Glucose dehydrogenase mutant, preparation method thereof and application of glucose dehydrogenase mutant in synthesis of NMNH

Abstract

The invention relates to the technical field of gene engineering and enzyme engineering, in particular to a glucose dehydrogenase mutant, a preparation method thereof and application of the glucose dehydrogenase mutant in synthesis of NMNH. The glucose dehydrogenase mutant is obtained after mutation on any one or more sites of the 39th site, the 51st site, the 75th site, the 93th site, the 157th site, the 195th site, the 208th site or the 236th site of a wild type glucose dehydrogenase amino acid sequence. The glucose dehydrogenase mutant is high in catalytic activity and can efficiently catalyze NMN to synthesize NMNH, the constructed glucose dehydrogenase mutant is utilized to catalyze NMN to synthesize NMNH, and the yield of NMNH can reach 41.2 g / L.

Description

Technical Field

[0001] The invention relates to the technical field of gene engineering and enzyme engineering, in particular to a glucose dehydrogenase mutant and a preparation method thereof and use thereof in synthesizing NMNH. Background Art

[0002] NAD+ (nicotinamide adenine dinucleotide) plays an important role in human health. Increasing the level of NAD+ in the body plays an important role in maintaining biological health. NAD+ has a large molecular mass and it is difficult for it to enter cells. Proper supplementation of NAD+ precursors in the body will help to increase the level of NAD+ in the body, thereby reducing the occurrence of diseases. Nicotinamide mononucleotide (NMN) and reduced nicotinamide mononucleotide (NMNH) are two NAD+ precursors, and it has been proven that supplementing these two precursors can effectively increase the level of NAD+ in the body. NMNH is the reduced form of NMN and is a more effective NAD+ enhancer than NMN.

[0003] At present, there are relatively few technologies for synthesizing NMNH, and chemical synthesis and bio-enzyme catalysis have been reported. Compared with chemical methods, bio-enzyme catalysis has the advantage of being green and environmentally friendly. The currently reported enzyme-catalyzed synthesis of NMNH is to use NADH pyrophosphatase to catalyze NADH (reduced nicotinamide adenine dinucleotide) to generate NMNH and AMP. This method uses substrate NADH, the raw material is expensive, and the mass loss rate reaches 50%. From an economic point of view, the commercial value of this technology is low. At present, research on the synthesis of NMNH is very insufficient, which seriously limits the commercialization of this important substance. Bio-enzyme catalysis technology mainly relies on efficient functional enzymes. Therefore, for this important substance NMNH, screening suitable dehydrogenases to catalyze the reduction of NMN to generate NMNH, and conducting directed mutations on the screened dehydrogenases to improve the activity of the enzyme, and realizing the efficient synthesis of NMNH will promote the commercial application of NMNH and play an important role in human health. Summary of the invention

[0004] In view of the above-mentioned shortcomings of the prior art, the object of the present invention is to provide a glucose dehydrogenase mutant and a preparation method thereof and use thereof in the synthesis of NMNH, so as to solve the problems in the prior art.

[0005] To achieve the above-mentioned object and other related objects, the present invention provides a glucose dehydrogenase mutant, which is obtained by mutation at any one or more positions of the 39th, 51st, 75th, 93rd, 157th, 195th, 208th or 236th position of the amino acid sequence of wild-type glucose dehydrogenase.

[0006] The amino acid sequence of the wild-type glucose dehydrogenase is shown in SEQ ID NO.1.

[0007] In certain embodiments of the present invention, the glucose dehydrogenase mutant is obtained by a combined mutation at positions 39 and 93, or a combined mutation at positions 39 and 75, or a combined mutation at positions 39 and 157, or a combined mutation at positions 39, 93 and 157, or a combined mutation at positions 39, 93 and 75, or a combined mutation at positions 93 and 208, or a combined mutation at positions 51 and 157, or a combined mutation at positions 93 and 157 of the amino acid sequence of the wild-type glucose dehydrogenase.

[0008] In certain embodiments of the present invention, the glucose dehydrogenase mutant is obtained by performing any of the following mutations on the wild-type glucose dehydrogenase amino acid sequence shown in SEQ ID NO.1: Y39Q single mutation, Y39N single mutation, Y39Q / A93K combined mutation, Y39Q / I75L combined mutation, Y39N / I75S combined mutation, Y39Q / A93K / H157R combined mutation, Y39N / A93P / H157Q combined mutation.

[0009] The present invention also provides an isolated polynucleotide encoding the aforementioned glucose dehydrogenase mutant.

[0010] The present invention also provides a nucleic acid construct, which comprises the isolated polynucleotide.

[0011] The present invention also provides a cell, wherein the cell contains the nucleic acid construct or an exogenous polynucleotide as shown in any one of SEQ ID Nos. 30 to 32 is integrated into the genome.

[0012] The present invention also provides a method for preparing the glucose dehydrogenase mutant, comprising the following steps: culturing the cells, inducing the expression of the glucose dehydrogenase mutant, and collecting and separating the bacteria after the induction to obtain an enzyme solution of the glucose dehydrogenase mutant.

[0013] The present invention also provides uses of the glucose dehydrogenase mutant, the isolated polynucleotide, the nucleic acid construct, and the cell in preparing NMNH.

[0014] The present invention also provides a method for preparing NMNH, which comprises using the glucose dehydrogenase mutant to catalyze NMN to obtain NMNH.

[0015] As described above, the glucose dehydrogenase mutant of the present invention, its preparation method and use in the synthesis of NMNH have the following beneficial effects: high catalytic activity, capable of efficiently catalyzing NMN to synthesize NMNH, and realizing the biological preparation of NMNH; the production of NMNH can reach 41.2 g / L by catalyzing NMN to synthesize NMNH using the constructed glucose dehydrogenase mutant; the technology of biological preparation of NMNH is green and environmentally friendly, and no toxic chemical reagents are introduced into the reaction system; it is conducive to the industrial development of NMNH; NMNH is an effective precursor of NAD+, and based on the reported efficacy of NAD+, the commercial application of NMNH can effectively improve human health and reduce the occurrence of diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 Shown is a liquid chromatogram of the glucose dehydrogenase mutant of the present invention catalyzing the reaction of NMN to NMNH after 6 hours.

[0017] Figure 2 Shown is the mass spectrum of NMNH synthesized catalytically by the glucose dehydrogenase mutant of the present invention. DETAILED DESCRIPTION

[0018] The present invention provides a glucose dehydrogenase mutant, which is obtained by mutation at any one or more positions of the 39th, 51st, 75th, 93rd, 157th, 195th, 208th or 236th position of the amino acid sequence of wild-type glucose dehydrogenase.

[0019] In certain preferred embodiments of the present invention, the mutation site is selected from position 39, position 75, position 93, position 157, and position 195. The glucose dehydrogenase mutants formed by mutations at these sites have a higher conversion rate of catalyzing NMN to NMNH.

[0020] The wild-type glucose dehydrogenase is a glucose dehydrogenase of a microorganism, and the microorganism is selected from Escherichia coli, Streptomyces, Bacillus subtilis, Salmonella typhi or mycobacteria, yeast, mold, etc.

[0021] In certain embodiments of the present invention, the amino acid sequence of the wild-type glucose dehydrogenase is shown as SEQ ID NO.1.

[0022] In certain embodiments of the present invention, the glucose dehydrogenase mutant is obtained by a combined mutation at positions 39 and 93, or a combined mutation at positions 39 and 75, or a combined mutation at positions 39 and 157, or a combined mutation at positions 39, 93 and 157, or a combined mutation at positions 39, 93 and 75, or a combined mutation at positions 93 and 208, or a combined mutation at positions 51 and 157, or a combined mutation at positions 93 and 157 of the amino acid sequence of the wild-type glucose dehydrogenase.

[0023] In certain embodiments of the present invention, the mutation at position 39 is selected from Y39Q or Y39N, that is, the tyrosine at position 39 is mutated to glutamine or asparagine.

[0024] In certain embodiments of the present invention, the mutation at position 51 is selected from E51Q, that is, glutamic acid at position 51 is mutated to glutamine.

[0025] In certain embodiments of the present invention, the mutation at position 75 is selected from I75S or I75L, that is, the isoleucine at position 75 is mutated to serine or leucine.

[0026] In certain embodiments of the present invention, the mutation at position 93 is selected from A93K or A93P, that is, the alanine at position 93 is mutated to lysine or proline.

[0027] In certain embodiments of the present invention, the mutation at position 157 is selected from H157R or H157Q, that is, the histidine at position 157 is mutated to arginine or glutamine.

[0028] In certain embodiments of the present invention, the mutation at position 195 is selected from I195E or I195L, that is, the isoleucine at position 195 is mutated to glutamic acid or leucine.

[0029] In certain embodiments of the present invention, the mutation at position 208 is selected from D208N or D208Y, that is, the aspartic acid at position 208 is mutated to asparagine or tyrosine.

[0030] In certain embodiments of the present invention, the mutation at position 236 is selected from A236V, that is, the alanine at position 236 is mutated to valine.

[0031] In certain embodiments of the present invention, the glucose dehydrogenase mutant is obtained by performing any of the following mutations on the wild-type glucose dehydrogenase amino acid sequence shown in SEQ ID NO.1: Y39Q single mutation, Y39N single mutation, Y39Q / A93K combined mutation, Y39Q / I75L combined mutation, Y39N / I75S combined mutation, Y39Q / A93K / H157R combined mutation, Y39N / A93P / H157Q combined mutation.

[0032] The present invention also provides an isolated polynucleotide encoding the aforementioned glucose dehydrogenase mutant.

[0033] In certain embodiments of the present invention, the polynucleotide comprises a nucleotide sequence as shown in SEQ ID NO.30: aactatcaaagtaat (SEQ ID NO.30).

[0034] In certain embodiments of the present invention, the polynucleotide comprises the nucleotide sequence shown in SEQ ID NOs. 30-31: aataataagggtctt (SEQ ID NO. 31).

[0035] In certain embodiments of the present invention, the nucleotide sequence of the polynucleotide is shown in SEQ ID NO.32: (SEQ ID NO.32).

[0036] The present invention also provides a nucleic acid construct, which comprises the isolated polynucleotide.

[0037] The term "nucleic acid construct" refers to an artificially constructed nucleic acid segment that can be introduced into target cells or tissues. The nucleic acid construct can be various expression vectors, which include a vector backbone, i.e., an empty vector, and an expression framework.

[0038] The type of expression vector is not specifically limited. An expression vector refers to a nucleic acid molecule that allows the insertion of exogenous nucleotides without destroying the ability of the vector to replicate and / or integrate in a host cell. An expression vector may include a nucleic acid sequence that allows it to replicate in a host cell, such as an origin of replication. An expression vector may also include one or more selective marker genes and other genetic factors. An expression vector is a vector that contains necessary regulatory sequences to allow the transcription and translation of an inserted gene or genes. The expression vector is selected from a eukaryotic expression vector or a prokaryotic expression vector.

[0039] The prokaryotic expression vector is selected from an Escherichia coli expression vector, a Bacillus subtilis expression vector or a Streptomyces expression vector. In a preferred embodiment, the prokaryotic expression vector is selected from an Escherichia coli expression vector. Compared with other expression systems, the Escherichia coli expression system has a clear genetic background, a short culture cycle, a high expression level of the target gene, and strong anti-pollution ability. The Escherichia coli expression vector is, for example, a pET expression vector, specifically pET28a, pET32a, which can be stably expressed in Escherichia coli. The expression vector can also be a pCW expression vector, a pUC expression vector or a pPIC9k expression vector.

[0040] The eukaryotic expression vector is selected from a yeast expression vector, an insect expression vector or a mammalian expression vector. The mammalian expression vector is selected from a retroviral expression vector, a lentiviral expression vector, an adenoviral expression vector, and an adeno-associated viral expression vector. In a preferred embodiment, the eukaryotic expression vector is selected from a retroviral expression vector, which can be stably expressed in a cell line, and the retroviral vector is, for example, pMSCV.

[0041] The host cell is selected from eukaryotic host cells or prokaryotic host cells. Eukaryotic host cells are selected from fungi such as yeast, insects, birds, plants, C.elegans or nematodes or mammalian host cells. A non-limiting example of an insect cell is a Spodopterafrugiperda (Sf) cell. An example of a yeast host cell is Saccharomyces cerevisiae (S.cerevisiae), Kluyveromyces lactis (Kluyveromyces lactis, K.lactis) or Yarrowia lipolytica, Pichia pastoris. An example of a mammalian cell is a COS cell, a baby hamster kidney cell, a mouse L cell, a LNCaP cell, a Chinese hamster ovary (CHO) cell, a human embryonic kidney (HEK) cell, an African green monkey cell, a CV1 cell, a Vero or a Hep-2 cell. Examples of prokaryotic host cells include bacterial cells, such as E. coli, Streptomyces, B. subtilis, Salmonella typhi, or mycobacteria.

[0042] Those skilled in the art can transfect the expression vector into host cells according to methods well known in the art to obtain cells containing the coding gene of the glucose dehydrogenase mutant. For example, the expression vector can be introduced into eukaryotic cells by calcium phosphate coprecipitation, electroporation, microinjection, liposome transfection or transfection using a polyamine transfection reagent.

[0043] The present invention also provides a cell, wherein the cell contains the nucleic acid construct or an exogenous polynucleotide as shown in any one of SEQ ID Nos. 30 to 32 is integrated into the genome.

[0044] The cells are bacteria or fungi.

[0045] The present invention also provides a method for preparing the glucose dehydrogenase mutant, comprising the following steps: culturing the cells, inducing the expression of the glucose dehydrogenase mutant, and collecting and separating the bacteria after the induction to obtain an enzyme solution of the glucose dehydrogenase mutant.

[0046] In certain embodiments of the present invention, the cell culture conditions include any of the following: a culture temperature of 25-32° C., a rotation speed of 150-250 rpm, and a culture medium of LB medium.

[0047] In certain embodiments of the present invention, the expression of the glucose dehydrogenase mutant is induced when the culture system is cultured to an OD600 of 0.5-1.0.

[0048] In certain embodiments of the present invention, IPTG is used to induce the expression of the glucose dehydrogenase mutant.

[0049] In certain embodiments of the present invention, the final concentration of IPTG is 0.3-0.6 mM based on the total volume of the culture system. In certain embodiments of the present invention, the induction time is 14-18 hours.

[0050] In certain embodiments of the invention, the bacterial cells are collected by centrifugation.

[0051] In certain embodiments of the present invention, the separation method is: the collected bacterial cells are disrupted by ultrasound and centrifuged to obtain the enzyme solution of the glucose dehydrogenase mutant.

[0052] The present invention also provides uses of the glucose dehydrogenase mutant, the isolated polynucleotide, the nucleic acid construct, and the cell in preparing NMNH.

[0053] The use is to catalyze NMN to prepare NMNH.

[0054] The present invention also provides a method for preparing NMNH, which comprises using the glucose dehydrogenase mutant to catalyze NMN to obtain NMNH.

[0055] In certain embodiments of the present invention, the temperature for catalyzing NMN using a glucose dehydrogenase mutant is 25° C.-40° C. For example, the temperature is 25-30° C., 30-35° C., or 35-40° C.

[0056] In certain embodiments of the present invention, the pH value of using a glucose dehydrogenase mutant to catalyze NMN is 6-10, for example, pH 6-7, 7-7.5, 7.5-8, 8-8.5, 8.5-9, 9-10.

[0057] When the glucose dehydrogenase mutant provided by the present invention is used for enzyme catalysis, the conversion rate of NMN is high when the reaction temperature is controlled at 25-40° C. and the pH is controlled at 7.5-10.0.

[0058] In certain embodiments of the present invention, when the glucose dehydrogenase mutant is used to catalyze NMN, the final concentration of the glucose dehydrogenase mutant is 0.5 mg / mL to 200.0 mg / mL based on the total volume of the catalytic system. The final concentration of the glucose dehydrogenase mutant in the catalytic system is, for example, 0.5-10 mg / mL, 2-30 mg / mL, 5-50 mg / mL, 10-100 mg / mL, 10-200 mg / mL.

[0059] In certain embodiments of the present invention, when the glucose dehydrogenase mutant is used to catalyze NMN, the initial concentration of NMN is 6 to 60 mM based on the total volume of the catalytic system. For example, the initial concentration of NMN is 6 to 10 mM, 10 to 20 mM, 20 to 30 mM, 30 to 35 mM, 35 to 40 mM, 40 to 50 mM, or 50 to 60 mM.

[0060] In certain embodiments of the present invention, the catalytic system using a glucose dehydrogenase mutant to catalyze NMN includes: a glucose dehydrogenase mutant, NMN, glucose, NaCl, and a pH buffer.

[0061] In certain embodiments of the present invention, based on the total volume of the catalytic system, the concentration of glucose in the catalytic system is 0.05 to 2.0 mol / L. The concentration of glucose in the catalytic system is, for example, 0.05 to 0.1 mol / L, 0.1 to 0.2 mol / L, 0.2 to 0.3 mol / L, 0.3 to 0.4 mol / L, 0.4 to 0.5 mol / L, 0.5 to 1.0 mol / L, 1.0 to 1.5 mol / L, 1.5 to 2.0 mol / L.

[0062] In certain embodiments of the present invention, based on the total volume of the catalytic system, the concentration of NaCl in the catalytic system is 0.1 to 4.0 mol / L. The concentration of NaCl in the catalytic system is, for example, 0.1 to 0.5 mol / L, 0.5 to 1 mol / L, 1 to 1.5 mol / L, 1.5 to 2 mol / L, 2 to 2.5 mol / L, 2.5 to 3 mol / L, 3 to 3.5 mol / L, 3.5 to 4 mol / L.

[0063] In certain embodiments of the present invention, the pH buffer is, for example, Tris-HCL buffer.

[0064] In certain embodiments of the present invention, the method specifically uses the enzyme solution of the glucose dehydrogenase mutant to catalyze NMN to obtain NMNH.

[0065] In certain embodiments of the invention, NMN and / or glucose are supplemented during the catalytic process.

[0066] In certain embodiments of the present invention, when the concentration of NMN in the reaction system is lower than 3 mM, NMN and / or glucose are added once. The number of times of adding NMN and / or glucose is 1 to 10 times.

[0067] The following describes the embodiments of the present invention through specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention.

[0068] Before further describing the specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terms used in the examples of the present invention are for describing the specific embodiments rather than for limiting the scope of protection of the present invention; in the present specification and claims, unless otherwise expressly stated herein, the singular forms "a", "an" and "the" include plural forms.

[0069] When the embodiments give numerical ranges, it should be understood that, unless otherwise specified in the present invention, both endpoints of each numerical range and any numerical value between the two endpoints can be selected. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those generally understood by those skilled in the art. In addition to the specific methods, equipment, and materials used in the embodiments, according to the grasp of the prior art by those skilled in the art and the record of the present invention, any methods, equipment, and materials of the prior art similar or equivalent to the methods, equipment, and materials described in the embodiments of the present invention can also be used to realize the present invention.

[0070] Example 1: Screening of highly efficient NMNH glucose dehydrogenase mutants

[0071] Construction of glucose dehydrogenase and mutants:

[0072] Glucose dehydrogenase (amino acid sequence such as SEQ ID NO.1, GenBank: WP_003246720.1; denoted as: BsuGDH) was used as the starting protein, and mutation design of BsuGDH was performed by computer simulation. The mutation sites that may be meaningful are predicted to be single point mutations or their two-by-two combined mutations of 8 sites, including Y39, E51, I75, A93, H157, I195, D208, and A236. The constructed recombinant plasmid pET28-BsuGDH (nucleotide sequence as shown in SEQ ID NO.34) was used as a template, and the corresponding synthetic primers (primers synthesized by Jiangsu Saisuofei Biotechnology Co., Ltd.) were used to PCR amplify the DNA sequence encoding the mutation of glucose dehydrogenase. After gel recovery and purification, the PCR product was fused and connected using a seamless cloning kit (Shanghai Biyuntian Biotechnology Co., Ltd., CatNo.D7010M) to construct a mutant expression plasmid. If there is a single site mutation, the corresponding primers are used to perform PCR amplification with the recombinant plasmid pET28-BsuGDH as a template, and then the expression plasmid of the site mutation is constructed by fusion; if there are two site mutations, based on the constructed first site mutation plasmid, the primers for the second site mutation are used to perform the second round of PCR and ligation to construct a double mutation expression plasmid. If there are three site mutations, based on the constructed two site mutation plasmids, the primers for the third site mutation are used to perform the third round of PCR and ligation to construct a triple site mutation expression plasmid.

[0073] in:

[0074] Primer for mutation at position 39 (Y39Q)

[0075] Forward primer (SEQ ID NO. 2): 5'-atcaactatcaaagtaataaac-3'

[0076] Reverse primer (SEQ ID NO. 3): 5'-actttgatagttgataaccacttttg-3'

[0077] Primer for mutation at position 39 (Y39N)

[0078] Forward primer (SEQ ID NO.4): 5'-gtggttatcaactataatagtaataaac-3'

[0079] Reverse primer (SEQ ID NO.5): 5'-ttatagttgataaccacttttgcctg-3'

[0080] Primer for mutation at position 51 (E51Q)

[0081] Forward primer (SEQ ID NO.6): 5'-gtaaaagaacaggtcatcaaggc-3'

[0082] Reverse primer (SEQ ID NO.7): 5'-gacctgttcttttacctcgttcgga-3'

[0083] Primer for mutation at position 75 (I75S)

[0084] Forward primer (SEQ ID NO.8): 5'-atgtaaaaaattccgtgcaaacggcaat-3'

[0085] Reverse primer (SEQ ID NO.9): 5'-cggaattttttacatcttcctctttcg-3'

[0086] Primer for mutation at position 75 (I75L)

[0087] Forward primer (SEQ ID NO.10): 5'-tctcgtgcaaacggcaattaaggag-3'

[0088] Reverse primer (SEQ ID NO.11): 5'-tgcacgacattttttacatcttcctc-3'

[0089] Primer for mutation at position 93 (A93K)

[0090] Forward primer (SEQ ID NO.12): 5'-gattaataataagggtcttgaaaatcc-3'

[0091] Reverse primer (SEQ ID NO.13): 5'-cccttattattaatcataatatcgag-3'

[0092] Primer for mutation at position 93 (A93P)

[0093] Forward primer (SEQ ID NO.14): 5'-gattaataatcccggtcttgaaaatcctg-3'

[0094] Reverse primer (SEQ ID NO.15): 5'-gaccgggattattaatcataatatcg-3'

[0095] Primer for mutation of site 157 (H157R)

[0096] Forward primer (SEQ ID NO.16): 5'-gtccgctatgcggcaagtaaaggc-3'

[0097] Reverse primer (SEQ ID NO.17): 5'-tgccgcatagcggacaaataacggc-3'

[0098] Primer for mutation of site 157 (H157Q)

[0099] Forward primer (SEQ ID NO.18): 5'-gtccaatatgcggcaagtaaaggcgg-3'

[0100] Reverse primer (SEQ ID NO.19): 5'-tgccgcatattggacaaataacggc-3'

[0101] Primer for mutation at position 195 (I195E)

[0102] Forward primer (SEQ ID NO.20): 5'-cgccagagaatgctgaaaaattcgc-3'

[0103] Reverse primer (SEQ ID NO.21): 5'-cagcattctctggcgtgttgatcgc-3'

[0104] Primer for mutation at position 195 (I195L)

[0105] Forward primer (SEQ ID NO.22): 5'-gatcaacacgccactcaatgctg-3'

[0106] Reverse primer (SEQ ID NO.23): 5'-agtggcgtgttgatcgcacctg-3'

[0107] Primer for mutation of site 208 (D208N)

[0108] Forward primer (SEQ ID NO.24): 5'-cagaaagctaatgtagaaagcatgattc-3'

[0109] Reverse primer (SEQ ID NO.25): 5'-tacattagctttctgtttagggtcag-3'

[0110] Primer for mutation of site 208 (D208Y)

[0111] Forward primer (SEQ ID NO.26): 5’-cagaaagcttatgtagaaagcatgattc-3’

[0112] Reverse primer (SEQ ID NO.27): 5’-ttctacataagctttctgtttagggtc-3’

[0113] Primer for mutation at site 236 (A236V)

[0114] Forward primer (SEQ ID NO.28): 5’-gaaggaagtcagctacgtcacaggcatc-3’

[0115] Reverse primer (SEQ ID NO.29): 5’-tagctgacttccttcgaagcaagccag-3’

[0116] Nucleotide sequence of pET28-BsuGDH:

[0117] tggcgaatgggacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctag

[0118] cgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctttagggttccgatttag

[0119] tgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttg

[0120] gagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataagggattttgccgatttcg

[0121] gcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattttaacaaaatattaacgtttacaatttcaggtggcacttttcggggaaatg

[0122] tgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgaattaattcttagaaaaactcatcgagcatcaaatgaaactg

[0123] caatttattcatatcaggattatcaataccatatttttgaaaaagccgtttctgtaatgaaggagaaaactcaccgaggcagttccataggatggcaa

[0124] gatcctggtatcggtctgcgattccgactcgtccaacatcaatacaacctattaatttcccctcgtcaaaaataaggttatcaagtgagaaatcacca

[0125] tgagtgacgactgaatccggtgagaatggcaaaagtttatgcatttctttccagacttgttcaacaggccagccattacgctcgtcatcaaaatcact

[0126] cgcatcaaccaaaccgttattcattcgtgattgcgcctgagcgagacgaaatacgcgatcgctgttaaaaggacaattacaaacaggaatcgaat

[0127] gcaaccggcgcaggaacactgccagcgcatcaacaatattttcacctgaatcaggatattcttctaatacctggaatgctgttttcccggggatcg

[0128] cagtggtgagtaaccatgcatcatcaggagtacggataaaatgcttgatggtcggaagaggcataaattccgtcagccagtttagtctgaccatct

[0129] catctgtaacatcattggcaacgctacctttgccatgtttcagaaacaactctggcgcatcgggcttcccatacaatcgatagattgtcgcacctgat

[0130] tgcccgacattatcgcgagcccatttatacccatataaatcagcatccatgttggaatttaatcgcggcctagagcaagacgtttcccgttgaatatg

[0131] gctcataacaccccttgtattactgtttatgtaagcagacagttttattgttcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagac

[0132] cccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttg

[0133] tttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagtta

[0134] ggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtctta

[0135] ccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaac

[0136] gacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagc

[0137] ggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgactt

[0138] gagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggcct

[0139] tttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgacc

[0140] gagcgcagcgagtcagtgagcgaggaagcggaagagcgcctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatatg

[0141] gtgcactctcagtacaatctgctctgatgccgcatagttaagccagtatacactccgctatcgctacgtgactgggtcatggctgcgccccgacac

[0142] ccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgt

[0143] cagaggttttcaccgtcatcaccgaaacgcgcgaggcagctgcggtaaagctcatcagcgtggtcgtgaagcgattcacagatgtctgcctgtt

[0144] catccgcgtccagctcgttgagtttctccagaagcgttaatgtctggcttctgataaagcgggccatgttaagggcggttttttcctgtttggtcactg

[0145] atgcctccgtgtaagggggatttctgttcatgggggtaatgataccgatgaaacgagagaggatgctcacgatacgggttactgatgatgaacat

[0146] gcccggttactggaacgttgtgagggtaaacaactggcggtatggatgcggcgggaccagagaaaaatcactcagggtcaatgccagcgctt

[0147] cgttaatacagatgtaggtgttccacagggtagccagcagcatcctgcgatgcagatccggaacataatggtgcagggcgctgacttccgcgttt

[0148] ccagactttacgaaacacggaaaccgaagaccattcatgttgttgctcaggtcgcagacgttttgcagcagcagtcgcttcacgttcgctcgcgta

[0149] tcggtgattcattctgctaaccagtaaggcaaccccgccagcctagccgggtcctcaacgacaggagcacgatcatgcgcacccgtggggcc

[0150] gccatgccggcgataatggcctgcttctcgccgaaacgtttggtggcgggaccagtgacgaaggcttgagcgagggcgtgcaagattccgaat

[0151] accgcaagcgacaggccgatcatcgtcgcgctccagcgaaagcggtcctcgccgaaaatgacccagagcgctgccggcacctgtcctacga

[0152] gttgcatgataaagaagacagtcataagtgcggcgacgatagtcatgccccgcgcccaccggaaggagctgactgggttgaaggctctcaag

[0153] ggcatcggtcgagatcccggtgcctaatgagtgagctaacttacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgc

[0154] cagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgccagggtggtttttcttttcaccagtgagacgggcaac

[0155] agctgattgcccttcaccgcctggccctgagagagttgcagcaagcggtccacgctggtttgccccagcaggcgaaaatcctgtttgatggtggt

[0156] taacggcgggatataacatgagctgtcttcggtatcgtcgtatcccactaccgagatatccgcaccaacgcgcagcccggactcggtaatggcg

[0157] cgcattgcgcccagcgccatctgatcgttggcaaccagcatcgcagtgggaacgatgccctcattcagcatttgcatggtttgttgaaaaccgga

[0158] catggcactccagtcgccttcccgttccgctatcggctgaatttgattgcgagtgagatatttatgccagccagccagacgcagacgcgccgaga

[0159] cagaacttaatgggcccgctaacagcgcgatttgctggtgacccaatgcgaccagatgctccacgcccagtcgcgtaccgtcttcatgggagaa

[0160] aataatactgttgatgggtgtctggtcagagacatcaagaaataacgccggaacattagtgcaggcagcttccacagcaatggcatcctggtcat

[0161] ccagcggatagttaatgatcagcccactgacgcgttgcgcgagaagattgtgcaccgccgctttacaggcttcgacgccgcttcgttctaccatc

[0162] gacaccaccacgctggcacccagttgatcggcgcgagatttaatcgccgcgacaatttgcgacggcgcgtgcagggccagactggaggtgg

[0163] caacgccaatcagcaacgactgtttgcccgccagttgttgtgccacgcggttgggaatgtaattcagctccgccatcgccgcttccactttttcccg

[0164] cgttttcgcagaaacgtggctggcctggttcaccacgcgggaaacggtctgataagagacaccggcatactctgcgacatcgtataacgttactg

[0165] gtttcacattcaccaccctgaattgactctcttccgggcgctatcatgccataccgcgaaaggttttgcgccattcgatggtgtccgggatctcgac

[0166] gctctcccttatgcgactcctgcattaggaagcagcccagtagtaggttgaggccgttgagcaccgccgccgcaaggaatggtgcatgcaagg

[0167] agatggcgcccaacagtcccccggccacggggcctgccaccatacccacgccgaaacaagcgctcatgagcccgaagtggcgagcccgat

[0168] cttccccatcggtgatgtcggcgatataggcgccagcaaccgcacctgtggcgccggtgatgccggccacgatgcgtccggcgtagaggatc

[0169] gagatctcgatcccgcgaaattaatacgactcactataggggaattgtgagcggataacaattcccctctagaaataattttgtttaactttaagaag

[0170] gagatataccatgtatccggatttaaaaggaaaagtcgtcgctattacaggagctgcttcagggctcggaaaggcgatggccattcgcttcggca

[0171] aggagcaggcaaaagtggttatcaactattatagtaataaacaagatccgaacgaggtaaaagaagaggtcatcaaggcgggcggtgaagct

[0172] gttgtcgtccaaggagatgtcacgaaagaggaagatgtaaaaaatatcgtgcaaacggcaattaaggagttcggcacactcgatattatgattaat

[0173] aatgccggtcttgaaaatcctgtgccatctcacgaaatgccgctcaaggattgggataaagtcatcggcacgaacttaacgggtgcctttttagga

[0174] agccgtgaagcgattaaatatttcgtagaaaacgatatcaagggaaatgtcattaacatgtccagtgtgcacgaagtgattccttggccgttatttgt

[0175] ccactatgcggcaagtaaaggcgggataaagctgatgacagaaacattagcgttggaatacgcgccgaagggcattcgcgtcaataatattgg

[0176] gccaggtgcgatcaacacgccaatcaatgctgaaaaattcgctgaccctaaacagaaagctgatgtagaaagcatgattccaatgggatatatc

[0177] ggcgaaccggaggagatcgccgcagtagcagcctggcttgcttcgaaggaagccagctacgtcacaggcatcacgttattcgcggacggcg

[0178] gtatgacacaatatccttcattccaggcaggccgcggttaagatccggctgctaacaaagcccgaaaggaagctgagttggctgctgccaccgctgagcaataactagcataaccccttggggcctctaaacgggtcttgaggggttttttgctgaaaggaggaactatatccggat (SEQ ID NO. 33)

[0179] The plasmid encoding the glucose dehydrogenase mutant constructed above was transformed into a BL21 (DE3) host to obtain the corresponding engineered strain.

[0180] Inducing the expression of glucose dehydrogenase and mutants:

[0181] The engineered strains carrying the above-mentioned glucose dehydrogenase BsuGDH and mutant encoding genes were inoculated into 3mL LB test tube culture medium, the culture temperature was controlled at 30°C and the rotation speed was 200rpm, and the culture was completed for 16h, and the resulting seed liquid was obtained. Then the seed liquid was inoculated into a 50mL shake flask LB culture medium, and the culture conditions were consistent with the culture conditions when preparing seeds, and the culture temperature was controlled at 30°C and the rotation speed was 200rpm. The OD600 value was detected during the culture process. When OD600 was in the range of 0.5-1.0, IPTG (IPTG final concentration was 0.5mM) was added to induce the expression of glucose dehydrogenase mutants, and the induction time was about 16h. After the induction was completed, the cells were collected under a centrifugal force of 12000g. At the same time, the collected cells were washed twice with Tris-HCL buffer (pH7.5, concentration of 50mM), and the resulting cells were frozen and stored at -20°C.

[0182] Preparation of glucose dehydrogenase and mutants:

[0183] Add 1 mL of Tris-HCL buffer (pH 7.5, concentration 50 mM) to the above frozen bacteria to suspend the cells. The suspended bacteria were broken with an ultrasonic disruptor (model SCIENTZ-IID, Ningbo Xinzhi Biotechnology Co., Ltd.). The breaking conditions were: ultrasonic for 3 seconds, stop for 6 seconds, and a total of 5 minutes of ultrasonic. The broken enzyme solution was centrifuged at 12000g and 4°C for 10 minutes. The supernatant obtained was the enzyme solution containing glucose dehydrogenase and mutants, which was used for subsequent enzyme catalysis experiments.

[0184] Performance of glucose dehydrogenase and its mutants:

[0185] The glucose dehydrogenase and mutants obtained above were subjected to enzyme catalysis experiments respectively. The enzyme catalytic system consists of 800 μL of 50 mM pH 7.5 Tris-HCL buffer, 100 μL of 60 mM NMN solution, 50 μL of 2 M glucose solution, 50 μL of 20 M NaCl solution, and 1 mg / ml of glucose dehydrogenase (calculated based on the total volume of the enzyme catalytic system). The reaction conditions of enzyme catalysis are as follows: temperature 30 ° C, and the shaking speed is 50 rpm. The enzyme catalytic reaction starts with the input of substrate NMN. After the input of NMN, 1 mL was sampled from the reaction bottle, and the initial NMN concentration was detected by HPLC (recorded as 0 h); the reaction was terminated after 6 h, and 1 mL was sampled in the same way. The residual amount of NMN in the reaction solution at the end of HPLC detection (6 h) and the amount of NMNH generated. The conversion rate was calculated based on the concentration of NMN at the beginning of the reaction, the residual amount of NMN at the end of the reaction, and the amount of NMNH generated.

[0186] The NMNH conversion rate was calculated according to formula ①:

[0187] B(6) / [A(0)–A(6)]×100%①

[0188] Wherein, A(0) is the concentration of NMN at the beginning of the reaction; A(6) is the concentration of NMN in the reaction bottle after 6 h of reaction; B(6) is the concentration of NMNH in the reaction bottle after 6 h of reaction.

[0189] Detection method of NMN and NMNH: BioCore SAX 5um 4.6*250mm chromatographic column was used, the injection volume was 5μL, the mobile phase was 50mM disodium hydrogen phosphate, the flow rate was controlled at 0.5mL / min, the column oven temperature was 25℃, and the detection wavelength of NMN and NMNH was 225nm.

[0190] After 6 h of reaction, the concentration and conversion rate of NMN to NMNH catalyzed by glucose dehydrogenase and its mutants are shown in Table 1.

[0191] Table 1 Concentration and conversion rate of NMNH synthesized by glucose dehydrogenase and its mutants

[0192]

[0193] According to the conversion rates of different glucose dehydrogenase mutants in Table 1, Y39 (Y39Q, Y39N, Y39Q / A93K, Y39Q / I75L, Y39N / I75S, Y39Q / A93K / H157R, Y39N / A93P / H157Q), I75 (I75S, I75L, Y39Q / I75L, Y39N / I75S), A93 (A93K, A93P, Y39Q / After mutations at sites such as A93K, Y39Q / A93K / H157R, Y39N / A93P / H157Q), H157 (H157R, H157Q, Y39Q / A93K / H157R, Y39N / A93P / H157Q), and I195 (I195E), the conversion rates of glucose dehydrogenase catalyzing NMN to NMNH are all high, and all have commercial prospects for catalyzing NMN to NMNH.

[0194] Among them, the glucose dehydrogenase mutant (BsuGDH Y39Q / A93K / H157R ) catalyzes NMN to synthesize NMNH after 6 hours of liquid chromatography. Figure 1 .

[0195] At the same time, mass spectrometry analysis is performed on the NMNH detected in the liquid chromatogram. When the sample is subjected to liquid chromatography detection, it is added to the injection volume, such as the injection volume of 50 μL, and then after the NMNH peak is detected in the liquid chromatogram, a 1.5 mL centrifuge tube is used to collect the liquid-separated NMNH sample in the subsequent outflow pipeline. The collected NMNH sample is subjected to mass spectrometry analysis to determine the molecular weight of the synthesized NMNH. Glucose dehydrogenase mutant (BsuGDH Y39Q / A93K / H157R The mass spectrum of NMNH synthesized by catalysis is shown in Figure 2 From the mass spectrum, it can be seen that the molecular weight of the synthesized NMNH is consistent with that of

[0196] Example 2: Optimization of enzyme catalytic reaction conditions of glucose dehydrogenase mutant

[0197] For several mutation sites for efficient synthesis of NMNH, such as Y39, I75, A93, H157, and I195, one of the combination sites was randomly selected for experiments to optimize the enzyme-catalyzed synthesis of NMNH.

[0198] BL21-BsuGDH Y39Q / A93K / H157R (This strain carries a glucose dehydrogenase mutant with mutations at the Y39Q, A93K, and H157R sites) as the starting strain, after induced expression, cell disruption, and preparation of glucose dehydrogenase mutant enzyme solution. The prepared enzyme solution is used to subsequently investigate the enzyme catalytic performance of the glucose dehydrogenase mutant under different temperatures, different pH values, and different initial NMN concentrations.

[0199] (1) Catalytic performance of glucose dehydrogenase mutants at different temperatures

[0200] The performance of the prepared glucose dehydrogenase mutant in catalyzing NMN to synthesize NMNH at different temperatures was investigated. The enzyme catalytic system consists of 800μL of 50mM pH7.5 Tris-HCL buffer, 100μL of 60mM NMN, 50μL of 2M glucose, 50μL of 20M NaCl, and 1mg / ml of glucose dehydrogenase (calculated based on the total volume of the enzyme catalytic system). Enzyme-catalyzed reaction conditions: the temperatures were set at 25°C, 30°C, 37°C, and 40°C, and the shaker speed was 50rpm. The enzyme-catalyzed reaction started with the addition of the substrate NMN and ended after 6h. After the end, 1mL of sample was taken out from the reaction bottle, and the amount of NMNH generated in the reaction solution was detected by HPLC. Glucose dehydrogenase mutant BsuGDH Y39Q / A93K / H157R The results of catalyzing NMN to NMNH at different temperatures are shown in Table 2.

[0201] Table 2 Concentration and conversion rate of NMNH synthesized by glucose dehydrogenase mutants at different temperatures

[0202]

[0203] According to the conversion rate of glucose dehydrogenase mutants in synthesizing NMNH at different temperatures in Table 2, it can be seen that glucose dehydrogenase mutants can efficiently synthesize NMNH in the range of 25°C to 40°C.

[0204] (2) Catalytic performance of glucose dehydrogenase mutants at different pH

[0205] The performance of the prepared glucose dehydrogenase mutant in catalyzing the synthesis of NMNH from NMN at different pH values ​​was investigated. The enzyme catalytic system consists of 100 μL of 60 mM NMN, 50 μL of 2 M glucose, 50 μL of 20 M NaCl, 800 μL of buffer, and 1 mg / ml of glucose dehydrogenase (calculated based on the total volume of the enzyme catalytic system). Different pH values ​​were controlled by using buffers with different pH values: pH 7.5 (50 mM pH 7.5 Tris-HCL buffer), pH 8.0 (50 mM pH 8.0 Tris-HCL buffer), pH 8.5 (50 mM pH 8.5 Tris-HCL buffer), and pH 9.0 (50 mM pH 9.0 Tris-HCL buffer). Enzyme catalytic reaction conditions: temperature 30 ° C, shaker speed 50 rpm. The enzyme catalytic reaction started with the addition of substrate NMN and ended after 6 h. After the end, 1 mL of sample was taken out from the reaction bottle, and the amount of NMNH generated in the reaction solution was detected by HPLC. Glucose dehydrogenase mutant BsuGDH Y39Q / A93K / H157RThe results of catalyzing NMN to NMNH at different pH values ​​are shown in Table 3.

[0206] Table 3 Concentration and conversion rate of NMNH synthesized by glucose dehydrogenase mutants at different pH

[0207]

[0208] According to the conversion rate of glucose dehydrogenase mutants in synthesizing NMNH at different pH values ​​in Table 3, it can be seen that glucose dehydrogenase mutants can efficiently synthesize NMNH in the pH range of 7.5-10.0.

[0209] (3) The yield of NMNH synthesized by glucose dehydrogenase mutant enzymes at different initial NMN concentrations

[0210] The yield of NMNH synthesized by the prepared glucose dehydrogenase mutant at different initial NMN concentrations was investigated. The composition of the enzyme-catalyzed reaction system: 100 μL of NMN mother solution (the mother solution concentrations were 60 mM, 180 mM, 360 mM, and 540 mM, respectively), 50 μL of 2M glucose, 50 μL of 20M NaCl, 800 μL of 50 mM pH 8.0 Tris-HCL buffer, and 1 mg / ml of glucose dehydrogenase (calculated based on the total volume of the enzyme-catalyzed system). Enzyme-catalyzed reaction conditions: temperature 35 ° C, shaker 50 rpm. The enzyme-catalyzed reaction started with the addition of substrate NMN and ended after 12 hours of reaction. After the end, 1 mL of sample was taken out from the reaction bottle, and the amount of NMNH generated in the reaction solution was detected by HPLC. Glucose dehydrogenase mutant BsuGDH Y39Q / A93K / H157R The results of synthesizing NMNH at different initial NMN concentrations are shown in Table 4.

[0211] Table 4 Concentration and conversion rate of NMNH synthesized by glucose dehydrogenase mutants at different initial NMN concentrations

[0212]

[0213] According to the conversion rate of glucose dehydrogenase mutants in converting different initial concentrations of NMN to synthesize NMNH in Table 4, it can be seen that the glucose dehydrogenase mutants can efficiently synthesize NMNH at different concentrations, among which the conversion rate of synthesizing NMNH was the highest, reaching 92.32% when the initial NMN concentration was 6 mM.

[0214] Example 3: Glucose dehydrogenase mutant enzyme produces high NMNH

[0215] For the mutation sites Y39, I75, A93, H157, and I195 for efficient synthesis of NMNH, the Y39Q mutation glucose dehydrogenase mutant was selected to efficiently synthesize NMNH.

[0216] BL21-BsuGDH Y39Q / A93K / H157R (This strain carries a glucose dehydrogenase mutant with mutations at the Y39Q, A93K, and H157R sites) as the starting strain, after induced expression, cell disruption, and preparation of glucose dehydrogenase mutant enzyme solution. The prepared enzyme solution is used to catalyze NMN to synthesize NMNH.

[0217] The enzyme-catalyzed reaction system consists of: 100 μL of 360 mM NMN mother solution, 50 μL of 2 M glucose, 50 μL of 20 M NaCl, 800 μL of 50 mM pH 8.0 Tris-HCL buffer, and 1 mg / ml of glucose dehydrogenase (calculated based on the total volume of the enzyme-catalyzed system). Enzyme-catalyzed reaction conditions: temperature 35 °C, shaker 50 rpm. The enzyme-catalyzed reaction starts with the addition of substrate NMN. When the concentration of NMN in the reaction solution is lower than 3 mM, 100 μL of 360 mM NMN mother solution and 50 μL of 2 M glucose are added to the reaction system. After adding 4 times, the reaction is terminated. After the end, 1 mL of sample is taken out from the reaction bottle, and the amount of NMNH generated in the reaction solution is detected by HPLC. From the results of the liquid phase, it was determined that the glucose dehydrogenase mutant BsuGDH Y39Q / A93K / H157R The yield of NMNH catalyzed by NMN synthesis reached 41.2 g / L.

[0218] The above examples are for the purpose of illustrating the embodiments disclosed by the present invention and are not to be construed as limiting the present invention. In addition, the various modifications listed herein and the variations of the methods in the invention are obvious to those skilled in the art without departing from the scope and spirit of the present invention. Although the present invention has been specifically described in conjunction with various specific preferred embodiments of the present invention, it should be understood that the present invention should not be limited to these specific embodiments. In fact, various modifications as described above that are obvious to those skilled in the art to obtain the invention should be included within the scope of the present invention.

Claims

1. A glucose dehydrogenase mutant, characterized in that: The glucose dehydrogenase mutant is obtained by mutation at any one or more positions of the 39th, 51st, 75th, 93rd, 157th, 195th, 208th or 236th position of the amino acid sequence of the wild-type glucose dehydrogenase.

2. The glucose dehydrogenase mutant according to claim 1, characterized in that The wild-type glucose dehydrogenase is a glucose dehydrogenase of a microorganism; preferably, the amino acid sequence of the wild-type glucose dehydrogenase is shown in SEQ ID NO.

1.

3. The glucose dehydrogenase mutant according to claim 1, characterized in that The glucose dehydrogenase mutant is obtained by a combined mutation at positions 39 and 93, or a combined mutation at positions 39 and 75, or a combined mutation at positions 39 and 157, or a combined mutation at positions 39, 93 and 157, or a combined mutation at positions 39, 93 and 75, or a combined mutation at positions 93 and 208, or a combined mutation at positions 51 and 157, or a combined mutation at positions 93 and 157 in the amino acid sequence of the wild-type glucose dehydrogenase.

4. The glucose dehydrogenase mutant according to claim 1, characterized in that Also includes any one or more of the following features: 1) the mutation at position 39 is selected from Y39Q or Y39N; 2) the mutation at position 51 is selected from E51Q; 3) the mutation at position 75 is selected from I75S or I75L; 4) the mutation at position 93 is selected from A93K or A93P; 5) the mutation at position 157 is selected from H157R or H157Q; 6) the mutation at position 195 is selected from I195E or I195L; 7) the mutation at position 208 is selected from D208N or D208Y; 8) The mutation at position 236 is selected from A236V.

5. The glucose dehydrogenase mutant according to claim 1, characterized in that The glucose dehydrogenase mutant is obtained by performing any of the following mutations on the wild-type glucose dehydrogenase amino acid sequence shown in SEQ ID NO.1: Y39Q single mutation, Y39N single mutation, Y39Q / A93K combined mutation, Y39Q / I75L combined mutation, Y39N / I75S combined mutation, Y39Q / A93K / H157R combined mutation, and Y39N / A93P / H157Q combined mutation.

6. An isolated polynucleotide, characterized in that The polynucleotide encodes the glucose dehydrogenase mutant according to any one of claims 1-5.

7. The isolated polynucleotide according to claim 6, characterized in that The polynucleotide comprises the nucleotide sequence shown in SEQ ID NO.30; preferably, the polynucleotide comprises the nucleotide sequence shown in SEQ ID NO.30-31; More preferably, the nucleotide sequence of the polynucleotide is as shown in SEQ ID NO.

32.

8. A nucleic acid construct, characterized in that The nucleic acid construct comprises the isolated polynucleotide of claim 6 or 7.

9. A cell, characterized in that The cell contains the nucleic acid construct of claim 8 or an exogenous polynucleotide as shown in any one of SEQ ID Nos. 30 to 32 integrated into the genome.

10. The method for preparing a glucose dehydrogenase mutant according to any one of claims 1 to 5, characterized in that: The steps include: The cell of claim 9 is cultured to induce the expression of the glucose dehydrogenase mutant, and after the induction, the bacterial cells are collected and crushed to obtain an enzyme solution of the glucose dehydrogenase mutant.

11. Use of the glucose dehydrogenase mutant according to any one of claims 1 to 5, the isolated polynucleotide according to claim 6 or 7, the nucleic acid construct according to claim 8, or the cell according to claim 9 in preparing NMNH.

12. The use according to claim 11, characterized in that The use is to catalyze NMN to prepare NMNH.

13. A method for preparing NMNH, characterized in that: The preparation method comprises using the glucose dehydrogenase mutant described in any one of claims 1-5 to catalyze NMN, thereby obtaining NMNH.

14. The preparation method according to claim 13, characterized in that: The preparation method also includes any one or more of the following features: 1) The temperature for catalyzing NMN using the glucose dehydrogenase mutant is 25°C-40°C; 2) Using glucose dehydrogenase mutants to catalyze NMN at a pH of 6-10; 3) When the glucose dehydrogenase mutant is used to catalyze NMN, the final concentration of the glucose dehydrogenase mutant is 0.5 mg / mL to 200.0 mg / mL based on the total volume of the catalytic system; 4) When the glucose dehydrogenase mutant is used to catalyze NMN, the initial concentration of NMN is 6 to 60 mM based on the total volume of the catalytic system; 5) The catalytic system using the glucose dehydrogenase mutant to catalyze NMN includes: glucose dehydrogenase mutant, NMN, glucose, NaCl, and pH buffer.

15. The preparation method according to claim 14, characterized in that: The preparation method also includes any one or more of the following features: 1) The catalytic system using the glucose dehydrogenase mutant to catalyze NMN includes: a glucose dehydrogenase mutant, NMN, glucose, NaCl, and a pH buffer solution, wherein the concentration of glucose in the catalytic system is 0.05 to 2.0 mol / L, and / or the concentration of NaCl is 0.1 to 4.0 mol / L, based on the total volume of the catalytic system; 2) Adding NMN and / or glucose during the catalytic process; preferably, the number of times of adding NMN and / or glucose is 1 to 10 times.

Images