCTATGCAACGACCCATACTCTTTTAATTTTGAAAC

[0151] TGTTGCAAGCCCAAATATTGTCCTCAAGAAACATACACAGAAAG

[0152] TCCTATTTGAGACATGTTCAAACCCCTTATTATCCG

[0153] GGGTACATACAGAGGACAATGAGGCAGAGGAGAAAGCATTGGC

[0154] TGAATTCTTACTCAATCAAGAAGTGATTCACCCACGT

[0155] GTCGCACATGCTATCATGGAAGCAAGCTCTGTGGGTAGGAGAAA

[0156] GCAAATTCAAGGGCTTGTTGACACAACGAACACTGT

[0157] GATTAAGATTGCACTGACTAGGAGGCCCCTCGGTATCAAAAGGC

[0158] TGATGCGGATAATCAATTACTCGAGCATGCATGCAA

[0159] TGTTGTTCAGAGATGATATTTTCTTATCCAATAGATCCAACCACCC

[0160] ATTAGTTTCTTCCAATATGTGCTCGCTGACGCTA

[0161] GCAGATTATGCCCGAAACAGAAGCTGGTCACCTCTGACAGGGGG

[0162] CAGGAAAATACTGGGTGTATCCAACCCTGATACCAT

[0163] AGAACTTGTGGAGGGAGAGATTCTCAGCGTCAGTGGAGGGTGC

[0164] ACAAAATGTGACAGCGGAGATGAGCAGTTTACTTGGT

[0165] TCCATCTTCCAAGCAATATAGAGCTGACTGATGACACCAGAAAA

[0166] AATCCCCCGATGAGAGTGCCATATCTTGGGTCGAAG

[0167] ACTCAAGAGAGGAGAGCTGCCTCGCTTGCGAAAATAGCCCACAT

[0168] GTCACCACATGTGAAAGCAGCACTAAGGGCATCATC

[0169] CGTGTTAATCTGGGCTTATGGGGACAACGAAGTGAACTGGACTG

[0170] CTGCTCTTAATATTGCAAGGTCTCGATGCAACATAA

[0171] GCTCAGAGTACCTTCGGCTATTGTCACCCCTGCCCACGGCTGGGA

[0172] ATCTCCAACATAGATTGGATGATGGCATAACCCAG [[ID=*41]]

[0173] ATGACATTTACCCCTGCATCTCTCTACAGAGTGTCGCCTTACataCA

[0174] It should be noted that there seems to be a lowercase "a" in the sequence at the end of line 42 which might be an error in the original. If this is a special case or a known deviation, it's left as is during translation.CATATCCAATGATTCTCAAAGGCTATTCACCGA

[0175] AGAAGGGGTCAAAGAGGGAAACGTGGTTTACCAACAAATTATGC

[0176] TCTTGGGTTTATCCCTAATTGAATCACTCTTCCCAA

[0177] TGACAGCAACCAGAACATATGATGAGATCACATTACACCTCCACA

[0178] GTAAATTTAGCTGCTGTATCCGAGAAGCGCCTGTT

[0179] GCGGTTCCCTTCGAGCTCCTCGGGCTGGCACCGGAATTAAGAAT

[0180] GGTAACCTCAAATAAGTTCATGTATGATCCTAGCCC

[0181] TATATCAGAGAGAGATTTCGCGAGACTTGACTTAGCTATCTTCAA

[0182] GAGTTACGAGCTTAATTTGGAATCATATTCCACGC

[0183] TGGAGCTAATGAACATTCTTTCAATATCTAGCGGGAAGTTGATTG

[0184] GCCAATCTGTGGTTTCTTATGATGAAGACACCTCT

[0185] ATAAAGAATGATGCTATAATAGTGTATGACAACACACGAAATTGG

[0186] ATTAGTGAGGCGCAGAACTCAGATGTGGTCCGCTT

[0187] GTTTGAGTATGCAGCACTCGAAGTGCTTCTTGACTGTGCTTATCA

[0188] ACTCTACTATCTGAGGGTAAGGGGTCTAAACAACA

[0189] TCGTCCTATACATGAATGACTTATATAAGAACATGCCAGGGATCCT

[0190] ACTCTCCAATATTGCGGCCACGATATCCCACCCC

[0191] ATCATTCACTCAAGGTTGAATGCAGTAGGCCTAATTAACCATGAC

[0192] GGGTCACACCAGCTCGCAGATATAGACTTCGTCGA

[0193] GGTGTCTGCAAAATTGTTAGTCTCTTGCACTCGACGCGTGGTCTC

[0194] AGGCTTATATGCAGGGAATAAGTACGATCTGCTGT

[0195] TCCCATCTGTCTTAGATGATAACCTGAATGAGAAGATGCTCCAAC

[0196] TGATTTCCCGGTTATGCTGTCTGTACACAGTGCTC

[0197] TTTGCTACAACAAGAGAAATCCCAAAAATAAGGGGCCTATCAGC

[0198] AGAAGAGAAATGCTCAATACTCACTGAGTATCTACT

[0199] GTCAGATGCTGTAAAACCATTGCTTAGGCCCGAACAAGTGAATTC

[0200] TATCATGTCTCCCAACATAATCACGTTCCCAGCCA

[0201] ATCTATATTACATGTCTAGGAAGAGCCTTAATTTGATCAGAGAACG

[0202] AGAGGACAGAGATACTATCTTGTCATTGTTGTTC

[0203] CCTCAGGAACCACTGCTTGAGCTTCGCCCAGTACGGGACATTGG

[0204] TGCTCGAGTGAAAGACCCGTTTACCCGGCAACCCGC

[0205] ATCATTCATACAAGAGCTAGATCTGAGTGCCCCAGCAAGGTACGA

[0206] CGCATTTACACTGAGTAAGGCCTGCTTCGAGCATA

[0207] CATTACCGAACCCAAAGGAGGATTACCTAGTACGGTACTTGTTCA

[0208] GAGGAATAGGGACTGCTTCATCTTCTTGGTATAAG

[0209] GCATCTCATCTTCTATCCGTACCTGAGGTCAGGTGTGCAAGACAT

[0210] GGGAACTCCTTATACTTAGCGGAAGGAAGCGGAGC

[0211] CATCATGAGTCTTCTTGAATTGCATATACCACATGAGACTATCTATT

[0212] ACAATACACTTTTCTCGAATGAGATGAACCCTC

[0213] CACAGCGACATTTCGGACCTACACCAACACAGTTTCTAAACTCG

[0214] GTCGTTTATAGGAATCTACAAGCGGAAGTGCCATGT

[0215] AAAGATGGATATGTCCAGGAGTTCTGCCCATTATGGAGAGAGAAT

[0216] GCAGAAGAAAGTGACCTGACCTCAGATAAAGCAGT

[0217] TGGATATATCACATCCGTGGTACCCTACAGGTCTGTATCATTACTA

[0218] CATTGTGACATTGAGATTCCTCCAGGGTCCAATC

[0219] AAAGCTTATTAGATCAACTGGCTACTAATTTATCCCTGATTGCCAT

[0220] GCATTCTGTGAGGGAGGGCGGGGTAGTGATCATC

[0221] AAAGTACTGTATGCAATGGGGTACTACTTCCATTTACTCATGAATT

[0222] TATTCACTCCATGTTCCACAAAAGGATATATACT

[0223] CTCCAATGGCTATGCCTGTAGAGGGGATATGGAGTGTTACCTGAT

[0224] ATTCGTTATGGGCTACTTGGGCGGGCCCACCTTCG

[0225] TGCACGAAGTGGTAAGGATGGCAAAAACTCTAATACAACGACAC

[0226] GGTACACTCCTATCTAAATCAGATGAAATTACATTG

[0227] ACTAAGCTATTTACCTCACAGCAGCGTCATGTAACAGATATCCTAT

[0228] CCAGTCCTTTACCGAAGCTAATGAAGCTCTTGAG

[0229] AGAAAATATTGATGCCGCACTAATTGAAGCTGGGGGACAGCCCG

[0230] TCCGTCCATTCTGTGCGGAAAGTTTGGTGAGCACAC

[0231] TAACAGATATGACTCAGACAGCTCAGATCATTGCCAGCCACATTG

[0232] ACACAGTCATTCGGTCTGTAATTTACATGGAGGCT

[0233] GAGGGTGACCTCGCCGACACAGTGTTCTTATTTACTCCTTACAAT

[0234] CTATCCACAGACGGTAAAAGGAGAACATCACTTAA

[0235] GCAGTGCACCAAACAGATCTTGGAAGTCACAATACTGGGTCTCA

[0236] GAGCCAAAGATATCAATAAAGTAGGTGATGTAATCA

[0237] GTTTAGTACTCAGAGGTGCGGTTTCTCTAGAGGACCTCATCCCAT

[0238] TAAGGACATACCTGAAGCGCAGTACCTGCACTAAA

[0239] TACCTGAAAGCGGTCCTAGGTATTACTAAACTCAAAGAAATGTTC

[0240] ACAGATACCTCATTACTGTACTTGACTCGTGCTCA

[0241] ACAAAAATTCTACATGAAAACCATAGGTAATGCTGCCAAGGGATA

[0242] TTACTGTAATAATGACTCTTAAAGGCAATCGTACG

[0243] CCAATCAGTTATCTTCCTAACTGATGACTCCCTCATTGACTCAATT

[0244] ATACCAGATTAGAAAAAAGTTAAATTCCGACTCT

[0245] TTGGAACTCGTATTCGGATTCAGTTAGTTAACTTTAAGCAAGAGTGCGCAAAGTCATCCCTAATTATAGTGATGTCATTC

[0246] ACCAAATCTCTGTTTGGT。

[0247] To further optimize the growth performance of the attenuated marker vaccine against Newcastle disease virus genotype VII (MG7 strain), the present invention screened out the differential sites by comparing the amino acid sequences of the key regions of the F, HN, and L proteins between the MG7 strain and the La Sota strain with good growth performance, and rescued the MG7 mutant virus. By measuring the hemagglutination (HA) titer and virus growth titer of the rescued virus, a mutant virus with significantly better growth performance than the MG7 strain was finally screened out and named rMG7-L-V1291I, with an HA titer of 1:512 and a virus titer of approximately 10 9.5 EID 50 / mL. The results of genetic stability tests and virus virulence determinations showed that this MG7 mutant virus had good genetic stability and was an attenuated strain (the average lethal time of chicken embryos ≥ 120 h, and the intracerebral pathogenicity index of 1-day-old chickens ≤ 0.7). This attenuated vaccine can effectively prevent Newcastle disease virus genotype VII prevalent in China, and can effectively distinguish vaccinated poultry from virus-infected poultry, laying a foundation for the research and development of the attenuated marker vaccine against Newcastle disease virus genotype VII.

[0248] In a preferred embodiment, the hemagglutination titer of this vaccine strain is approximately 9 log2HA, and the virus titer is approximately 10 9.5 EID 50 / mL.

[0249] In the present invention, "about" refers to a value within the range of ±5% of a specific value. For example, "about 9" includes ±5% of 9, or from 8.55 to 9.45; "about 10 9.5 " includes ±5% of 10 9.5 , or from 0.95×10 9.5 to 1.05×10 9.5 .

[0250] According to another aspect of the present invention, there is provided a method for constructing the above-mentioned attenuated marker vaccine strain rMG7-L-V1291I against Newcastle disease virus genotype VII, and this construction method includes the following steps:

[0251] (a) Using the pCAGGS-MG7-cDNA whole-genome plasmid as a template, site-directed mutagenesis was performed on the differential amino acid sites of the structural proteins of the MG7 strain to obtain a mutant plasmid;

[0252] (b) Performing reverse genetic manipulation on this mutant plasmid to construct the attenuated marker vaccine strain rMG7-L-V1291I against Newcastle disease virus genotype VII.

[0253] In a preferred embodiment, in this pCAGGS-MG7-cDNA whole-genome plasmid, the cleavage site of the F protein of the MG7 strain has been mutated to the cleavage site of the F protein of the La Sota strain, and 18 amino acids are deleted at positions 443-460 of the NP protein of the MG7 strain.

[0254] In a preferred embodiment, the upstream primer used for the site-directed mutagenesis is 5'-CAGAGTGTCGCCTTACATACACATATCCAATGATT-3'.

[0255] In a preferred embodiment, the downstream primer used for the site-directed mutagenesis is 5'-AATCATTGGATATGTGTATGTAAGGCGACACTCTG-3'.

[0256] In a preferred embodiment, the site-directed mutagenesis comprises the following steps:

[0257] (1) PCR amplification: Amplify the DNA fragments upstream and downstream of the mutation site. After gel extraction of the upstream and downstream DNA fragments, mix them in equimolar amounts as a template to amplify the full-length DNA mutation fragment to obtain an amplification product;

[0258] (2) Ligation: Double-digest the amplification product and the pCAGGS-MG7-cDNA whole genome plasmid, and perform gel extraction to obtain the digested product. Use T4 DNA ligase to ligate the digested product in a metal bath to obtain a ligation product;

[0259] (3) Transformation: Transform the ligation product into DH5α competent cells, add LB liquid medium and culture for about 30 min, spread it on an LB solid medium plate with ampicillin resistance, and culture for 12 hours; and

[0260] (4) Screening: Identify whether the MG7 mutant plasmid is successfully ligated, and screen to obtain the successfully ligated mutant plasmid.

[0261] In the present invention, "about" refers to a value within a range of ±5% of a specific value. For example, "about 30" includes ±5% of 30, or from 28.5 to 31.5.

[0262] In a preferred embodiment, the temperature of the metal bath is about 16°C.

[0263] In the present invention, "about" refers to a value within a range of ±5% of a specific value. For example, "about 16" includes ±5% of 16, or from 15.2 to 16.8.

[0264] In a preferred embodiment, the LB solid medium is an LB solid medium with ampicillin resistance.

[0265] In a preferred embodiment, the temperature of the culture is about 37°C.

[0266] In the present invention, "about" refers to a value within a range of ±5% of a specific value. For example, "about 37" includes ±5% of 37, or from 35.15 to 38.85.

[0267] In a preferred embodiment, the reverse genetic operation comprises the following steps:

[0268] (i) Co-transfecting the successfully ligated mutant plasmid and the helper plasmid into BHK-21 cells, culturing, freeze-thawing, and filtering through a filter to obtain a cell culture; and

[0269] (ii) Inoculating the cell culture into chicken embryos, incubating, and collecting the allantoic fluid of chicken embryos with positive hemagglutination test results to obtain the attenuated live marker vaccine strain rMG7-L-V1291I of Newcastle disease virus genotype VII.

[0270] In a preferred embodiment, the helper plasmids are pBSK-NP, pBSK-P, and pBSK-L.

[0271] In a preferred embodiment, the BHK-21 cells are BHK-21 cells pre-infected with recombinant vaccinia virus VVT7.

[0272] In the present invention, when the multiplicity of infection, time, or other values or parameters are expressed as a range, a preferred range, or a range defined by a series of upper preferred values and lower preferred values, this should be understood to specifically disclose all ranges formed by any pair of an upper range limit or preferred value and any lower range limit or preferred value, regardless of whether the range is disclosed individually. For example, when the range "0.001 - 0.1" is disclosed, the described range should be interpreted to include ranges such as "0.001 - 0.1", "0.001 - 0.08", "0.001 - 0.06", "0.001 - 0.04", "0.001 - 0.02", "0.02 - 0.1", "0.02 - 0.08", "0.02 - 0.06", "0.02 - 0.04", "0.04 - 0.1", "0.04 - 0.06", "0.06 - 0.1", "0.06 - 0.08", "0.08 - 0.1", etc. When a numerical range is described herein, unless otherwise stated, the range is intended to include its end values and all integers and fractions within the range.

[0273] In a preferred embodiment, the multiplicity of infection of the recombinant vaccinia virus VVT7 is 0.001 - 0.1 MOI, for example, about 0.01 MOI.

[0274] In the present invention, "about" means a value within a range of ±5% of a specific value. For example, "about 0.01" includes ±5% of 0.01, or from 0.0095 to 0.0105.

[0275] In a preferred embodiment, the pre-infection time is 0.5 - 1.5 h, for example, about 1 h.

[0276] In the present invention, "about" refers to a value within the range of ±5% of a specific value. For example, "about 1" includes ±5% of 1, or from 0.95 to 1.05.

[0277] In a preferred embodiment, the culturing time is 48 to 96 h, such as about 72 h.

[0278] In the present invention, "about" refers to a value within the range of ±5% of a specific value. For example, "about 72" includes ±5% of 72, or from 68.4 to 75.6.

[0279] In a preferred embodiment, the culturing temperature is about 37°C.

[0280] In the present invention, "about" refers to a value within the range of ±5% of a specific value. For example, "about 37" includes ±5% of 37, or from 35.15 to 38.85.

[0281] In a preferred embodiment, the culturing container is a cell culture incubator containing 5% CO2.

[0282] In a preferred embodiment, the number of freeze-thaw cycles is 1 time.

[0283] In a preferred embodiment, the pore size of the filter is 0.22 μm.

[0284] In a preferred embodiment, the chicken embryo is a 9- to 11-day-old SPF chicken embryo.

[0285] In a preferred embodiment, the incubation time is 2 to 4 days, such as about 3 days.

[0286] In the present invention, "about" refers to a value within the range of ±5% of a specific value. For example, "about 3" includes ±5% of 3, or from 2.85 to 3.15.

[0287] According to another aspect of the present invention, there is provided the use of the above-mentioned Newcastle disease attenuated live marker vaccine strain rMG7-L-V1291I of genotype VII in the preparation of a vaccine.

[0288] In a preferred embodiment, the vaccine is a vaccine having a protective effect against Newcastle disease caused by genotype VII.

[0289] In a preferred embodiment, the vaccine is an avian vaccine.

[0290] In a preferred embodiment, the avian is a chicken.

[0291] The present invention will be further described below in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods without specific conditions noted in the following embodiments are generally carried out according to conventional conditions or conditions recommended by the manufacturer.

[0292] Unless otherwise defined, all professional and scientific terms used herein have the same meaning as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to those described herein can be applied to the methods of the present invention. The preferred methods and materials described herein are for illustrative purposes only.

[0293] The above-mentioned features mentioned in the present invention, or the features mentioned in the embodiments, can be combined arbitrarily. All the features disclosed in this patent specification can be used in combination with any composition form, and each feature disclosed in the specification can be replaced by any alternative feature that provides the same, equivalent or similar purpose. Therefore, unless otherwise specified, the disclosed features are only general examples of equivalent or similar features.

[0294] Examples

[0295] 1. Materials and Methods

[0296] 1.1. Plasmids and Cells

[0297] The pCAGGS-MG7-cDNA whole genome plasmid (the cleavage site of the F protein of the MG7 strain has been mutated to the cleavage site of the F protein of the La Sota strain, and 18 amino acids are deleted at positions 443-460 of the NP protein); the three helper plasmids pBSK-NP, pBSK-P, pBSK-L and the BHK-21F cells are all stored in our laboratory.

[0298] 1.2. Viruses, Bacteria and Laboratory Animals

[0299] The recombinant vaccinia virus VVT7 is amplified and stored in our laboratory; the competent Escherichia coli DH5α is purchased from TaKaRa Biotechnology (Dalian) Co., Ltd.; the SPF chicken embryos and 1-day-old SPF chickens are purchased from Boehringer Ingelheim (Beijing) Co., Ltd.

[0300] 1.3. Primer Design and Synthesis

[0301] Corresponding mutant primers were designed using biological software such as Oligo7 based on the pCAGGS-MG7-cDNA whole genome plasmid (as shown in Table 1).

[0302] Table 1 Primer Information

[0303] Primer Name Primer Sequence (5′-3′) rMG7-F-N471A-F GAACTTGGAAACGTCGCGAATTCAATCAGCAATGCC rMG7-F-N471A-R GGCATTGCTGATTGAATTCGCGACGTTTCCAAGTTC rMG7-HN-G256E-F GTGCTCTAAGGTCACAGAAACTGAAGAGGAGGATT rMG7-HN-G256E-R AATCCTCCTCTTCAGTTTCTGTGACCTTAGAGCAC rMG7-L-V1291I-F CAGAGTGTCGCCTTACATACACATATCCAATGATT rMG7-L-V1291I-R AATCATTGGATATGTGTATGTAAGGCGACACTCTG

[0304] 1.4. Construction of MG7 Mutant Plasmids

[0305] Using the pCAGGS-MG7-cDNA whole-genome plasmid as a template, site-directed mutagenesis was performed on the differential amino acid sites of each structural protein of the MG7 strain. The specific method is as follows. First, PCR amplify the upstream and downstream DNA fragments of the mutation site. After gel extraction of the upstream and downstream DNA fragments, mix them in equimolar amounts as a template, and perform Overlap PCR to amplify the full-length DNA mutation fragment (Tables 2 and 3). Double-digest the full-length DNA mutation fragment and the pCAGGS-MG7-cDNA whole-genome plasmid, gel extract the digested plasmid and the target fragment, and use T4 DNA ligase to ligate the digested plasmid and the fragment overnight in a 16°C metal bath. Transform the ligation product into DH5α competent cells. After adding 500 μL of LB liquid medium and culturing at 37°C for 30 min, take an appropriate amount of the culture solution and spread it on an LB solid medium plate (ampicillin-resistant), and culture overnight at 37°C. Pick monoclonal colonies from the solid plate and inoculate them into 5 mL of LB liquid medium (ampicillin-resistant), and culture overnight at 37°C. After the culture is completed, extract the MG7 mutant plasmid in small amounts, and use nucleic acid electrophoresis to identify whether the MG7 mutant plasmid is successfully ligated. Send the suspected successfully ligated MG7 mutant plasmid to the company for sequencing, and use the positive plasmid for the rescue of the MG7 mutant virus.

[0306] Table 2 PCR reaction system

[0307] Reagent Volume (50 μL) PrimeStar DNA Polymerase 0.5 μL 5×PrimeStar Buffer 10 μL dNTP Solution 4 μL Forward Primer 1.5 μL Reverse Primer 1.5 μL DNA Template (25 ng / μL) 1 μL <![CDATA[ddH2O]]> Make up to 50 μL

[0308] Table 3 Site-directed mutagenesis PCR program

[0309]

[0310]

[0311] 1.5. Rescue of the MG7 mutant virus

[0312] When the density of BHK-21F cells in the cell plate is about 70%, discard the supernatant of the cell culture medium, add 1 mL of Opti-MEM, and pre-infect BHK-21F cells with recombinant vaccinia virus VVT7 (0.01 MOI) for 1 h. Co-transfect BHK-21 cells with the MG7 mutant plasmid and three helper plasmids (pBSK-NP, pBSK-P, and pBSK-L). Place the transfected cell plate in a 37°C cell culture incubator containing 5% CO2 and culture for 72 h. Freeze-thaw the cells in the cell plate once, filter the cell culture through a 0.22 μm filter, and inoculate all of it into 9- to 11-day-old SPF chicken embryos. Place the SPF chicken embryos sealed with wax in a 37°C incubator and continue to incubate for 3 d. After incubating for 3 d, aspirate the allantoic fluid of the chicken embryos for the HA test, and collect the allantoic fluid of the chicken embryos with positive HA test results for sequencing and identification.

[0313] 1.6. Detection of the genetic stability of the MG7 mutant virus

[0314] Dilute the MG7 mutant virus 10-fold with sterile PBS, then inoculate it into 9- to 11-day-old SPF chicken embryos and continuously passage it in the chicken embryos until the 15th passage. Extract the RNA of the MG7 mutant virus at the 5th, 10th, and 15th passages according to the steps of the virus RNA extraction kit instruction manual. Amplify the DNA fragment containing the mutation site by RT-PCR, recover the target fragment by gel extraction, and send it to the company for sequencing. Use SeqMan software to analyze the sequencing results and verify the genetic stability of the MG7 mutant virus. 5

[0315] 1.7 Determination of the virulence of the MG7 mutant virus

[0316] Refer to the WOAH standard and determine the virulence of the MG7 mutant virus through two indicators, MDT and ICPI.

[0317] MDT determination: First, serially dilute the allantoic fluid of the MG7 mutant virus 10-fold, then inoculate the virus dilutions from 10 -9 to 10 -6 onto 9- to 11-day-old SPF chicken embryos. Finally, place the SPF chicken embryos in an incubator at 37°C for 7 days. Candle the embryos twice a day, discard the dead embryos within 24 hours, record the death time of each chicken embryo, and calculate the MDT value of this mutant virus. The NDV virulence determination criteria are as follows: The MDT of a low virulence strain is greater than 90 hours, the MDT of a medium virulence strain is between 60 hours and 90 hours, and the MDT of a high virulence strain is less than 60 hours.

[0318] ICPI determination: First, dilute the allantoic fluid of the MG7 mutant virus 10-fold, then inoculate the virus solution intracranially into 1-day-old chicks, 50 μL per chick, 10 chicks per group. Observe the status of the chicks every day and score them (normal chicken: 0 points; diseased chicken: 1 point; dead chicken: 2 points) for a total of 8 days. Finally, calculate the ICPI value of this mutant virus. The NDV virulence determination criteria are as follows: The ICPI of a low virulence strain is less than 0.7, the ICPI of a medium virulence strain is between 0.7 and 1.5, and the ICPI of a high virulence strain is greater than 1.60.

[0319] 1.8 Immunization of SPF chickens with a live attenuated vaccine and challenge protection test

[0320] Randomly divide 4-week-old SPF chickens into 6 groups, 16 chickens per group. Immunize the SPF chickens by the intranasal and intraocular route with the MG7 strain, three MG7 mutant viruses, and the La Sota strain (10 7 EID 50 / 100 μL per feather) once, and the PBS control group is inoculated with 100 μL of sterile PBS by the same route. Collect blood from the wing vein of the SPF chickens at 1, 2, and 3 weeks after immunization to separate the serum. On the 21st day after immunizing the SPF chickens with the live attenuated vaccine, challenge them with the NDV-97 strain at 10 5 EID​50 (100 μL) dose was used for challenge by intramuscular injection in the leg muscle. Observe continuously for 14 days, and record the physiological conditions and the number of deaths of SPF chickens (as shown in Table 4).

[0321] Table 4 Immunization and challenge protocols

[0322] Virus Strain Inoculation Dose Inoculation Route Blood Sampling Time Challenge Dose rMG7-F-N471A <![CDATA[10 7 EID 50 / 100 μL / per feather]]> Dropwise Instillation into Nose and Eye Weeks 1, 2, and 3 <![CDATA[10 5 EID 50 / only]]> rMG7-HN-G256E <![CDATA[10 7 EID 50 / 100 μL / per feather]]> Dropwise Instillation into Nose and Eye Weeks 1, 2, and 3 <![CDATA[10 5 EID 50 / only]]> rMG7-L-V1291I <![CDATA[10 7 EID 50 / 100 μL / per feather]]> Dropwise Instillation into Nose and Eye Weeks 1, 2, and 3 <![CDATA[10 5 EID 50 / only]]> MG7 <![CDATA[10 7 EID 50 / 100 μL / per feather]]> Dropwise Instillation into Nose and Eye Weeks 1, 2, and 3 <![CDATA[10 5 EID 50 / only]]> LaSota <![CDATA[10 7 EID 50 / 100 μL / per feather]]> Dropwise Instillation into Nose and Eye Weeks 1, <![CDATA[10 5 EID 50 / only]]> ​ ​ ​ <![CDATA[10 5 EID 50 / only]]>

[0323] 1.9 Detection of the replication ability of the attenuated strain in vivo after immunizing SPF chickens

[0324] On the 2nd, 4th, 6th, 8th, and 10th days after immunizing SPF chickens, collect throat and cloacal swabs from SPF chickens in each vaccine immunization group, put them into 500 μL of PBS containing double antibodies, shake vigorously and mix well, and then let stand for 30 min. Centrifuge the supernatant of the swab leaching solution and inoculate it into 9 - 11-day-old chicken embryos, inoculating 3 embryos for each dilution gradient, 100 μL / embryo. After incubating in an incubator at 37 °C for 48 h, measure the HA titer of the allantoic fluid of the chicken embryos. If the HA titer ≥ 1:16, the swab is determined to be virus-excreting, and finally calculate the virus excretion rate.

[0325] 1.10 Detection of HI antibody titers after immunizing SPF chickens

[0326] First, add 25 μL of PBS to the hemagglutination plate, then add 25 μL of the detection antigen and serially dilute it 2-fold, then add 25 μL of PBS, and finally add 25 μL of 1% chicken red blood cell suspension. Shake well and let stand for 15 min, and read the HA titer. Prepare 4-unit antigen according to the HA titer of the detection antigen. First, add 25 μL of PBS to the hemagglutination plate, then add 25 μL of the serum to be tested and serially dilute it 2-fold, then add 25 μL of 4-unit detection antigen, shake well and let stand for 15 min, and finally add 25 μL of 1% chicken red blood cell suspension. Shake well and let stand for 15 min, and read the HI titer of the serum to be tested.

[0327] 1.11 Detection of the virus excretion level after challenging SPF chickens

[0328] On the 3rd, 5th, 7th, 9th, and 11th days after challenging SPF chickens, collect swabs from SPF chickens in each vaccine immunization group, put them into 1 mL of PBS containing double antibodies, shake vigorously and mix well, and then let stand for 30 min. Continuously dilute the supernatant of the swab leaching solution 10-fold serially and inoculate it into 9 - 11-day-old chicken embryos, inoculating 3 embryos for each dilution gradient, 100 μL / embryo. After incubating in an incubator at 37 °C for 48 h, measure the HA titer of the allantoic fluid of the chicken embryos. If the HA titer ≥ 1:16, the swab is determined to be virus-excreting, and finally calculate the virus content of the swab.

[0329] 1.12 Detection of the virus-carrying situation in various organs after challenging SPF chickens

[0330] On the 3rd and 5th days after immunization and challenge of SPF chickens, 3 SPF chickens in each group were randomly and painlessly sacrificed. Six kinds of organs, namely liver, spleen, kidney, bursa of Fabricius, pancreas and small intestine, were collected, added with PBS containing double antibodies, and then 2 autoclaved steel beads were added. The tissues were homogenized at low temperature for 10 min using a high-throughput tissue grinder. After homogenization, the centrifugal supernatant was taken and serially diluted 10-fold and inoculated into 9- to 11-day-old chicken embryos. 3 embryos were inoculated at each dilution gradient, 100 μL / embryo. After incubation in an incubator at 37 °C for 48 h, the HA titer of the allantoic fluid of the chicken embryos was measured. If the HA titer ≥ 1:16, the organ was determined to contain the virus, and finally the virus content in the organ was calculated.

[0331] 2. Results and Analysis

[0332] 2.1. Rescue and Growth Characteristics Analysis of MG7 Mutant Viruses

[0333] Using the pCAGGS-MG7-cDNA full-genome plasmid as a template, the full-length DNA fragment containing the mutation site was amplified by PCR. After steps such as double digestion, ligation, transformation, and sequencing identification, this study successfully constructed multiple MG7 mutant plasmids.

[0334] The allantoic fluid of chicken embryos with positive HA test results was collected, the rescued virus RNA was extracted, and the target fragment containing the amino acid site mutation was amplified by RT-PCR and sent to the company for sequencing. The sequencing results showed that the amino acid site mutation of the rescued MG7 mutant virus was successful.

[0335] The MG7 mutant virus was serially passaged in 9- to 11-day-old chicken embryos. By measuring the HA titer and virus titer of the MG7 mutant virus, this study finally screened out three mutant viruses with better growth performance than the MG7 strain and named them rMG7-F-N471A, rMG7-HN-G256E, and rMG7-L-V1291I (as shown in Table 5).

[0336] Table 5 Analysis of the Growth Characteristics of the Rescued MG7 Mutant Viruses in Chicken Embryos

[0337]

[0338]

[0339] 2.2. Genetic Stability Analysis of MG7 Mutant Viruses

[0340] Extract the allantoic fluid RNA of the 5th, 10th, and 15th generations of the rMG7-F-N471A, rMG7-HN-G256E, and rMG7-L-V1291I MG7 mutant viruses, amplify the mutant fragments by RT-PCR and sequence them. The sequencing results showed that the mutant sites of the three MG7 mutant viruses, rMG7-F-N471A, rMG7-HN-G256E, and rMG7-L-V1291I, could be stably inherited after continuous passage to the 15th generation in 9- to 11-day-old SPF chicken embryos, and no reverse mutations occurred (as ​ , ​ and ​ shown).

[0341] 2.3 Virulence analysis of MG7 mutant viruses

[0342] Determine the MDT and ICPI values of the three MG7 mutant viruses according to the WOAH standard. The experimental data showed that the MDT and ICPI values of the three MG7 mutant viruses, rMG7-F-N471A (MDT ≥ 120 h, ICPI = 0.13), rMG7-HN-G256E (MDT ≥ 120 h, ICPI = 0.02), and rMG7-L-V1291I (MDT ≥ 120 h, ICPI = 0), all met the requirements for NDV low virulent strains (as shown in Table 6).

[0343] Table 6 Virulence analysis of MG7 mutant viruses

[0344]

[0345] 2.4 Analysis of the in vivo replication ability of MG7 mutant viruses after immunizing SPF chickens

[0346] Detect the replication ability of MG7 mutant viruses in SPF chickens. The results showed that all low virulent strains could replicate in SPF chickens, and the highest virus excretion rates in the larynx and cloaca were observed on the 4th and 6th days after immunization; among them, the virus excretion rate in the rMG7-F-N471A vaccine immunized group was higher than that in the MG7 vaccine immunized group. Therefore, the replication ability of the rMG7-F-N471A mutant strain in SPF chickens was better than that of the MG7 strain (as shown in Table 7).

[0347] Table 7 Detection results of virus excretion in SPF chickens after immunization with low virulent vaccines

[0348]

[0349] 2.5 Detection of HI antibody titers after immunizing SPF chickens

[0350] The HI antibody titers in the sera of SPF chickens immunized with each vaccine at different time points after immunization were determined using the MG7 strain as the detection antigen. The results showed that the HI antibody titers in the sera of SPF chickens in each vaccine immunization group continuously increased after immunization and reached the highest level at the 3rd week. The HI antibody titers in the MG7 and its mutant virus vaccine immunization groups were between 1:16 and 1:32. Compared with the MG7 vaccine immunization group, there was no significant difference in the HI antibody titers in the rMG7-F-N471A, rMG7-HN-G256E, and rMG7-L-V1291I vaccine immunization groups( ​ ).

[0351] 2.6. Detection of virus excretion levels and virus carriage in various organs of SPF chickens after challenge

[0352] SPF chickens immunized with the live attenuated vaccine were challenged with the NDV-97 strain on the 21st day after immunization. The results showed that all SPF chickens in the PBS control group became ill and died within 6 days, the protection rate of SPF chickens in the MG7 vaccine immunization group was 90%, and the protection rate of SPF chickens in other vaccine immunization groups was 100% (as ​ shown). The swab titration results showed that compared with the MG7 and La Sota vaccine immunization groups, no virus was detected in the throat and cloacal swabs of SPF chickens in the rMG7-F-N471A and rMG7-HN-G256E vaccine immunization groups, while the virus excretion rate of the swabs in the rMG7-L-V1291I vaccine immunization group was 20%. This indicates that the rMG7-F-N471A mutant strain and the rMG7-HN-G256E mutant strain can provide 100% protection for SPF chickens as live attenuated vaccines and can effectively prevent SPF chickens from excreting the virus (as shown in Table 8).

[0353] Virus titration was performed on the collected various organs. The organ titration results showed that virus could be detected in all organs of the PBS control group; virus could only be isolated from the bursa of Fabricius in the rMG7-F-N471A and rMG7-HN-G256E vaccine immunization groups; virus could be isolated from the spleen, pancreas, and bursa of Fabricius in the rMG7-L-V1291I vaccine immunization group; virus could be isolated from the pancreas, bursa of Fabricius, and kidney in the MG7 vaccine immunization group; virus was distributed in the liver, spleen, pancreas, and bursa of Fabricius in the La Sota vaccine immunization group. The above results indicate that compared with the MG7 and La Sota vaccine immunization groups, the rMG7-F-N471A mutant strain and the rMG7-HN-G256E mutant strain can effectively inhibit virus replication in the organs of SPF chickens as live attenuated vaccines (as shown in Table 9).

[0354] Table 8 Detection results of virus excretion after challenge with the NDV-97 strain in SPF chickens immunized with live attenuated vaccines on the 21st day

[0355]

[0356] Among them, "-" indicates that all SPF chickens died.

[0357] Table 9 Distribution of virus in different tissues after challenge with NDV-97 strain at 21 d after immunization of SPF chickens with live attenuated vaccine

[0358]

[0359]

[0360] The embodiments of the present invention have been introduced in detail above. Specific examples are used herein to elaborate on the principle and implementation manner of the present invention. The description of the above embodiments is only used to help understand the method and its core idea of the present invention. At the same time, changes or deformations made by those skilled in the art based on the idea of the present invention in terms of the specific implementation manner and application scope of the present invention all fall within the protection scope of the present invention. In summary, the content of this specification should not be construed as a limitation to the present invention.

Claims

1. A genetically attenuated marker vaccine strain rMG7-L-V1291I of Newcastle disease virus genotype VII, characterized in that, Its preservation number is CGMCC No. 46291.

2. A method for constructing the genetically attenuated marker vaccine strain rMG7-L-V1291I of genotype VII Newcastle disease virus, characterized in that, The construction method includes the following steps: (a) Using the pCAGGS-MG7-cDNA whole genome plasmid as a template, site-directed mutagenesis is carried out on the structurally different amino acid sites of the MG7 strain to obtain a mutant plasmid; (b) The mutant plasmid is subjected to reverse genetic operation to construct the Newcastle disease attenuated live marked vaccine strain rMG7-L-V1291I of genotype VII.

3. The construction method according to claim 2, wherein, In the pCAGGS-MG7-cDNA whole genome plasmid, the cleavage site of the F protein of the MG7 strain has been mutated to the cleavage site of the F protein of the La Sota strain, and 18 amino acids are deleted at positions 443-460 of the NP protein of the MG7 strain.

4. The construction method according to claim 2, characterized in that, The upstream primer used for the site-directed mutagenesis is 5’-CAGAGTGTCGCCTTACATACACATATCCAATGATT-3’.

5. The construction method according to claim 2, characterized in that, The downstream primer used for the site-directed mutagenesis is 5’-AATCATTGGATATGTGTATGTAAGGCGACACTCTG-3’.

6. The construction method according to claim 2, characterized in that, The site-directed mutagenesis includes the following steps: (1) PCR amplification: Amplify the DNA fragments upstream and downstream of the mutation site. After gel recovery of the upstream and downstream DNA fragments, they are mixed in equimolar amounts as a template to amplify the full-length DNA mutant fragment to obtain an amplification product; (2) Ligation: The amplification product and the pCAGGS-MG7-cDNA whole genome plasmid are double digested, and the enzyme digestion products are recovered by gel to obtain ligation products, which are ligated using T4 DNA ligase in a metal bath; (3) Transformation: The ligation product is transformed into DH5α competent cells, added with LB liquid medium and cultured for 28.5-31.5 min, and then spread on an LB solid medium plate with ampicillin resistance and cultured for 12 hours; and (4) Screening: Identify whether the MG7 mutant plasmid is successfully ligated, and screen to obtain the successfully ligated mutant plasmid.

7. The construction method according to claim 6, characterized in that, The temperature of the metal bath is 15.2-16.8 °C.

8. The construction method according to claim 6, characterized in that The LB solid medium is an LB solid medium with ampicillin resistance.

9. The construction method according to claim 6, characterized in that The temperature of the culture is 35.15-38.85 °C.

10. The construction method according to claim 2, characterized in that, The reverse genetic operation includes the following steps: (i) Co-transfect the successfully ligated mutant plasmid and the helper plasmid into BHK-21 cells, culture, freeze-thaw, and filter through a filter to obtain a cell culture; and (ii) Inoculate the cell culture into chicken embryos, incubate, and collect the allantoic fluid of chicken embryos with positive hemagglutination test results to obtain the Newcastle disease attenuated live marked vaccine strain rMG7-L-V1291I of genotype VII.

11. The construction method according to claim 10, wherein, The helper plasmid is pBSK-NP, pBSK-P, and pBSK-L.

12. The construction method according to claim 10, characterized in that, The BHK-21 cells are BHK-21 cells pre-infected with the recombinant poxvirus VVT7.

13. The construction method according to claim 12, characterized in that, The multiplicity of infection of the recombinant poxvirus VVT7 is 0.001-0.1 MOI.

14. The construction method according to claim 13, characterized in that, The multiplicity of infection of the recombinant poxvirus VVT7 is 0.0095-0.0105 MOI.

15. The construction method according to claim 12, characterized in that, The time of pre-infection is 0.5-1.5 h.

16. The construction method according to claim 15, wherein, The time of pre-infection is 0.95-1.05 h.

17. The construction method according to claim 10, wherein The culturing time is 48 to 96 h.

18. The construction method according to claim 17, characterized in that, The culturing time is 68.4 to 75.6 h.

19. The construction method according to claim 10, characterized in that, The culturing temperature is 35.15 to 38.85 °C.

20. The construction method according to claim 10, characterized in that, The culturing container is a cell incubator containing 5% CO2.

21. The construction method according to claim 10, characterized in that, The number of freeze-thaw cycles is 1.

22. The construction method according to claim 10, wherein The pore size of the filter is 0.22 μm.

23. The construction method according to claim 10, wherein The chicken embryos are 9- to 11-day-old SPF chicken embryos.

24. The construction method according to claim 10, characterized in that, The incubation time is 2 to 4 days.

25. The construction method according to claim 24, characterized in that, The incubation time is 3 days.

26. Use of the attenuated live Newcastle disease virus genotype VII marker vaccine strain rMG7-L-V1291I according to claim 1 in the preparation of a vaccine against Newcastle disease.

27. The use according to claim 26, characterized in that, The vaccine is a vaccine having a protective effect against Newcastle disease caused by genotype VII.

28. The use according to claim 26, wherein, The vaccine is an avian vaccine.

29. The use according to claim 28, wherein, The avian species is chicken.

Images