Molecular marker closely linked with wheat flag leaf width major QTL and application of molecular marker in prediction of wheat flag leaf width

Abstract

The invention discloses a molecular marker closely linked with wheat flag leaf width major QTL and application of the molecular marker in prediction of wheat flag leaf width, and belongs to the technical field of wheat molecular biotechnology and breeding. Wherein the molecular marker is 4BFLW-290, the nucleotide sequences of the molecular marker are as shown in SEQ ID NO: 3 and SEQ ID NO: 4, the specific primer pair of the molecular marker is 4BFLW-290-F / R, and the nucleotide sequences of the specific primer pair are as shown in SEQ ID NO: 1 and SEQ ID NO: 2. The molecular marker 4BFLW-290 provided by the invention fully embodies the flag leaf width major QTL of the wheat variety (line), can quickly and accurately predict whether the wheat variety (line) has the flag leaf width major QTL or not, and provides excellent gene resources and selection tools for wheat yield trait molecular breeding.

Description

Technical Field

[0001] This invention relates to a molecular marker and its application, specifically to a molecular marker closely linked to a major QTL for wheat flag leaf width and its application in predicting wheat flag leaf width, belonging to the field of wheat molecular biotechnology and breeding technology. Background Technology

[0002] Wheat is one of the world's most important food crops, and increasing wheat yield is a crucial way to meet food demand. Leaves are the main organs for photosynthesis in wheat, with the flag leaf making a significant contribution to grain yield; after flowering, the photosynthetic products of the flag leaf account for 30% of wheat yield. Among flag leaf morphologies, flag leaf width has a significantly greater impact on wheat yield than flag leaf length and area. Previous studies have shown a highly significant positive correlation between wheat flag leaf width and yield traits. Therefore, identifying superior alleles controlling flag leaf width and developing functional molecular markers can greatly accelerate the breeding process of high-yielding wheat varieties, providing excellent genetic resources and selection tools for molecular breeding of wheat yield traits.

[0003] Wheat flag leaf width is a quantitative trait controlled by multiple genes, with a complex genetic basis and significant environmental influences. Therefore, genetic research on wheat flag leaf width is quite challenging. Classical genetic analysis methods can only study multiple genes controlling quantitative traits as a whole, making it difficult to effectively investigate the number of genes controlling trait expression, their location on chromosomes, their effects, and their modes of action. With the development of molecular biology and biostatistics, quantitative trait locus (QTL) mapping techniques based on molecular marker genetic maps and various statistical models have provided effective technical means for studying the inheritance of quantitative traits. QTLs can be used to detect the location and effect of target traits on chromosomes, as well as their relationship with other genes. Therefore, continuously enriching the diversity of wheat flag leaf width genes and studying and developing genes related to wheat flag leaf width through molecular marker technology is of paramount importance in breeding work.

[0004] Gao Xu et al. used recombinant inbred lines constructed from wheat varieties Mian 96-5 and Guixie 3 as materials and detected four QTLs related to flag leaf width on chromosomes 4B, 5B, and 6A using a 55K SNP chip. Lu Lahu et al. used a DH population constructed from Nongda 3338 and Jingdong 6 as experimental materials and detected 40 QTLs related to flag leaf traits, of which 14 were related to flag leaf width, located on chromosomes 2D, 4A, 4B, 4D, 5A, 6A, and 6D. Chang Xin et al. used a recombinant inbred line population constructed from wheat varieties Xiaoyan 81 and Xinong 1376 as experimental materials and detected 10 QTLs related to flag leaf width, located on chromosomes 1A, 3A, 5A, 7A, 3B, and 5D. Fu Jinmei et al. used recombinant inbred lines constructed from Lankao 906 and Xiaoyan 81 as experimental materials and detected seven QTLs for flag leaf width, located on chromosomes 1B, 2A, 4A, 4B, 6B, 6D, and 7D, respectively. To date, there are no reports of fine mapping of QTLs controlling flag leaf width on wheat chromosome 4B. Summary of the Invention

[0005] Therefore, the purpose of this invention is to locate the major QTL for wheat flag leaf width on wheat chromosome 4B, mine molecular markers closely linked to the major QTL for wheat flag leaf width, and predict whether wheat varieties (lines) have QTL sites that increase wheat flag leaf width through the mined molecular markers, thereby accelerating the breeding process of high-yielding new wheat varieties.

[0006] To achieve the above objectives, the present invention adopts the following technical solution: The molecular marker 4BFLW-290, located on wheat chromosome 4B and an InDel marker, is used to predict the width of the flag leaf of wheat. Its nucleotide sequence is shown in SEQ ID NO: 3 and SEQ ID NO: 4. Wheat genomic DNA containing the sequence shown in SEQ ID NO: 3 is predicted to contain alleles that increase flag leaf width; wheat genomic DNA containing the sequence shown in SEQ ID NO: 4 is predicted not to contain alleles that increase flag leaf width.

[0007] The primer pair 4BFLW-290-F / R is used to predict the width of wheat flag leaves. The primer pair 4BFLW-290-F / R is a specific primer pair for the aforementioned molecular marker 4BFLW-290. The nucleotide sequence of the primer pair 4BFLW-290-F / R is shown in SEQ ID NO: 1 and SEQ ID NO: 2.

[0008] A detection reagent for predicting wheat flag leaf width, the detection reagent comprising the aforementioned primer pair 4BFLW-290-F / R for predicting wheat flag leaf width.

[0009] A method for predicting wheat flag leaf width includes the following steps: (1) Extracting genomic DNA from wheat; (2) Using wheat genomic DNA as a template, PCR amplification was performed using the primer pair 4BFLW-290-F / R described in claim 2 to obtain the amplification product; (3) Separate the amplification products by electrophoresis; (4) When the size of the amplified product is 210 bp, it is predicted that wheat contains an allele that increases the width of the flag leaf; when the size of the amplified product is 244 bp, it is predicted that wheat does not contain an allele that increases the width of the flag leaf.

[0010] Preferably, in step (2), the PCR amplification system is 10 μL, specifically including: 1 μL DNA template, 1 μL upstream primer, 1 μL downstream primer, 5 μL 2×Taq PCR premixed reagent, and 2 μL ddH2O.

[0011] The advantages of this invention are: (1) The molecular marker 4BFLW-290 (SEQ ID NO: 3, SEQ ID NO: 4) discovered in this invention fully embodies the major QTL of flag leaf width in wheat varieties (lines). Using the genomic DNA of the wheat variety (line) to be tested as a template, the wheat variety (line) is amplified by PCR using the specific primer pair 4BFLW-290-F / R (SEQ ID NO: 1, SEQ ID NO: 2) of the molecular marker 4BFLW-290. This can quickly and accurately predict whether the wheat variety (line) has the major QTL of flag leaf width, providing excellent gene resources and selection tools for molecular breeding of wheat yield traits. (2) The molecular marker 4BFLW-290, which is closely linked to the major QTL of wide flag leaf in wheat, discovered in this invention, can be used for wheat molecular breeding. This can greatly reduce the work of phenotypic identification and can be used in wheat seedling stage, thereby eliminating non-target plants. This saves breeding costs and improves breeding efficiency, opening up more new genetic resources for flag leaf traits in wheat breeding. Attached Figure Description

[0012] Figure 1 This is the mapping interval of the major QTL-qFlw-4B for flag leaf width in wheat on wheat chromosome 4B. The hollow rectangles represent chromosomes, the right side of the chromosome shows the name of the molecular marker, and the numbers on the left side of the chromosome indicate the location of the molecular marker on the chromosome, in Mb. There are two types of molecular markers in the figure: 4BFLW-290 is an InDel marker, and the rest are SNP markers. The red rectangles on the right side of the chromosome represent the QTL mapping intervals for flag leaf width under various environmental conditions. Figure 2This is a graph showing the PCR amplification results of molecular marker 4BFLW-290 in some families of the RIL population. In the graph, M represents the 50bp DNA ladder, K represents the amplification result of wheat variety Kenong 9204, J represents the amplification result of wheat variety Jing 411, and numbers 1-48 represent the amplification results of some families of the RIL population. Figure 3 This is a graph showing the results of flag leaf width single-marker analysis based on molecular marker 4BFLW-290 in 188 families of RIL populations under different environments. Black bars represent alleles from Kenong 9204, and white bars represent alleles from Jing 411. ** indicates highly significant differences. P <0.01). Detailed Implementation

[0013] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments.

[0014] The wheat variety used in this invention, Kenong 9204 (KN9204), is an approved variety with the variety approval number: National Approval Wheat 2003037.

[0015] The wheat variety used in this invention, Jing 411 (J411), is an approved variety that can be obtained from the National Crop Germplasm Resource Bank. Its national unified number is ZM020984.

[0016] The 2×Taq PCR premixed reagent used in this invention was produced by Tiangen Biotech (Beijing) Co., Ltd., and its specification is: KT211-02 (1ml, containing dye, blue).

[0017] The preparation method of the non-denaturing polyacrylamide gel with a mass concentration of 6.0% used in this invention is as follows: dissolve 5.85g of acrylamide and 0.15g of methylene acrylamide in 100ml of distilled water.

[0018] I. Obtaining RIL Group

[0019] Using Kenong 9204, a wheat variety with a relatively wide flag leaf, as the female parent and Jing 411, a wheat variety with a relatively narrow flag leaf, as the male parent, hybrid F1 was obtained. F1 was self-pollinated to obtain F2. F2 was self-pollinated generation by generation to form the F6 generation RIL population containing 188 families.

[0020] II. Field planting and phenotypic identification of RIL populations under different experimental environments.

[0021] The RIL population was field-planted and phenotypically identified in eight experimental environments, and the flag leaf width of each line was examined under different years, locations, and nitrogen level treatments.

[0022] The eight test environments are as follows: E1: 2011-2012 Shijiazhuang Agro-ecosystem Experimental Station (Shijiazhuang) Low Nitrogen; E2: High nitrogen levels at the Shijiazhuang Agro-ecosystem Experimental Station (Shijiazhuang) in 2011-2012; E3: Low nitrogen at Shijiazhuang Agro-ecosystem Experimental Station (Shijiazhuang) in 2012-2013; E4: High nitrogen levels at the Shijiazhuang Agro-ecosystem Experimental Station (Shijiazhuang) in 2012-2013; E5: Low-nitrogen farm, Beijing Pingxifu Farm, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, 2012-2013; E6: High-nitrogen farm, Beijing Pingxifu Farm, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, 2012-2013; E7: Low-nitrogen test at the Huixian Experimental Base (Xinxiang), Xinxiang Academy of Sciences, Henan Province, 2012-2013; E8: High nitrogen at the Huixian Experimental Base (Xinxiang), Xinxiang Academy of Sciences, Henan Province, 2012-2013.

[0023] Low nitrogen means no fertilizer is applied throughout the year, while high nitrogen means applying 300 kg / hm² of fertilizer before sowing each year. -2 diammonium phosphate and 225 kg•hm -2 Urea is applied as a base fertilizer at a rate of 150 kg / hm² during the jointing stage. -2 Urea top dressing.

[0024] Wheat planting method: Plant 2 rows per line, sow 40 seeds per row; row length 3m, plant spacing 7.5cm, row spacing 25cm, normal growth and harvest.

[0025] Method for determining flag leaf width: During the wheat heading stage, use a ruler with an accuracy of 0.01 cm to measure the width of the flag leaf at its widest point. Measure 5 plants for each line and take the average value.

[0026] III. Initial localization of major QTLs for wheat flag leaf width on wheat chromosomes High-density genetic linkage maps of 188 families in the RIL population were constructed using JOINMAP 2.0 software. Flag leaf width phenotypic values ​​obtained directly from investigations and predictions in eight experimental environments were organized according to the BIP module format requirements of IciMapping v4.1, and then additive QTL mapping was performed. Using a 1Mb step interval, 1000 permutation tests were conducted to detect the LOD peak under different environments, and the LOD threshold (2.5) was determined.

[0027] QTL analysis was performed by combining the high-density genetic linkage map of 188 RIL families and the phenotypic data of flag leaf width in 8 experimental environments. A major QTL for flag leaf width, qFlw-4B, was detected in the region of AX-109988872 to AX-110527790 on chromosome 4B of wheat (physical location: 4B: 29.7003 - 4B: 45.9657). It could be stably detected in 8 experimental environments, with LOD values ranging from 7.54 to 13.91, and it could explain 9.03 - 18.45% of the phenotypic variation in flag leaf width.

[0028] The QTL detection results of flag leaf width in 8 experimental environments of 188 families in the RIL population are shown in Table 1 and Figure 1 .

[0029] Table 1 QTL detection results of flag leaf width in 8 experimental environments of 188 families in the RIL population

[0030] IV. Mining molecular markers tightly linked to the major QTL of wheat flag leaf width and designing specific primer pairs According to the alignment results of the genome re-sequencing data of Kenong 9204 and Jing 411, an InDel marker (4BFLW-290) was designed near the region of AX-109988872 to AX-110527790 on chromosome 4B of wheat (physical location: 4B: 29.7003 - 4B: 45.9657). Its position in the target interval is as Figure 1 shown.

[0031] Compared with Jing 411 (the nucleotide sequence of the molecular marker 4BFLW-290 is shown in SEQ ID NO: 4), there is a 34-bp base deletion in the genome of Kenong 9204 (the nucleotide sequence of the molecular marker 4BFLW-290 is shown in SEQ ID NO: 3).

[0032] According to the above molecular marker 4BFLW-290, the corresponding specific primer pair was designed. The sequences of the designed specific primer pair are as follows: Forward primer 4BFLW-290-F: ACCAGATTGTACGGAATAGGG (SEQ ID NO: 1) Reverse primer 4BFLW-290-R: GAACATTGGAAGGTGACAACA (SEQ ID NO: 2).

[0033] V Genotyping analysis of the RIL population 1. Extracting DNA of each line in the RIL population The DNA of each line in the RIL population was extracted by the improved CTAB method. The specific extraction method is as follows: (1) Take steel balls and 0.2g of fresh leaves and put them into a 2.0mL centrifuge tube, quickly put them into liquid nitrogen, shake and grind them into fine powder; (2) Add 0.8 mL of CTAB (hexadecyltrimethylammonium bromide) extract, shake well, and incubate in a water bath at 65°C for 60 min, turning the container 4 times during the incubation period. (3) Place the centrifuge tube at room temperature to cool, add an equal volume of chloroform-isoamyl alcohol (volume ratio 24:1), shake vigorously for 1 min to mix, and centrifuge at 8000 rpm for 10 min. (4) Transfer 600 μL of supernatant to another 1.5 mL centrifuge tube, add 0.8 times the volume of pre-cooled isopropanol (pre-cooled at -20°C) to precipitate DNA, and centrifuge at 12000 rpm for 6 min; (5) Discard the supernatant, add an appropriate amount of 70% (v / v) ethanol solution to wash the precipitate twice, place the centrifuge tube at an angle in a fume hood to dry, and after there is no alcohol smell, add 400 μL of TE buffer to dissolve it, and store it in a -20℃ refrigerator for long-term storage.

[0034] 2. Genotyping analysis of the RIL population using the InDel marker 4BFLW-290. (1) PCR amplification of DNA from the RIL population Leaf DNA from the RIL population was amplified by PCR using specific primers for the molecular marker 4BFLW-290, 4BFLW-290-F / R (SEQ ID NO: 1, SEQ ID NO: 2). The PCR amplification system is 10 μL, specifically consisting of: 1 μL DNA template, 1 μL upstream primer, 1 μL downstream primer, 5 μL 2×Taq PCR premixed reagent, and 2 μL ddH2O.

[0035] The PCR amplification program used was a standard amplification program, as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 1 min, repeated 34 times; 72℃ extension for 5 min; amplification ended, and the sample was stored at 12℃.

[0036] (2) Electrophoresis of PCR amplification products The obtained PCR amplification products were separated by constant voltage electrophoresis using a 6.0% (w / w) non-denaturing polyacrylamide gel. The electrophoresis buffer was 1×TBE, and the electrophoresis was performed at a constant voltage of 150V for 2.5 hours. The specific steps of gel preparation and electrophoresis are as follows: (i) Place the glass plate horizontally, with the flat plate at the bottom and the concave plate on top, and place the seal in the middle. Try inserting the comb to see if it fits. (ii) Each piece of glue requires 50 mL of non-denaturing polyacrylamide gel with a mass concentration of 6.0%. Add 20 μL of tetramethylethylenediamine (TEMED) and 200 μL of ammonium persulfate with a mass concentration of 10% to each 50 mL of non-denaturing polyacrylamide gel, stir evenly, and pour the glue using a glass rod. After pouring the glue, insert the comb. (iii) After the gel solidifies, remove the comb, rinse the gel wells with deionized water, place the solidified glass plate in the electrophoresis tank with the groove facing inward, and clamp it with a clip. (iv) Fill the top and bottom with 1×TBE electrophoresis buffer, spot 0.3 μL of the sample, and then electrophores at a constant voltage of 150V for 2.5 h; (v) After electrophoresis, silver nitrate staining is performed. Specifically: remove the gel block and fix it in the fixative for 3 min; rinse it quickly with deionized water 3 times, 30 s each time; stain it in silver staining solution for 6 min, rinse it quickly with water; develop it in the developing solution until the amplified bands appear; stop the development in deionized water, take a picture, and obtain a non-denaturing polyacrylamide gel image. Figure 2 ), record tape type.

[0037] (3) Analyze the electrophoresis results The PCR amplification fragment size of wheat variety Kenong 9204 is 210bp (SEQ ID NO: 3), and the PCR amplification fragment size of wheat variety Jing 411 is 244bp (SEQ ID NO: 4). Among the 188 populations of RIL families, 65 had the same banding pattern as Kenong 9204, 77 had the same banding pattern as Jing 411, 23 were heterozygous, and 23 had deletions.

[0038] VI. Analysis of the flag width effect of QTL-qFlw-4B under different environments Using the linkage between molecular marker 4BFLW-290 and QTL-qFlw-4B, and based on the genotyping results of 188 families in the RIL population using molecular marker 4BFLW-290, the flag leaf width effect of QTL-qFlw-4B under different environmental conditions was analyzed. SPSS 25.0 was used to perform a significance analysis of the differences in flag leaf width among the 188 families in the RIL population.

[0039] Single-marker analysis of flag leaf width based on molecular marker 4BFLW-290 in 188 families of RIL populations across 8 environments is shown in Table 2. Figure 3 .

[0040] Table 2 Results of flag leaf width measurement for each line in the RIL population

[0041] The results showed that, compared with the allele from Jing 411 that reduced flag leaf width, the allele from Kenong 9204 significantly increased flag leaf width (by 0.076–0.121 cm). This result could be replicated in multiple environments.

[0042] The above results demonstrate that the molecular marker 4BFLW-290 discovered in this invention is a molecular marker closely linked to the major QTL for wheat flag leaf width, and can be effectively used in wheat plant type molecular marker-assisted selection breeding programs.

[0043] It should be noted that the above embodiments of the present invention are merely examples for clearly illustrating the present invention and are not intended to limit the implementation of the present invention. Those skilled in the art can make other variations or modifications based on the above description. All obvious variations or modifications derived from the technical solutions of the present invention are still within the protection scope of the present invention.

Claims

1. The molecular marker 4BFLW-290 for predicting wheat flag leaf width, characterized in that, The molecular marker 4BFLW-290 is located on wheat chromosome 4B and is an InDel marker. Its nucleotide sequence is shown in SEQ ID NO: 3 and SEQ ID NO:

4. Wheat whose genomic DNA contains the sequence shown in SEQ ID NO: 3 is predicted to contain an allele that increases flag leaf width. Wheat whose genomic DNA contains the sequence shown in SEQ ID NO: 4 is predicted not to contain an allele that increases flag leaf width.

2. The primer pair 4BFLW-290-F / R for predicting wheat flag leaf width is characterized by, The primer pair 4BFLW-290-F / R is a specific primer pair for the molecular marker 4BFLW-290 described in claim 1, and the nucleotide sequence of the primer pair 4BFLW-290-F / R is shown in SEQ ID NO: 1 and SEQ ID NO:

2.

3. A detection reagent for predicting the width of wheat flag leaves, characterized in that, The detection reagent comprises the primer pair 4BFLW-290-F / R for predicting wheat flag leaf width as described in claim 2.

4. A method for predicting the width of wheat flag leaves, characterized in that, Includes the following steps: (1) Extracting genomic DNA from wheat; (2) Using wheat genomic DNA as a template, PCR amplification was performed using the primer pair 4BFLW-290-F / R described in claim 2 to obtain the amplification product; (3) Separate the amplification products by electrophoresis; (4) When the size of the amplified product is 210 bp, it is predicted that wheat contains an allele that increases the width of the flag leaf; when the size of the amplified product is 244 bp, it is predicted that wheat does not contain an allele that increases the width of the flag leaf.

5. The method for predicting wheat flag leaf width according to claim 4, characterized in that, In step (2), the PCR amplification system is 10 μL, specifically including: 1 μL DNA template, 1 μL upstream primer, 1 μL downstream primer, 5 μL 2×Taq PCR premixed reagent, and 2 μL ddH2O.

Images