Transgenic Synechocystis strains with enhanced stress resistance and their application in sewage treatment

Abstract

The present invention discloses a transgenic Synechocystis sp. strain with enhanced stress resistance and its application in sewage treatment, belonging to the technical field of microbiology. In the present invention, the MntH gene is integrated into the genome of Synechocystis sp. PCC6803, thereby constructing transgenic Synechocystis sp. PCC6803. Through Cr<supgt;6+< / supgt; metal ion and hydrogen peroxide stress, the difference in stress resistance between the modified and unmodified strains was verified. The results showed that inserting the functional element gene MntH into the genome of Synechocystis sp. PCC6803 effectively improved the stress resistance of the strain. Under the stress culture of hydrogen peroxide or Cr<supgt;6+< / supgt; metal ions, the transgenic strain showed better stress resistance and better growth conditions than the wild-type strain. At the same time, the contents of photosynthetic pigments, proteins, etc. related to the growth of the transgenic strain were higher than those of the wild-type strain. The present invention provides a technical means for constructing transgenic algal strains with enhanced stress resistance and studying the physiological and metabolic functions of microalgae.

Description

Technical Field

[0001] The present invention relates to a Synechocystis algal strain with enhanced stress resistance modified by synthetic biology transgenic technology, and also relates to the application of the Synechocystis algal strain in sewage treatment. The present invention belongs to the technical field of microorganisms. Background Art

[0002] Synechocystis sp PCC6803 ( Synechocystis sp PCC6803) is a prokaryote capable of photosynthesis, which can be autotrophic or heterotrophic, and also has the characteristics of fast growth and convenient operation, and is an ideal receptor for cyanobacteria genetic engineering. In the past few decades, the research progress on cyanobacteria has shifted from gene expression to genome editing, metabolic regulation or synthetic biology. Cyanobacteria strains have been further developed under multi-omics data analysis such as bioinformatics and genomics, and a powerful genetic engineering platform will be constructed to obtain strains with higher growth rate, better carbon fixation ability, more high-value compounds, better carbon dioxide tolerance and high temperature tolerance, and promote its applications in environmental remediation, synthetic biology and other aspects.

[0003] In the past decade, highly photosynthetic microalgae have been widely used in synthetic biology, such as the production of biofuels and chemical products. The research and development of cyanobacteria synthetic biotechnology are becoming more and more rapid and mature, and have applications in sewage treatment, biosynthesis, agriculture and other aspects. Synechocystis sp PCC6803 has broad application prospects in synthetic biology. During the long-term evolution process, in order to adapt to the changing living environment, Synechocystis sp PCC6803 has evolved a variety of regulatory mechanisms, and the cells initiate different metabolic regulations to cope with different stress conditions. Strengthening the development and optimization of the cyanobacteria synthetic biology toolbox and selecting and improving the chassis performance of cyanobacteria are of great significance for production and application, and have an important promoting significance for the development of cyanobacteria light-driven carbon fixation synthesis technology. Cyanobacteria will face different environmental stresses in applications such as environmental remediation, biosynthesis and agriculture, and the improvement of its stress resistance performance is very important for its application.

[0004] Microalgae have great potential in developing sustainable technologies for removing inorganic and organic pollutants from the environment. This potential is attributed to various mechanisms such as biosorption, bioaccumulation, and biodegradation, involving different functional groups, proteins, and peptides responsible for pollutant binding and detoxification. Heavy metal pollution in sewage has become a major aspect of heavy metal pollution, among which cadmium pollution is the most common. In recent years, the application of biosorption technology in the treatment of heavy metal-polluted water has received extensive attention from researchers. Biosorption refers to the non-specific binding of heavy metal ions to the cell surface or extracellular proteins or polysaccharides. Among these microorganisms, algae have unique advantages such as high affinity, numerous binding sites, and large surface area, and can efficiently adsorb heavy metals. Using microalgae for bioremediation of heavy metals has become a research hotspot in recent years. For example, the fungus-algae symbiotic system (FASS) is usually used to assist in immobilizing algae and enhancing the adsorption of heavy metals. When adsorbing heavy metal ions, they are usually poisoned by heavy metals. By modifying microalgae and using synthetic biology and omics to create engineered microalgae species with stronger tolerance to toxic pollutants, it is beneficial to purify the environment; compared with wild-type microalgae species, they have a higher absorption or conversion rate of pollutants, which can further expand the application of microalgae in sewage treatment.

[0005] Therefore, in the present invention, Synechocystis sp. PCC6803 with enhanced stress resistance was obtained by inserting the exogenous gene MntH into the genome of Synechocystis sp. PCC6803, providing an effective technical means for constructing transgenic algal strains with strong stress resistance and sewage treatment. Summary of the Invention

[0006] One object of the present invention is to provide a Synechocystis sp. algal strain with enhanced stress resistance modified by synthetic biology transgenic technology.

[0007] Another object of the present invention is to provide the application of the Synechocystis sp. algal strain with enhanced stress resistance in studying the physiological and metabolic functions of microalgae, constructing transgenic algal strains with strong stress resistance, and sewage treatment.

[0008] To achieve the above object, the present invention adopts the following technical means:

[0009] The present invention integrates the manganese transporter MntH gene of Salmonella typhimurium ( S. Typhimurium ) SL1344 into the genome of Synechocystis sp. PCC6803, thereby constructing MntH transgenic Synechocystis sp. PCC6803. The growth curves of the newly constructed MntH transgenic algal strain and the wild-type Synechocystis sp. PCC6803 were measured to judge their growth differences. At the same time, through Cr 6+Wild-type and MntH transgenic algal strains were stressed with metal ions and hydrogen peroxide, and physiological indexes such as chlorophyll between the wild-type and MntH transgenic algal strains were measured to verify the difference in stress resistance of the algal strains before and after transformation. The results showed that inserting the functional element gene MntH into the genome of Synechocystis sp. PCC6803 effectively improved the stress resistance of the algal strain. Under normal culture conditions, there was no difference in growth between the MntH transgenic algal strain and the wild-type algal strain; while under the stress of hydrogen peroxide or Cr 6+ When cultured under metal ion stress, the MntH transgenic algal strain showed better stress resistance, with a better growth condition than the wild-type algal strain. At the same time, the contents of various photosynthetic pigments and proteins related to growth in the MntH transgenic algal strain were higher than those in the wild-type algal strain.

[0010] Based on the above research, the present invention proposes the application of the manganese transporter encoding gene MntH of Salmonella typhimurium SL1344 in constructing transgenic Synechocystis sp. PCC6803 with enhanced stress resistance.

[0011] Among them, preferably, the stress resistance includes resistance to heavy metal ion stress and antioxidant stress.

[0012] Among them, preferably, the manganese transporter encoding gene MntH of Salmonella typhimurium SL1344 is inserted into the genome of Synechocystis sp. PCC6803 to improve the stress resistance of Synechocystis sp. PCC6803.

[0013] Among them, preferably, the nucleotide sequence of the manganese transporter encoding gene MntH of Salmonella typhimurium SL1344 is as shown in SEQ ID NO: 1.

[0014] Among them, preferably, the manganese transporter encoding gene MntH of Salmonella typhimurium SL1344 is regulated by the promoter PpsbA2.

[0015] Furthermore, the present invention also proposes a transgenic Synechocystis sp. PCC6803 with enhanced stress resistance. The manganese transporter encoding gene MntH of Salmonella typhimurium SL1344 is inserted into the genome of the transgenic Synechocystis sp. PCC6803, and the nucleotide sequence of the manganese transporter encoding gene MntH of Salmonella typhimurium SL1344 is as shown in SEQ ID NO: 1.

[0016] Among them, preferably, the transgenic Synechocystis sp. PCC6803 is obtained by inserting a recombinant fragment containing an upstream fragment, the promoter P psbA2 , the MntH gene 、Kan , a resistance gene and a downstream fragment into the genome of Synechocystis sp. PCC6803 by homologous recombination.

[0017] Among them, preferably, the recombinant fragment containing the upstream fragment, promoter P psbA2 , MntH gene 、Kan , resistance gene and downstream fragment has the nucleotide sequence shown in SEQ ID NO: 2.

[0018] Furthermore, the present invention also provides a method for constructing the transgenic Synechocystis PCC6803, comprising the following steps:

[0019] (1) Construction of the pMD19T- MntH recombinant plasmid:

[0020] (1) Using the genome of Synechocystis PCC6803 as a template, the upstream homologous arm up and downstream homologous arm down fragments are amplified respectively using the primer pairs up-F / up-R and down-F / down-R;

[0021] (2) Using pET-28a as a template, the Kan resistance fragment is amplified using the primer pair Kan -F / Kan -R, and using the genome of Synechocystis PCC6803 as a template, the promoter Ppsb -F / Ppsb -R is used to amplify the promoter ppsbA2 fragment. Then, using the primer pair up-F / down-R, an overlapping PCR is performed with the fragments up, ppsbA2 , kan , down and other proportional mixtures as templates to amplify the up- ppsbA-kan-down fragment, and then it is ligated to the pMD19T vector using T4 ligase and transformed into Escherichia coli TG1; then, PCR detection and verification are performed using the primer pair up-F / down-R, and the plasmid is extracted after culturing the identified correct strain. The correctly constructed plasmid is named pMD19T- ppabA-kan ;

[0022] (3) Using a single colony of Salmonella typhimurium SL1344 as a template, the MntH fragment is amplified using the primer pair MntH-F / MntH-R; the plasmid pMD19T- ppabA-kan and the MntH fragment are respectively digested with the restriction enzymes Bg III and Spe I, and then recovered, followed by ligation and transformation into Escherichia coli TG1, and PCR detection is performed using the primer pair Ppsb -F / MntH-R. After culturing the detected correct strain, the plasmid is extracted and sequenced, and the correctly constructed plasmid is named pMD19T- MntH ;

[0023] The sequences of the above-mentioned primer pairs are as follows:

[0024] ;

[0025] (2) Obtaining of MntH transgenic Synechocystis:

[0026] (1) Preparation of mixed cellulose ester membrane: The mixed cellulose ester membrane was rinsed three times with distilled water, placed in a glass dish and boiled for 5 min, and then sterilized for later use;

[0027] (2) Preparation of algal species: A small amount of Synechocystis PCC6803 algal species was scraped from the BG11 plate and cultured in BG-11 liquid medium. When the algal solution grew to the logarithmic phase, 10 mL of the algal solution was taken into a 15 mL centrifuge tube and centrifuged at 1800 g for 5 min;

[0028] (3) The algal cell precipitate was washed three times with fresh BG-11 liquid medium, and 400 µL of BG-11 liquid medium was added to resuspend the algal cells;

[0029] (4) pMD19T- MntH was added to the resuspended algal cells. After mixing, it was incubated at 30 °C and 1400 lux for 6 - 8 h;

[0030] (5) A treated mixed cellulose ester membrane was placed on the BG-11 solid medium without resistance, ensuring that there were no air bubbles between the membrane and the plate. 200 µL of the incubated algal cells was evenly spread on the surface of the mixed cellulose ester membrane;

[0031] (6) After light culture for 18 - 24 h, the membrane was transferred to the BG-11 solid medium containing kanamycin and continued to be light-cultured;

[0032] (7) After 10 - 14 d, single algal colonies were picked and streaked on the BG-11 solid medium containing kanamycin and continued to be cultured;

[0033] (8) The streaked single algal colonies were inoculated into the BG-11 liquid medium containing kanamycin and cultured. Then their DNA was extracted and PCR detection was carried out using specific primers MntH -F / R. If the algal strain with the MntH gene band was amplified, it indicated that the exogenous target gene was correctly transferred, and it was the screened MntH transgenic Synechocystis.

[0034] Finally, the present invention also proposes the application of the transgenic Synechocystis PCC6803 in the following aspects:

[0035] (1) The application of the transgenic Synechocystis PCC6803 in constructing transgenic algal strains with enhanced stress resistance;

[0036] (2)Use of the transgenic Synechocystis sp. PCC6803 as a model strain in studying the physiological and metabolic functions of microalgae;

[0037] (3)Use of the transgenic Synechocystis sp. PCC6803 in sewage treatment.

[0038] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0039] 1. The present invention identifies the functional element MntH available in Synechocystis sp. PCC6803. By inserting the foreign gene MntH into the genome of Synechocystis sp. PCC6803, the stress resistance of Synechocystis sp. PCC6803 can be significantly enhanced. Through heavy metal ion stress and hydrogen peroxide stress, the differences in physiological index data are analyzed, and the differences in stress resistance capabilities among different algal strains are analyzed. The results show that under Cr 6+ stress, compared with the wild-type algal strain, the growth state of the transgenic algal strain is better, and the contents of total protein, phycobiliprotein, chlorophyll a, carotenoid, SOD, and CAT in the algal strain are significantly higher than those of the wild-type algal strain. Under hydrogen peroxide stress, the ROS content of the wild-type algal strain gradually increases with the increase in hydrogen peroxide concentration, while the ROS content of the MntH algal strain changes less, and the growth and survival rates of the MntH algal strain are better than those of the wild-type algal strain.

[0040] 2. Using the transgenic Synechocystis sp. PCC6803 with application potential proposed by the present invention as a platform, synthetic biotechnology is systematically applied to develop new algal species that are "editable, controllable, and scalable", and the physiological and metabolic functions of Synechocystis sp. PCC6803 are deeply understood, redesigned, and directionally modified, laying a foundation for the research of microalgae synthetic biology. Brief Description of the Drawings

[0041] Figure 1 Construction and identification of the transgenic algal strain (MntH);

[0042] In the figure: A is the monoclonal map screened during the transformation of Synechocystis sp. PCC6803; B is the colony PCR detection result of the transgenic algal strain, where 1-6 are sample numbers, M is the DNA marker, and as shown, sample No. 3 is positive;

[0043] Figure 2 Growth situation diagrams of the wild-type algal strain (WT) and the transgenic algal strain (MntH) under normal and different concentrations of chromium ion stress culture conditions;

[0044] In the figure: A is the growth curve under normal culture; B is the growth curve under 1 mg / L Cr 6+ stress; C is the growth curve under 1.75 mg / L Cr 6+ stress; D is the growth curve under 2 mg / L Cr6+ Growth curves under stress; E is 4 mg / L Cr 6+ Growth curves under stress, F is different concentrations of Cr 6+ Growth of the two algal strains was affected to varying degrees;

[0045] Figure 3 is Cr 6+ Physiological index diagrams of wild-type algal strain (WT) and transgenic algal strain (MntH) under Cr stress;

[0046] In the figure: A is Cr 6+ Content of total protein in algal strain under Cr stress; B is Cr 6+ Comparison diagram of total protein content in algal strain under the influence of Cr stress; C is Cr 6+ Content of phycobiliprotein (PBP) under Cr stress; D is Cr 6+ Content of extracellular polymeric substances (EPS) under Cr stress; P (Probability value) is the probability of obtaining the sample observation result or a more extreme result when the null hypothesis is true. In the figure indicates P < 0.05 (the lowest significance level), indicates P < 0.001 (the highest significance level);

[0047] Figure 4 is Cr 6+ Diagrams of carotenoid and chlorophyll a contents of wild-type algal strain (WT) and transgenic algal strain (MntH) under Cr stress;

[0048] In the figure: A is the determination of chlorophyll a; B is the determination of carotenoid; In the figure indicates P < 0.05, indicates P < 0.001;

[0049] Figure 5 is Cr 6+ Diagrams of related oxidative physiological indexes such as reactive oxygen species of wild-type algal strain (WT) and transgenic algal strain (MntH) under Cr stress;

[0050] In the figure: A is Cr 6+ Content of reactive oxygen species (ROS) in algal strain affected by Cr stress; B is Cr 6+ Comparison diagram of superoxide dismutase (SOD) in algal strain under Cr stress; C is Cr 6+ Content of catalase (CAT) in algal strain under Cr stress; In the figure indicates P < 0.05, indicates P < 0.01 (moderate significance level);

[0051] Figure 6Growth difference graph of wild-type algal strain (WT) and transgenic algal strain (MntH) under hydrogen peroxide stress;

[0052] In the figure: A shows the content of reactive oxygen species (ROS) in algal strains affected by hydrogen peroxide stress; B shows the growth curve graph of algal strains under hydrogen peroxide stress; C shows the survival rate graph of algal strains under hydrogen peroxide stress; D shows the intracellular ion content graph of algal strains under hydrogen peroxide stress. In the figure indicates P < 0.05, indicates P < 0.001. Specific implementation manner

[0053] The present invention will be further described below through examples, and its purpose is only to better understand the research content of the present invention rather than limit the protection scope of the present invention. Unless otherwise specified in the following examples, they are all conventional experimental methods and operation steps in the art.

[0054] The main sources of experimental materials are as follows:

[0055] Synechocystis sp. PCC6803( Synechocystis sp. PCC6803) used in this study was purchased from the Freshwater Algae Culture Collection of the Institute of Hydrobiology, Chinese Academy of Sciences.

[0056] Salmonella typhimurium( S. Typhimurium ) SL1344 used in this study was preserved and provided by the Laboratory of Agricultural and Environmental Microbiology, College of Life Sciences, Northwest A&F University. This strain has been disclosed in many patent documents and non-patent documents, such as the patent application with the publication number CN113444739A and the invention name "Construction of a broad-host plasmid for inducible expression of green fluorescent protein and its application in fluorescence tracing", and non-patent documents: 1) Wang Wenjie, Du Fuxi, Yu Chuan, etc. Construction and characterization of recombinant attenuated Salmonella typhimurium SL1344ΔcrpΔasd(pYA3493-VP2) expressing feline panleukopenia virus VP2 protein [J]. Chinese Veterinary Science, 2023, 53 (02): 189-197. DOI:10.16656 / j.issn.1673-4696.2023.0029. And 2) Li Rongxu. Construction of crp and hfq gene deletion strains of goose-derived Salmonella typhimurium and determination of their biological and immunological characteristics [D]. Foshan University of Science and Technology, 2020. DOI:10.27960 / d.cnki.gfskj.2020.000054.

[0057] Escherichia coli TG1 was used for DNA cloning and plasmid construction and was purchased from Beijing Solarbio Science & Technology Co., Ltd.

[0058] The pMD19T plasmid was purchased from TAKARA Bio Inc. (Beijing).

[0059] Restriction endonucleases were all purchased from Takara Bio Inc. (Beijing, China).

[0060] Universal DNA Purification and Recovery Kit (DP210), Plasmid Mini-Preps Kit (DP103), and Bacterial Genomic DNA Extraction Kit (DP302) were all purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.

[0061] DNA Ligation Kit (AG11801) was purchased from Hunan Aikerei Bioengineering Co., Ltd.

[0062] Total SOD Activity Detection Kit (S0109), Reactive Oxygen Species Detection Kit (S0033S), and Lipid Oxidation (MDA) Detection Kit (S0131S) were all purchased from Beyotime Biotechnology Co., Ltd.

[0063] Catalase (CAT) Activity Detection Kit (D799598-0100) was purchased from Sangon Biotech (Shanghai) Co., Ltd.

[0064] The cyanobacteria BG-11 freshwater liquid medium (referred to as "BG-11 liquid medium") was purchased from Sigma-Aldrich (Shanghai) Trading Co., Ltd., with the product number C3061. Adding an appropriate amount of agar (e.g., 15-20 g / L) to the BG-11 liquid medium gives the BG-11 solid medium.

[0065] Example 1 Construction of MntH Transgenic Synechocystis sp. PCC6803

[0066] 1. Method

[0067] (1) Construction of the recombinant plasmid pMD19T- MntH Using the genome of Synechocystis sp. PCC6803 (GCF_000009725.1) as a template, the upstream homologous arm up and downstream homologous arm down fragments were amplified using the primer pairs up-F / up-R and down-F / down-R respectively; using the plasmid pET-28a as a template, the resistance fragment was amplified using the primer pair

[0068] -F / Synechocystis -R; using the genome of Synechocystis sp. PCC6803 as a template, the promoter Kan -F / Kan -R was amplified. Then, using the primer pair up-F / down-R, with the fragments up, Kan resistance fragment, and Ppsb -F / Ppsb -R amplified the promoter ppsbA2 fragment. After that, using the primer pair up-F / down-R with the fragments up, ppsbA2 , kan, using the down equal - proportion mixture as a template for overlapping PCR to amplify up-ppsbA- kan-down a fragment (the sequence is shown in SEQ ID NO.2), then using T4 ligase to ligate it with the pMD19T vector and transform it into Escherichia coli TG1. Then use the primer pair up - F / down - R for PCR detection and verification. After identifying the correct strain, culture it and extract the plasmid. Name the correctly constructed plasmid pMD19T - ppabA-kan . Using a single colony of Salmonella typhimurium ( S. Typhimurium ) SL1344 as a template, use the primer pair MntH - F / MntH - R to amplify MntH a fragment; Use restriction endonucleases ppabA-kan pMD19T - MntH and the Bg fragment for enzymatic digestion with Spe III and MntH I, then recover them. Subsequently, ligate and transform them into Escherichia coli TG1, and use the primer pair ppsb - F / Ppsb - R for PCR detection and verification. After verifying the correct strain, culture it, extract the plasmid and sequence it using MntH seq F. Name the correctly constructed plasmid pMD19T -

[0069] ;

[0070] The PCR amplification system is as follows:

[0071] 2×Ape Mix 25 μL, template DNA 2 μL, primer F 2 μL, primer R 2 μL, ddH2O 19 μL, a total of 50 μL;

[0072] The PCR amplification program is as follows:

[0073] Pre - denature at 95 °C for 5 min, denature at 95 °C for 30 s, anneal at 50 °C for 30 s, extend at 72 °C for 1 min. After 31 cycles, final extension at 72 °C for 10 min.

[0074] (II) Obtaining MntH transgenic algal strains:

[0075] (1) Preparation of mixed cellulose ester membrane: Rinse the mixed cellulose ester membrane three times with distilled water, place it in a glass dish and boil for 5 min, and reserve it after sterilization.

[0076] (2) Preparation of algal seeds: Scrape a small amount of Synechocystis PCC6803 algal seeds from the BG11 plate and culture them in BG - 11 liquid medium. When the algal solution grows to the logarithmic phase (OD730 When (the ratio is) 0.6 - 0.8, take 10 mL of the algal solution and place it in a 15 mL centrifuge tube, and centrifuge it at a centrifugal force of 1800 g for 5 minutes.

[0077] (3) Wash the algal cell precipitate three times with fresh BG - 11 liquid medium, and add 400 μL of BG - 11 liquid medium to resuspend the algal cells.

[0078] (4) Add plasmid pMD19T - MntH to the resuspended algal cells, mix well, and incubate at 30 °C and 1400 lux for 6 - 8 h.

[0079] (5) Lay a treated mixed cellulose ester membrane on the BG - 11 solid medium without resistance, ensure there are no air bubbles between the membrane and the plate, and evenly spread 200 μL of the incubated algal cells on the surface of the mixed cellulose ester membrane.

[0080] (6) After light incubation for 18 - 24 h, transfer the membrane to the BG - 11 solid medium containing 50 μg / mL kanamycin and continue light incubation.

[0081] (7) After 10 - 14 d, pick single algal colonies and streak them on the BG - 11 solid medium containing 50 μg / mL kanamycin and continue culturing.

[0082] (8) Inoculate the streaked single algal colonies into the BG - 11 liquid medium containing kanamycin for culturing and growth, extract their DNA, and perform PCR detection with specific primers MntH - F / R. If Figure 1 , for the algal strains that amplify the MntH gene band, it indicates that the exogenous target gene has been correctly transferred, and the obtained MntH transgenic algal strains are the screened ones.

[0083] Example 2 Determination of the growth curves of wild - type Synechocystis sp. PCC6803 (WT) and MntH transgenic algal strains (MntH) under different concentrations of chromium ion stress

[0084] Inoculate the MntH transgenic algal strains (MntH) constructed in Example 1 and wild - type Synechocystis sp. PCC6803 (WT) simultaneously into 10 mL of BG - 11 liquid medium, and then place them in a light incubator for culturing. Measure the OD 730 value after 10 days, adjust the OD 730 values to be the same, and then uniformly transfer them to 10 mL of BG - 11 liquid medium. Add metal ions Cr 6+ at 0, 1, 1.75, 2, 4 mg / L respectively to the BG - 11 liquid medium, and place them in a light shaker for culturing, with three parallels in each group. Ensure the initial OD 730Consistent, the OD value was measured every 12 h, and the cells were continuously cultured for 10 days to plot the growth curve. 730

[0085] To determine the effects of different concentrations of Cr on the growth of algal strains, the growth of algal strains was first measured under 0, 1, 2, 4, 8 mg / L Cr stress. 6+ 6+ Since the growth of algal strains was not significantly affected by 1 mg / L Cr stress, 6+ and the growth inhibition of algal strains by 2 mg / L Cr stress was too strong, 6+ therefore, the growth of algal strains was measured under 1.25, 1.5, 1.75 mg / L Cr stress. 6+ It was found that the growth difference caused by 1.75 mg / L Cr stress on algal strains was significant but the growth inhibition was not too strong. 6+ Subsequently, this concentration was selected for the determination of physiological indexes.

[0086] As Figure 2 seen, with the increase of Cr concentration, 6+ the growth states of wild-type algal strains and MntH transgenic algal strains gradually deteriorated. With the increase of Cr concentration, 6+ compared with wild-type algal strains, the growth state of MntH transgenic algal strains was better. It should be that the expression of the exogenous gene MntH helped the algal strains relieve the ROS accumulation caused by heavy metal ion stress.

[0087] Example 3 Determination of physiological indexes of wild-type Synechocystis sp. PCC6803 (WT) and MntH transgenic algal strains (MntH) under 1.75 mg / L Cr stress 6+

[0088] The contents of total protein, phycobiliproteins (PBP), extracellular polymeric substances (EPS), chlorophyll a, carotenoids, reactive oxygen species (ROS), superoxide dismutase (SOD), and catalase (CAT) of wild-type algal strains and MntH transgenic algal strains were measured respectively.

[0089] As Figure 3 shown in Figure 3It can be seen from B that the total protein content of the wild-type algal strain is 0.78 mg / L, and the total protein content of the MntH transgenic algal strain is 0.96 mg / L. The total protein content of the MntH transgenic algal strain is higher than that of the wild-type algal strain. It is thus speculated that the insertion of the exogenous gene MntH has a certain impact on the stress resistance and protein expression of the algal strain.

[0090] It can be seen from Figure 3 C that the PBP content of the wild-type algal strain is low, while that of the MntH transgenic algal strain is high, indicating that the phycobilisome of the wild-type algal strain is more damaged and the PBP content is affected; while the phycobilisome in the MntH transgenic algal strain is less damaged and the PBP content is higher than that of the wild-type algal strain, corresponding to the growth situation.

[0091] It can be seen from Figure 3 D that under the stress of heavy metal Cr 6+ the difference in extracellular polymeric substances between the wild-type algal strain and the MntH transgenic algal strain is small. It is thus speculated that the algal strain does not relieve the stress it receives by secreting extracellular polymeric substances, but regulates growth by transporting heavy metal ions into the cell and binding heavy metal ions or changing the intracellular redox state.

[0092] It can be seen from Figure 4 A that compared with the MntH transgenic algal strain, the growth of the wild-type algal strain is in a weak state, and the content of photosynthetic pigments it contains is also less. The chlorophyll content is 7.29 µg / mL. The photosynthetic pigment content of the MntH transgenic algal strain is higher. The chlorophyll content of the MntH transgenic algal strain is 9.88 µg / mL, which is 1.36 times that of the wild-type algal strain.

[0093] It can be seen from Figure 4 B that the carotenoid content of the wild-type algal strain is 2.43 µg / mL. The carotenoid content of the MntH transgenic algal strain is 2.87 µg / mL, which is 1.18 times that of the wild-type algal strain. Under the same culture conditions, the growth of the wild-type algal strain is slower and the color of the wild-type algal strain culture solution is lighter; the MntH transgenic algal strain has better stress resistance than the wild-type algal strain, and its photosynthetic pigment content is also more than that of the wild-type algal strain.

[0094] It can be seen from Figure 5 A that compared with the wild-type algal strain, the ROS content of the MntH transgenic algal strain is significantly reduced, indicating that its stress resistance is significantly improved. Synechocystis sp. PCC6803 will initiate enzymatic and non-enzymatic protection mechanisms when encountering excessive ROS, thus protecting the body from oxidative damage.

[0095] It can be seen from Figure 5It can be seen from B that there are obvious differences in the superoxide dismutase (SOD) activity among algal strains. The SOD activity of the wild-type algal strain is 3.48 U / mg, and that of the MntH transgenic algal strain is 4.09 U / mL, which is 1.17 times that of the wild-type algal strain. Under heavy metal ion stress, intracellular heavy metal ions accumulate, leading to an increase in ROS in the body, and then inducing an increase in SOD expression. The expression of the exogenous MntH gene causes heavy metal ions to accumulate rapidly in the body, thus promoting the expression of SOD. Therefore, the SOD activity is higher than that of the wild-type algal strain.

[0096] It can be seen from Figure 5 C that, compared with the MntH transgenic algal strain, the CAT activity of the wild-type algal strain is lower. The CAT activity of the wild-type algal strain is 0.89 U / mg, and that of the MntH transgenic algal strain is 1.11 U / mg, which is 1.25 times that of the wild-type algal strain. Heavy metal ions cause an increase in the ROS content. The increase in the ROS content promotes the expression of SOD, and SOD can dismutate O 2- into hydrogen peroxide; the increase in the hydrogen peroxide content causes an increase in CAT expression, and CAT can scavenge hydrogen peroxide in the body.

[0097] Example 4 Determination of Physiological Indexes of Wild-Type Synechocystis sp. PCC6803 and MntH Transgenic Algal Strains under Hydrogen Peroxide Stress

[0098] The constructed MntH transgenic algal strain and wild-type Synechocystis sp. PCC6803 were simultaneously inoculated into 10 mL of BG-11 liquid medium, and 0 mmol / L, 1 mmol / L, 2 mmol / L, and 4 mmol / L of hydrogen peroxide were added to the BG-11 liquid medium respectively. They were cultured in a light shaker, with three replicates in each group. The reactive oxygen species, growth curve, survival rate, and intracellular ion content of wild-type Synechocystis sp. PCC6803 and MntH transgenic algal strains under hydrogen peroxide stress were measured.

[0099] It can be seen from Figure 6 A that as the hydrogen peroxide concentration increases, the difference in the initial ROS content in the two algal strains is small, and then it increases; the ROS content of the wild-type algal strain gradually increases with the increase in the hydrogen peroxide concentration, while the change in the ROS content of the MntH algal strain is small, which should be due to the exogenous gene playing a role in resisting oxidative stress. When stressed with 4 mM hydrogen peroxide, the difference in the ROS content between the two algal strains is more obvious. Therefore, the subsequent experiments were carried out under 4 mM hydrogen peroxide stress.

[0100] It can be seen from Figure 6 B that under 4 mM hydrogen peroxide stress, there are slight differences in the growth between the wild-type algal strain and the MntH transgenic algal strain. The growth of the MntH algal strain is better than that of the wild-type algal strain.

[0101] As can be seen from Figure 6 C, under the stress of 4 mM hydrogen peroxide, the growth of the wild-type algal strain and the MntH transgenic algal strain was inhibited. After measuring the stress for 12 hours, the survival rates of the wild-type algal strain and the MntH transgenic algal strain were determined. The survival rate of the MntH transgenic algal strain was higher than that of the wild-type algal strain, and its stress resistance to oxidative stress was better.

[0102] As can be seen from Figure 6 D, the Mn ion content in the MntH transgenic algal strain was lower than that in the wild-type algal strain. It indicates that MntH helps bacteria transport manganese ions in an oxidative stress environment.

[0103] By inserting foreign genes into the genome of Synechocystis sp. PCC6803 MntH , the change of the oxidative stress ability in algal cells was caused, and then its ability to resist oxidative stress was enhanced.

Claims

1. Salmonella Typhimurium ( S.Typhimurium ) The manganese transporter encoding gene MntH of SL1344 was used in constructing transgenic Synechocystis with enhanced resistance to chromium ion stress and antioxidant stress. Synechocystis sp.) PCC6803, the nucleotide sequence of the manganese transporter encoding gene MntH of the Salmonella typhimurium SL1344 is shown in SEQ ID NO:

1.

2. The use according to claim 1, characterized in that The manganese transporter encoding gene MntH of the Salmonella typhimurium SL1344 is inserted into the genome of Synechocystis PCC6803, thereby improving the chromium ion stress resistance and oxidative stress resistance of Synechocystis PCC6803.

3. The use according to claim 1, characterized in that The manganese transporter encoding gene MntH of the Salmonella typhimurium SL1344 is regulated by the promoter PpsbA2.

4. A transgenic Synechocystis sp. PCC6803 with enhanced stress resistance, characterized in that: The transgenic Synechocystis PCC6803 is obtained by inserting a recombinant fragment comprising an upstream fragment, a promoter PpsbA2, a MntH gene, a Kan resistance gene and a downstream fragment into the genome of Synechocystis PCC6803 by homologous recombination; wherein the nucleotide sequence of the recombinant fragment comprising an upstream fragment, a promoter PpsbA2, a MntH gene, a Kan resistance gene and a downstream fragment is shown in SEQ ID NO:

2.

5. A method for constructing the transgenic Synechocystis PCC6803 according to claim 4, characterized in that: The following steps are involved: (I) Construction of pMD19T-MntH recombinant plasmid: (1) Using the genome of Synechocystis PCC6803 as a template, the primer pairs up-F / up-R and down-F / down-R were used to amplify the upstream homology arm up and the downstream homology arm down fragments respectively; (2) Using plasmid pET-28a as a template, the Kan resistance fragment was amplified using primer pair Kan-F / Kan-R, and using the genome of Synechocystis PCC6803 as a template, the promoter ppsbA2 fragment was amplified using primer pair Ppsb-F / Ppsb-R; then, overlapping PCR was performed using primer pair up-F / down-R with a mixture of equal proportions of fragments up, ppsbA2, kan, and down as a template to amplify the up-ppsbA-kan-down fragment, which was then ligated with the pMD19T vector using T4 ligase and transformed into Escherichia coli TG1; then, PCR detection and verification was performed using primer pair up-F / down-R, and the plasmid was extracted after the correct strain was identified and cultured, and the correctly constructed plasmid was named pMD19T-ppabA-kan; (3) Using a single colony of Salmonella typhimurium SL1344 as a template, the primer pair MntH-F / MntH-R was used to amplify the MntH fragment; the plasmid pMD19T-ppabA-kan and the MntH fragment were digested and recovered using restriction endonucleases BglII and SpeI, respectively, and then ligated and transformed into Escherichia coli TG1, and PCR detection was performed using primer pair Ppsb-F / MntH-R. After the correct strain was cultured, the plasmid was extracted and sequenced, and the correctly constructed plasmid was named pMD19T-MntH; The sequences of the primer pairs described above are as follows: up-F:TTGGGTAGCAAGGAAATATCAAC up-R: GAACGCTAAAGCCGCATTTAGGGGGCGGAATAAAAC Kan-F:GGACTAGTAGTTGGGTAACGCCAGG Kan-R:CACTTTATGCTTCCGGCT Ppsb-F:TGCGGCTTTAGCGTTC Ppsb-R: GGAAGATCTGGTTATAATTCCTTATGTATTTGTCGAT down-F: AGCCGGAAGCATAAAGTGTTGACCCACTAAAGCTCCG down-R:AACTCGGTCAAAATTAGTACCG MntH-F:GGAAGATCTATGACTGACAATCGCGTAGA MntH-R:GGACTAGTTTTATGACAACCCCATCACCG (II) Obtaining MntH transgenic Synechocystis: (1) Preparation of mixed cellulose ester membrane: The mixed cellulose ester membrane was rinsed three times with distilled water, placed in a glass dish and boiled for 5 min, and then sterilized for later use; (2) Preparation of algae: scrape a small amount of Synechocystis PCC6803 algae from the BG11 plate and culture it in BG-11 liquid culture medium. When the algae liquid grows to the logarithmic phase, take 10 mL of the algae liquid into a 15 mL centrifuge tube and centrifuge it at 1800 g for 5 min. (3) Wash the algal cell pellet three times with fresh BG-11 liquid culture medium, and add 400 μL of BG-11 liquid culture medium to resuspend the algal cells; (4) Add pMD19T-MntH to the resuspended algal cells, mix well and incubate at 30°C and 1400 lux for 6-8 h; (5) Place a treated mixed cellulose ester membrane on the non-resistant BG-11 solid culture medium, ensure that there are no bubbles between the membrane and the plate, and evenly spread 200 μL of incubated algal cells on the surface of the mixed cellulose ester membrane; (6) After 18-24 h of light culture, the membrane was transferred to BG-11 solid medium containing kanamycin and continued to be cultured under light; (7) After 10-14 days, single algae were picked and streaked on BG-11 solid medium containing kanamycin and cultured continuously; (8) A single algal colony was inoculated into a BG-11 liquid culture medium containing kanamycin for cultivation and growth, and its DNA was extracted. PCR detection was performed using specific primers MntH-F / R. If an algal strain with a MntH gene band was amplified, it indicated that the exogenous target gene was correctly transferred, and the strain was the MntH transgenic Synechocystis obtained by screening.

6. Use of the transgenic Synechocystis PCC6803 according to claim 4 in the following aspects: (1) Application of the transgenic Synechocystis PCC6803 as a model strain in studying the physiological and metabolic functions of microalgae; (2) Application of the transgenic Synechocystis PCC6803 in sewage treatment.

Images