Genome editing system and editing method of sweet clover based on hairy root genetic transformation system
Using the CRISPR_2.0-MtLAP1-KO-MaPDS gene editing system, and with the hypocotyl of Osmanthus fragrans as explants, we achieved efficient induction and visual screening of hairy roots of Osmanthus fragrans, solving the problems of low hairy root induction efficiency and contamination, and improving gene editing efficiency and detection efficiency.
Patent Information
- Application Number
- CN202411836044.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-13
- Publication Date
- 2025-10-28
- Estimated Expiration
- 2044-12-13
AI Technical Summary
The induction efficiency of hairy roots of Osmanthus fragrans is low, the induction time is long, and it is easily contaminated by Agrobacterium. There is a lack of efficient gene editing systems and methods, resulting in a large workload for detection and difficulty in quickly verifying gene function.
Using the CRISPR_2.0-MtLAP1-KO-MaPDS gene editing system, the hypocotyl of Osmanthus fragrans was used as an explant. Hairy roots were induced by Agrobacterium rhizogenes infection, and the accumulation of anthocyanins due to MtLAP1 gene overexpression was used to achieve visual screening and reduce the occurrence of seedling roots.
This study achieved efficient induction of hairy roots in Osmanthus fragrans, reduced the workload of hairy root detection, improved gene editing efficiency, shortened the research cycle, and provided an efficient gene editing system.
Smart Images

Figure CN119592615B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of plant tissue culture technology and plant transgenic technology, specifically relating to a genome editing system and editing method for Osmanthus fragrans based on a hairy root genetic transformation system. Background Technology
[0002] White-flowered sweet potato (Melilotus albus Desr.) is an annual or biennial diploid herbaceous plant belonging to the genus Melilotus in the legume family. It is characterized by drought tolerance, salt and alkali tolerance, and strong nitrogen-fixing ability, making it highly suitable for crop rotation. It is also an important forage crop for improving saline-alkali land. Currently, the main method for breeding new varieties of sweet potato is traditional circular breeding, but this method is time-consuming, labor-intensive, and difficult to improve single traits. Therefore, there is an urgent need to develop advanced biotechnologies such as genome editing (CRISPR / Cas9) and gene aggregation to shorten the breeding cycle of new white-flowered sweet potato varieties. However, there are currently no patent reports related to genome editing and other related technologies for white-flowered sweet potato.
[0003] Genetic transformation technology is an important tool for studying gene function and breeding new crop varieties in plants. Using *Agrobacterium tumefaciens* as a medium, the transformation method, which transfers target genes into plants via T-DNA in the Ti plasmid, has advantages such as simplicity, high efficiency, and strong reproducibility, and is widely used in plant genetic transformation. In addition, *Agrobacterium rhizogenes* can stably integrate the rol gene, a gene site that induces hairy roots, into the host plant genome via T-DNA in the Ri plasmid, producing hairy roots. Due to its short transformation cycle, the genetic transformation method using *Agrobacterium rhizogenes* to produce hairy roots is often used for rapid verification of gene function in plant metabolic pathways and for screening gene editor elements (promoters, CRISPR / Cas genes, sgRNA) in genome editing systems. However, influenced by factors such as explant condition and the type of Agrobacterium rhizogenes, the induction efficiency and positive rate of hairy roots vary greatly among different forage crops. For example, using mature leaves as explants for hairy root induction often results in low induction efficiency (<15%) and a long cycle (>60 days). Using root-stem junctions as explants for hairy root induction easily leads to confusion between seed roots and hairy roots, as well as false positives caused by Agrobacterium contamination, increasing the workload of detection. Currently, the hairy root induction system for Osmanthus fragrans generally suffers from low induction efficiency, long induction time, and serious Agrobacterium contamination. In addition, there is a lack of efficient and mature editing systems and methods for Osmanthus fragrans. Summary of the Invention
[0004] The purpose of this invention is to provide a genome editing system and method for Osmanthus fragrans based on a hairy root genetic transformation system. The gene editing system constructed using two target sites of the MaPDS gene can efficiently edit the MaPDS gene in the hairy roots of Osmanthus fragrans. By using Agrobacterium rhizogenes carrying the editing vector to infect the hypocotyl of Osmanthus fragrans, hairy roots can be generated in Osmanthus fragrans explants efficiently and rapidly, and the positive hairy roots can be visualized and screened. The method can effectively prevent the occurrence of seedling roots, reduce the workload of hairy root detection, and thus achieve high gene editing efficiency.
[0005] To achieve the above-mentioned objectives, the present invention employs the following technical solution:
[0006] The application of two target sites in Osmanthus fragrans: the application of constructing an editing system for the Osmanthus fragrans MaPDS gene using the two target sites, namely 5'-AAGGTTGTTATTGCTGGTGC-3' (SEQ ID NO.3) and 5'-TGGTCACAAGCCTATATTGC-3' (SEQ ID NO.4).
[0007] A genome editing system for Osmanthus fragrans, wherein the editing system is CRISPR_2.0-MtLAP1-KO-MaPDS, wherein MtLAP1 is the LAP1 gene of Alfalfa truncatum, and KO-MaPDS indicates that the editing system targets the MaPDS gene of Osmanthus fragrans. The nucleotide sequence of the editing system is shown in SEQ ID NO.1.
[0008] Because the editing system carries the MtLAP1 gene, overexpression of this gene leads to the accumulation of anthocyanins in hairy roots, resulting in color development that is visible to the naked eye. Therefore, it enables visual screening of positive hairy roots, reducing the workload of hairy root detection.
[0009] This invention also provides a method for efficiently editing the MaPDS gene in the hairy roots of Osmanthus fragrans using the aforementioned editing system, the method comprising the following steps:
[0010] Step 1: Take the hypocotyl of sterile 3-5 day old sweet osmanthus seedlings and make a wound on the hypocotyl using a sterile needle to use as an explant for inducing hairy roots of sweet osmanthus.
[0011] Step 2: Thaw Agrobacterium rhizogenes LBA9402 competent cells on ice, add CRISPR_2.0-MtLAP1-KO-MaPDS plasmid DNA, incubate on ice for 30 min, freeze in liquid nitrogen for 2-3 min; incubate at 37℃ for 3 min, add antibiotic-free LB medium, incubate at 28℃~200rpm~2h; spread on solid LB medium containing kanamycin and rifampin, incubate upside down at 28℃; after single colonies grow, identify by PCR, and preserve positive colonies;
[0012] Step 3: Inoculate the preserved positive bacterial culture obtained in Step 2 into liquid LB basal medium containing kanamycin and rifampicin resistance, and incubate at 28℃~200rpm; when the bacterial concentration OD 600 When the OD value reaches 0.6-0.8, centrifuge to enrich the bacterial cells; resuspend the bacterial culture in sterile SH liquid medium to OD. 600 The value is approximately 0.3-0.4, used as an infection solution to induce the hairy roots of Osmanthus fragrans var. spp.;
[0013] The SH liquid culture medium is SH basal culture medium with a final concentration of 15 g·L. -1 sucrose + 100 μmol·L -1 Acetyleugenol, pH 5.95;
[0014] Step 4: Place the hypocotyl explants prepared in Step 1 into the infection solution for inducing hairy roots of Osmanthus fragrans, vacuum for 5 minutes, shake and incubate for 30 minutes, and then place them on sterile filter paper to air dry; after co-culturing on co-culture medium for 2 days, transfer them to hairy root induction medium to induce hairy root development; change the induction medium every 15 days.
[0015] The co-culture medium is SH basal medium + 30 g·L -1 Sucrose + 7.8g·L -1 Agar + 4 mg / L -1 2,4-D + 0.5 mg L -1 6-BA + 100 μmol·L -1 Acetyleugenol, pH 5.95;
[0016] The hairy root induction medium is 1 / 2 MS basal medium + 15 g·L⁻¹ -1 Sucrose + 7.8g·L -1 Agar + 400 mg / L -1 Termetidine + 1 mg / L -1 glufosinate + 0.1 mg·L -1 IBA, pH value 5.95;
[0017] Step 5: Select the purplish-red hairy roots of the white-flowered sweet osmanthus by visual inspection, extract DNA using the CTAB method, and perform PCR amplification and sequencing.
[0018] The beneficial effects of this invention compared to the prior art are as follows:
[0019] This invention selects two target sites of the MaPDS gene in Osmanthus fragrans to construct a gene editing system, successfully achieving the editing of the target gene, with an editing efficiency of approximately 40% for one of the target sites. This invention is the first to confirm a suitable vector system for gene editing in Osmanthus fragrans. The constructed editing vector system is based on the principle of "color development" of anthocyanins accumulated by overexpression of the MtLAP1 transcription factor, enabling the visualization, rapid and efficient acquisition of positive hairy roots and the efficient editing of red positive hairy roots, preventing Agrobacterium contamination, and reducing the workload of hairy root target gene detection.
[0020] This invention utilizes the aforementioned editing system to obtain hairy root systems with MaPDS editing, providing a hairy root genome editing system for Osmanthus fragrans, which helps to verify the functions of unknown genes in Osmanthus fragrans.
[0021] This invention uses sterile hypocotyls of Osmanthus fragrans as explants to induce hairy roots. The hairy root induction rate is high (>30%), the induction time is short (30-45 days), and it effectively reduces the occurrence of seed roots, reduces the workload of root system detection, and improves detection efficiency. Attached Figure Description
[0022] Figure 1 Schematic diagram of the CRISPR_2.0-MtLAP1-KO-MaPDS framework for the hairy root vector of Osmanthus fragrans var. pubescens;
[0023] Figure 2 Diagram illustrating the process of LBA9402 Agrobacterium rhizogenes inducing anthocyanin accumulation in the hypocotyl of Osmanthus fragrans to produce hairy roots; (A) Osmanthus fragrans seeds are disinfected and germinated; (B) Osmanthus fragrans hypocotyls are placed in the infection solution; (C) Osmanthus fragrans hypocotyls are co-cultured after infection; (D) Induction of hairy roots from Osmanthus fragrans hypocotyls.
[0024] Figure 3 DNA molecular identification electrophoresis diagram of hairy roots of Osmanthus fragrans; (A) Agarose gel electrophoresis diagram of rolB gene in hairy roots of Osmanthus fragrans; (B) Agarose gel electrophoresis diagram of VirG gene in hairy roots of Osmanthus fragrans; (C) Agarose gel electrophoresis diagram of Cas9 gene in hairy roots of Osmanthus fragrans.
[0025] Figure 4 Statistical histogram of hypocotyl hairy roots induced in Osmanthus fragrans var. leucocephala;
[0026] Figure 5 Hairy root target site 1 edit type statistical bar chart;
[0027] Figure 6 A diagram illustrating the MaPDS gene editing process in Osmanthus fragrans var. pubescens. Detailed Implementation
[0028] The present invention will now be described in further detail with reference to the accompanying drawings and examples.
[0029] Example 1: Explant selection and hairy root induction of Osmanthus fragrans var. pubescens
[0030] 1) Select explants: Use a needle to lightly prick the hypocotyl of sterile Osmanthus fragrans seedlings that are about 3-5 days old to create a wound, and keep it for later use.
[0031] 2) Induction of hairy roots of explants: Refer to the method in Example 4.
[0032] 3) Statistics on explant induction rate and positive rate (statistical data from Example 4): The hypocotyl induction process of aseptic seedlings of Osmanthus fragrans is as follows: Figure 2 As shown. The test results are as follows. Figure 3 As shown, the hypocotyl hairy root induction rate of sterile Osmanthus fragrans seedlings was 39.8%, the positive rate was 72.8%, and the induction period was 30-45 days. Based on the above, Osmanthus fragrans hypocotyls were selected as the explants for subsequent gene editing-induced hairy root induction.
[0033] Example 2: Target site selection of hairy roots of Osmanthus fragrans
[0034] 1) Target site selection: Through literature review, the AtPDS gene number AT4G14210 of Arabidopsis thaliana and the GmPDS gene numbers GlyMa.18G003900 and GlyMa.11G253000 of soybean were identified. The CDS sequences of the Arabidopsis thaliana and soybean PDS genes were obtained from the Phytozome website, and the MaPDS gene sequence of Osmanthus fragrans was obtained by BLAST alignment in the Osmanthus fragrans database. The Osmanthus fragrans MaPDS gene sequence is shown in SEQ ID NO.2.
[0035] Target sites should be selected based on the following principles:
[0036] ① The GC content should ideally be between 40% and 60%;
[0037] ② Avoid ending with TTC or TTT, or containing only T and C in the last nucleotide, more than two Ts or at least one TT and one T or C.
[0038] ③ The sequence should not contain TTTT. Transcription using the U6 / U3 promoter is not possible because it terminates transcription.
[0039] ④ The PAM area should avoid GGG / CCC, etc. as much as possible;
[0040] ⑤ Avoid missing the target as much as possible;
[0041] ⑥ The number of hairpin structures formed by the target site itself should be ≤4.
[0042] Example 3: Construction of the MaPDS gene editing vector for Osmanthus fragrans and its transformation with Agrobacterium tumefaciens
[0043] 1) The CRISPR_2.0-pRGEB31R vector was selected as the backbone. The CRISPR_2.0-pRGEB31R vector was digested with XhoI restriction endonuclease. The linearized vector obtained by recovery and purification was denoted as CRISPR_2.0-pRGEB31R-XhoI.
[0044] 2) Using alfalfa cDNA as a template, the MtLAP1 fragment was amplified using MtLAP1-in2.0-F and MtLAP1-in2.0-R primers. The recovered fragment was recorded as the amplified product MtLAP1 DNA fragment (the specific sequence is shown in Table 1).
[0045] Table 1 Template sequences required for vector construction
[0046]
[0047] 3) PCR reaction system for the amplified product MtLAP1: 5 μL alfalfa cDNA, 25 μL 2×Phanta Max MasterMix, 2.5 μL MtLAP1-in2.0-F, 2.5 μL MtLAP1-in2.0-R, and ddH2O added to 50 μL;
[0048] 4) Reaction program for the amplified product MtLAP1: 95℃ for 3 min; 95℃ for 15 s, 55℃ for 15 s, 72℃ for 40 s, 32 cycles; extension at 72℃ for 5 min; storage at 4℃.
[0049] 5) The linearized vector CRISPR_2.0-pRGEB31R-XhoI obtained in 1) and the MtLAP1 DNA fragment obtained in 2) were seamlessly ligated;
[0050] 6) Seamless cloning reaction system: CRISPR_2.0-pRGEB31R-XhoI 300ng, MtLAP1 amplification fragment 50ng, 5×CE II Buffer 2μL, Exnase II 1μL, ddH2O to make up to 10μL; the reaction program for the seamless cloning reaction is 37℃, 40min.
[0051] 7) The ligation product obtained in 6) was transformed into DH5α competent cells. Bacterial PCR was performed using MtLAP1-in2.0-F and MtLAP1-in2.0-R primers for identification. Positive clones were selected for Sanger sequencing. The sequencing results were compared to obtain the gene editing visualization vector CRISPR_2.0-MtLAP1, denoted as CRISPR_2.0-MtLAP1.
[0052] The reaction system for PCR identification in section 7) is as follows: 1 μL of bacterial culture, 10 μL of 2×Taq Max Master Mix, 1 μL of MtLAP1-in2.0-F, 1 μL of MtLAP1-in2.0-R; ddH2O is added to 20 μL.
[0053] The PCR identification reaction procedure in section 7) is as follows: 95℃ for 5 min; 95℃ for 30 s, 55℃ for 30 s, 72℃ for 1 min, 29 cycles; extension at 72℃ for 5 min; storage at 4℃.
[0054] 8) Based on the obtained Osmanthus fragrans MaPDS gene sequence and the design principles of CRISPR (Protospacer-adjacent Motif (PAM) is NGG) vectors, the two target sites selected are 5'-AAGGTTGTTATTGCTGGTGC-3' and 5'-TGGTCACAAGCCTATATTGC-3'.
[0055] 9) After selecting the target site, using the pGTR vector containing tRNA and sgRNA sequences (key sequences are shown in Table 2) as a template, and using (MaPDS-2.0-F1, MaPDS-2.0-R1), (MaPDS-2.0-F2, MaPDS-2.0-R2), and (MaPDS-2.0-F3, MaPDS-2.0-R3) as primers (Table 2), fragments 1, 2, and 3 were amplified with high-fidelity enzymes. The products were denoted as PDS-2.0-PD1, PDS-2.0-PD2, and PDS-2.0-PD3, respectively, and then recovered and purified.
[0056] Table 2 Primer sequences required for vector construction
[0057]
[0058] The reaction system for the amplified product in step 9) consists of: 1 μL of E. coli culture containing pGTR (key sequences are shown in Table 1), 25 μL of 2×PhantaMax MasterMix, 12.5 μL of MaPDS-2.0-F, 12.5 μL of MaPDS-2.0-R; and ddH2O to a final volume of 50 μL.
[0059] The reaction procedure for the amplified product in 9) is as follows: 95℃ for 3 min; 95℃ for 15 s, 58℃ for 30 s, 72℃ for 40 s, 32 cycles; extension at 72℃ for 5 min, storage at 4℃.
[0060] 10) Using restriction endonuclease Bsa I and T4 ligase, the resulting products MaPDS-2.0-PD1, MaPDS-2.0-PD2, and MaPDS-2.0-PD3 were sequentially ligated into the backbone vector CRISPR_2.0-MtLAP via Golden Gate ligation.
[0061] The ligation reaction system described in section 10) consists of: 1.5 μL Bsa I Buffer, 1 μL T4 Buffer, 150 ng of backbone vector (CRISPR_2.0-MtLAP1) (depending on plasmid concentration), 1.5 μL Bsa I restriction enzyme, 0.5 μL T4 ligase, 50 ng each of amplification products (MaPDS-2.0-PD1, MaPDS-2.0-PD2, MaPDS-2.0-PD3), diluted to 15 μL with ddH2O.
[0062] The 10) Golden Gate ligation connection reaction program is as follows: 37℃ for 5 min, (37℃ for 10 min, 10℃ for 5 min, 20℃ for 5 min) for 5 cycles, and (37℃ for 3 min, 10℃ for 5 min, 20℃ for 5 min) for 12 cycles.
[0063] 11) The ligation product was transformed into DH5α competent cells, and bacterial colony PCR was performed using JC2.0F and JC2.0R primers for identification. Positive clones were subjected to Sanger sequencing, and the sequencing results were compared to obtain the final vector CRISPR_2.0-MtLAP1-KO-MaPDS, as shown in the diagram below. Figure 1 As shown;
[0064] The PCR identification reaction system described in 11) consists of: 1 μL of bacterial culture, 10 μL of 2×Taq Max Master Mix, 1 μL of JC2.0F, 1 μL of JC2.0R, and ddH2O added to 20 μL.
[0065] The PCR identification reaction procedure described in 11) is as follows: 95℃ for 5 min; 95℃ for 30 s, 55℃ for 30 s, 72℃ for 1 min, 29 cycles; extension at 72℃ for 5 min; and storage at 4℃.
[0066] 12) Add 200-300 ng of the constructed CRISPR_2.0-MtLAP1-KO-MaPDS plasmid to LBA9402 Agrobacterium rhizogenes competent cells (50 μL), incubate on ice for 30 min, place the competent cells transformed with plasmid in liquid nitrogen for 2-3 min, then place them in a 37℃ water bath for 3 min, followed by an ice bath for 3 min, add 400 μL of antibiotic-free LB medium, incubate at 28℃~200 rpm~2 h, centrifuge at 3000 g for 10 min, remove 200 μL of supernatant, resuspend the precipitated bacteria in the remaining 200 μL of LB, spread the resuspended bacterial solution on a solid LB culture dish containing kanamycin and rifampicin antibiotics, incubate upside down at 28℃, wait for 2 days for single colonies to grow, pick single colonies and incubate overnight in 400 mL LB (kanamycin + rifampicin antibiotic) in a shaker at 28℃. Positive bacteria were then identified using primers JC2.0F and JC2.0R. The primer sequences are shown in Table 2.
[0067] Example 4: Induction of hairy roots of Osmanthus fragrans
[0068] 1) Take the hypocotyl of sterile seedlings of Osmanthus fragrans (Lanxi No. 2, material authorized by Professor Zhang Jiyu's team at Lanzhou University) that have grown for 3-5 days; gently prick the hypocotyl of Osmanthus fragrans with a sterile needle to create a wound, which will serve as an explant for inducing hairy roots of Osmanthus fragrans.
[0069] 2) The positive strain prepared in Example 3 was inoculated into liquid LB basal medium containing the corresponding Agrobacterium tumefaciens resistance and cultured at 28°C with shaking at 200 rpm. When the bacterial concentration OD... 600 When the pH reached between 0.6 and 0.8, the bacterial cells were enriched by centrifugation at 3000g. The cells were then enriched using sterile SH liquid medium containing acetylsuccinyl syringone (SH basal medium + 15 g / L). -1 sucrose + 100 μmol·L -1 Acetyleugenol (pH 5.95) was used to resuspend the bacterial culture to OD. 600 The concentration was increased to 0.3-0.4, which was used as an infection solution to induce the hairy roots of Osmanthus fragrans.
[0070] 3) Place the prepared explants into the infection solution for inducing hairy roots of *Sweet clover*, vacuum for 5 minutes, incubate with shaking for 30 minutes, and then air dry on sterile filter paper. The drying time should not be too long to prevent the hypocotyl from dehydrating and wilting. Culture on co-culture medium (SH basal medium + 30 g / L) -1 Sucrose + 4 mg·L -1 2,4-D + 0.5 mg·L -1 6-BA + 100 μmol·L -1Acetyleugenol (pH 5.95) was co-cultured for 2 days, and then transferred to hairy root induction medium (1 / 2 MS basal medium + 15 g·L⁻¹). -1 Sucrose + 7.8g·L -1 Agar + 400 mg / L -1 Termetidine + 1 mg / L -1 glufosinate + 0.1 mg·L -1 Hairy roots are induced by IBA (pH 5.95), and the hairy roots can grow to a detectable state in 30-45 days.
[0071] Example 5: Statistical analysis of MaPDS gene editing methods in the hairy roots of Osmanthus fragrans var. pubescens.
[0072] 1) Hairy Root DNA Extraction: Fresh hairy roots of *Osmanthus fragrans* (from Example 4) were chopped and placed in a 1.5 mL centrifuge tube. 1 mL of 2×CTAB extraction buffer was added, and the mixture was ground and thoroughly mixed. The sample was incubated in a 65°C water bath for 30 min, gently inverting every 10 min to mix. After the water bath, the liquid was allowed to cool to room temperature. 100 μL of chloroform was added, and the mixture was vortexed for 15 s. The sample was centrifuged at 12,000 g for 10 min at room temperature. The supernatant was transferred to a new 1.5 mL centrifuge tube, and an equal volume of isopropanol was added. The mixture was vortexed and incubated at -20°C for 30 min, followed by centrifugation at 12,000 g for 10 min at room temperature. The precipitate was then washed with 1 mL of 70% ethanol, centrifuged at 7500 g for 5 min, and the supernatant was discarded. This washing process was repeated once. Finally, the DNA was allowed to air dry. Deionized water was added to dissolve the DNA, and the DNA concentration and ratio were measured using a micro-volume analyzer.
[0073] 2) PCR reaction: The PCR primer sequences for rolB gene, virG gene, and Cas9 gene are shown in Table 3.
[0074] Table 3 Primers for hairy root identification
[0075]
[0076] In step 2), the total PCR reaction volume is 20 μL, with 1 μL each of the upstream and downstream primers for the rolB gene, vir G gene, and Cas9 gene added (final concentration 20 pmol·L⁻¹). –1The reaction mixture consisted of 2 μL template DNA (approximately 200 ng), 10 μL 2×MIX Buffer, and 6 μL deionized water to a total volume of 20 μL. PCR conditions were as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 54℃ annealing for 30 s, 72℃ extension for 45 s, 29 cycles; 72℃ extension for 10 min, followed by storage of the PCR products at 4℃. 10 μL of PCR amplification products from each of the rolB, virG, and Cas9 genes were subjected to 1% agarose gel electrophoresis and photographed. 5 μL of a 2000 bp LadderMaker was used as the molecular weight standard.
[0077] 3) Gel electrophoresis imaging showed that the PCR products of the rol B gene, vir G gene, and Cas9 gene were 194bp, 529bp, and 547bp in size, respectively. Figure 4 This is in line with expectations.
[0078] 4) MaPDS Target Site Editing Detection: Amplification of Upstream and Downstream Fragments at the Target Site: The target site was amplified using primers MaPDS-JC-F1: 5'-CTGCTTATTTGTCTTCCACC-3' (SEQ ID NO.5) and MaPDS-JC-R2: 5'-CAAATGAGATTAAATTAGTC-3' (SEQ ID NO.6), with a PCR fragment size of 996 bp. The amplified DNA fragment containing the target site was sent to a company for Sanger sequencing. Samples with double peaks were sequenced. The PCR product was recovered from the gel, ligated into a T vector, and transformed into *E. coli* DH5α. PCR detection was performed using universal primers M13F and M13R. Fifty positive clones were selected for further sequencing to determine their editing method. The editing type of target site 1 is as follows: Figure 5 As shown. The gene fragments for which specific target site editing methods are employed are as follows. Figure 6 As shown, the editing efficiency of target site 1 is 39.5%, and the editing efficiency of target site 2 is 0.02%.
[0079] This invention establishes an efficient genome editing system and method based on the visualized hairy root genetic transformation system of *Osmanthus fragrans*. This system effectively reduces the occurrence of seedling roots, decreases *Agrobacterium* contamination, enables rapid and efficient screening of positive hairy roots, reduces the workload of hairy root detection, and shortens the research cycle. It provides technical support for the genetic breeding and gene function analysis of *Osmanthus fragrans*, a leguminous plant.
[0080] The nucleotide sequence (SEQ ID NO.1) of the editing system CRISPR_2.0-MtLAP1-KO-MaPDS:
[0081] aagcttgataatttatttgaaaattcataagaaaagcaaacgttacatgaattgatgaaacaatacaaagac
[0082] agataaagccacgcacatttaggatattggccgagattactgaatattgagtaagatcacggaatttctga
[0083] caggagcatgtcttcaattcagcccaaatggcagttgaaatactcaaaccgccccatatgcaggagcgg
[0084] atcattcattgtttgtttggttgcctttgccaacatgggagtccaagattctgcagtcaaatctcggtgacgg
[0085] gcaggaccggacggggcggtaccggcaggctgaagtccagctgccagaaacccacgtcatgccagt
[0086] tcccgtgcttgaagccggccgcccgcagcatgccgcggggggcatatccgagcgcctcgtgcatgcg
[0087] cacgctcgggtcgttgggcagcccgatgacagcgaccacgctcttgaagccctgtgcctccagggactt
[0088] cagcaggtgggtgtagagcgtggagcccagtcccgtccgctggtggcggggggagacgtacacggt
[0089] cgactcggccgtccagtcgtaggcgttgcgtgccttccaggggcccgcgtaggcgatgccggcgacct
[0090] cgccgtccacctcggcgacgagccagggatagcgctcccgcagacggacgaggtcgtccgtccactc
[0091] ctgcggttcctgcggctcggtacggaagttgaccgtgcttgtctcgatgtagtggttgacgatggtgcaga
[0092] ccgccggcatgtccgcctcggtggcacggcggatgtcggccgggcgtcgttctgggctcatcgattcg
[0093] atttggtgtatcgagattggttatgaaattcagatgctagtgtaatgtattggtaatttgggaagatataatag
[0094] gaagcaaggctatttatccatttctgaaaaggcgaaatggcgtcaccgcgagcgtcacgcgcattccgtt
[0095] cttgctgtaaagcgttgtttggtacacttttgactagcgaggcttggcgtgtcagcgtatctattcaaaagtc
[0096] gttaatggctgcggatcaagaaaaagttggaatagaaacagaatacccgcgaaattcaggcccggttgc
[0097] catgtcctacacgccgaaataaacgaccaaattagtagaaaaataaaaactgactcggatacttacgtca
[0098] cgtcttgcgcactgatttgaaaaatctcagccatggctgcaggtcgacgagtcagtaataaacggcgtca
[0099] aagtggttgcagccggcacacacgagtcgtgtttatcaactcaaagcacaaatacttttcctcaacctaaa
[0100] aataaggcaattagccaaaaacaactttgcgtgtaaacaacgctcaatacacgtgtcattttattattagcta
[0101] ttgcttcaccgccttagctttctcgtgacctagtcgtcctcgtcttttcttcttcttcttctataaaacaataccca
[0102] aagagctcttcttcttcacaattcagatttcaatttctcaaaatcttaaaaactttctctcaattctctctaccgtg
[0103] atcaaggtaaatttctgtgttccttattctctcaaaatcttcgattttgttttcgttcgatcccaatttcgtatatgtt
[0104] ctttggtttagattctgttaatcttagatcgaagacgattttctgggtttgatcgttagatatcatcttaattctcg
[0105] attagggtttcatagatatcatccgatttgttcaaataatttgagttttgtcgaataattactcttcgatttgtgatt
[0106] tctatctagatctggtgttagtttctagtttgtgcgatcgaatttgtcgattaatctgagtttttctgattaacagc
[0107] catggactataaggaccacgacggagactacaaggatcatgatattgattacaaagacgatgacgataa
[0108] gatggccccaaagaagaagcggaaggtcggtatccacggagtcccagcagccgacaagaagtacag
[0109] catcggcctggacatcggcaccaactctgtgggctgggccgtgatcaccgacgagtacaaggtgccca
[0110] gcaagaaattcaaggtgctgggcaacaccgaccggcacagcatcaagaagaacctgatcggagccct
[0111] gctggttcgacagcggcgaaacagccgaggccacccggctgaagagaaaccgccaagaagatacac
[0112] cagacggagaaccggatctgctatctgcaagagatcttcagcaacgagatggccaaggtggacgaca
[0113] gcttcttccacagaactgggaagagtccttcctgggaagagagaagagaagcacgagcggcaccccacatct
[0114] tcggcaacatcgtggacgaggtggcctaccacgagaagtccccaccatctaccacctgagaaaaaa
[0115] ctggtggacagcaccgacaaggccgacctgcggctgatctatctggccctggcccacatgatcaagttc
[0116] cggggccacttcctgatcgagggcgacctgaaccccgacaacagcgacgtggacaagctgttcatcca
[0117] gctggtgcagacctacaaccagctgttcgaggaaaaccccatcaacgccagcggcgtggacgccaag
[0118] gccatcctgtctgccagagactgagcaagagcagacggctggaaaatctgatcgcccagctgcccggcga
[0119] gaagagaatggcctgttcggaaacctgattgccctgagcctgggcctgacccccaacttcaagagcaa
[0120] cttcgacctggccgaggatgccaaactgcagctgagcaaggacacctacgacgacgacctggacaac
[0121] ctgctggcccagatcggcgaccagtacgccgacctgtttctggccgccaagaacctgtccgacgccatc
[0122] ctgctgagcgacatcctgagagtgaacaccgagatcaccaaggcccccctgagcgcctctatgatcaa
[0123] gagatacgacgagcaccaccaggacctgaccctgctgaaagctctcgtgcggcagcagctgcctgag
[0124] aagtacaaagagattttttcgaccagagcaagaacggctacgccggctacattgacggcggagccag
[0125] ccaggaagagttctacaagttcatcaagcccatcctggaaaagatggacggcaccgaggaactgctcgt
[0126] gaagctgaacagagaggacctgctgcggaagcagcggaccttcgacaacggcagcatcccccacca
[0127] gatccacctgggagagctgcacgccattctgcggcggcaggagaatttttacccattcctgaaggacaa
[0128] ccgggaaaagatcgagaagatcctgaccttccgcatcccctactacgtgggccctctggccaggggaa
[0129] acagcagattcgcctggatgaccagaaagagcgaggaaaccatcaccccctggaacttcgaggaagt
[0130] ggtggacaagggcgcttccgcccagagcttcatcgagcggatgaccaacttcgataagaacctgccca
[0131] acgagaaggtgctgcccaagcacagcctgctgtacgagtacttcaccgtgtataacgagctgaccaaag
[0132] tgaaatacgtgaccgagggaatgagaaagcccgccttcctgagcggcgagcagaaaaaggccatcgt
[0133] ggacctgctgttcaagaccaaccggaaagtgaccgtgaagcagctgaaagaggactacttcaagaaaa
[0134] tcgagtgcttcgactccgtggaaatctccggcgtggaagatcggttcaacgcctccctgggcacatacca
[0135] cgatctgctgaaaattatcaaggacaaggacttcctggacaatgaggaaaacgaggacattctggaaga
[0136] tatcgtgctgaccctgacactgtttgaggacagagagatgatcgaggaacggctgaaaacctatgccca
[0137] cctgttcgacgacaaagtgatgaagcagctgaagcggcggagatacaccggctggggcaggctgagc
[0138] cggaagctgatcaacggcatccgggacaagcagtccggcaagacaatcctggatttcctgaagtccga
[0139] cggcttcgccaacagaaacttcatgcagctgatccacgacgacagcctgacctttaaagaggacatcca
[0140] gaaagcccaggtgtccggccagggcgatagcctgcacgagcacattgccaatctggccggcagcccc
[0141] gccattaagaagggcatcctgcagacagtgaaggtggtggacgagctcgtgaaagtgatgggccggc
[0142] acaagcccgagaacatcgtgatcgaaatggccagagagaaccagaccacccagaagggacagaaga
[0143] acagccgcgagagaatgaagcggatcgaagagggcatcaaagagctgggcagccagatcctgaaag
[0144] aacaccccgtggaaaacacccagctgcagaacgagaagctgtacctgtactacctgcagaatgggcg
[0145] ggatatgtacgtggaccaggaactggacatcaaccggctgtccgactacgatgtggaccatatcgtgcc
[0146] tcagagctttctgaaggacgactccatcgacaacaaggtgctgaccagaagcgacaagaaccggggc
[0147] aagagcgacaacgtgccctccgaagaggtcgtgaagaagatgaagaactactggcggcagctgctga
[0148] acgccaagctgattacccagagaaagttcgacaatctgaccaaggccgagagaggcggcctgagcga
[0149] actggataaggccggcttcatcaagagacagctggtggaaacccggcagatcacaaagcacgtggca
[0150] cagatcctggactcccggatgaacactaagtacgacgagaatgacaagctgatccgggaagtgaaagt
[0151] gatcaccctgaagtccaagctggtgtccgatttccggaaggatttccagttttacaaagtgcgcgagatca
[0152] acaactaccaccacgcccacgacgcctacctgaacgccgtcgtgggaaccgccctgatcaaaaagtac
[0153] cctaagctggaaagcgagttcgtgtacggcgactacaaggtgtacgacgtgcggaagatgatcgccaa
[0154] gagcgagcaggaaatcggcaaggctaccgccaagtacttcttctacagcaacatcatgaactttttcaag
[0155] accgagattaccctggccaacggcgagatccggaagcggcctctgatcgagacaaacggcgaaacc
[0156] ggggagatcgtgtgggataagggccgggattttgccaccgtgcggaaagtgctgagcatgccccaagt
[0157] gaatatcgtgaaaaagaccgaggtgcagacaggcggcttcagcaaagagtctatcctgcccaagagga
[0158] acagcgataagctgatcgccagaaagaaggactgggaccctaagaagtacggcggcttcgacagccc
[0159] caccgtggcctattctgtgctggtggtggccaaagtggaaaagggcaagtccaagaaactgaagagtgt
[0160] gaaagagctgctggggatcaccatcatggaaagaagcagcttcgagaagaatcccatcgactttctgga
[0161] agccaagggctacaaagaagtgaaaaaggacctgatcatcaagctgcctaagtactccctgttcgagct
[0162] ggaaaacggccggaagagaatgctggcctctgccggcgaactgcagaagggaaacgaactggccct
[0163] gccctccaaatatgtgaacttcctgtacctggccagccactatgagaagctgaagggctcccccgagga
[0164] taatgagcagaaacagctgtttgtggaacagcacaagcactacctggacgagatcatcgagcagatcag
[0165] cgagttctccaagagagtgatcctggccgacgctaatctggacaaagtgctgtccgcctacaacaagca
[0166] ccgggataagcccatcagagagcaggccgagaatatcatccacctgtttaccctgaccaatctgggagc
[0167] ccctgccgccttcaagtactttgacaccaccatcgaccggaagaggtacaccagcaccaaagaggtgct
[0168] ggacgccaccctgatccaccagagcatcaccggcctgtacgagacacggatcgacctgtctcagctgg
[0169] gaggcgacaaaaggccggcggccacgaaaaaggccggccaggcaaaaaagaaaaagtaagaattc
[0170] aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaatcgaacaaagcacc
[0171] agtggtctagtggtagaatagtaccctgccacggtacagacccgggttcgattcccggctggtgcatggt
[0172] cacaagcctatattgcgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaa
[0173] aagtggcaccgagtcggtgcaacaaagcaccagtggtctagtggtagaatagtaccctgccacggtac
[0174] agacccgggttcgattcccggctggtgcaaaggttgttattgctggtgcgttttagagctagaaatagcaa
[0175] gttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctttttttatatgaagatga
[0176] agatgaaatatttggtgtgtcaaataaaaagcttgtgtgcttaagtttgtgtttttttcttggcttgttgtgttatg
[0177] aatttgtggctttttctaatattaaatgaatgtaagatcacattataatgaataaacaaatgtttctataatccatt
[0178] gtgaatgttttgttggatctcttctgcagcatataactactgtatgtgctatggtatggactatggaatatgatt
[0179] aaagataaggaattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaactta
[0180] atcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgccctt
[0181] cccaacagttgcgcagcctgaatggcgaatgctagagcagcttgagcttggatcagattgtcgtttcccg
[0182] ccttcagtttaaactatcagtgtttgacaggatatattggcgggtaaacctaagagaaaagagcgtttatta
[0183] gaataacggatatttaaaagggcgtgaaaaggtttatccgttcgtccatttgtatgtgcatgccaaccacag
[0184] ggttcccctcgggatcaaagtactttgatccaacccctccgctgctatagtgcagtcggcttctgacgttca
[0185] gtgcagccgtcttctgaaaacgacatgtcgcacaagtcctaagttacgcgacaggctgccgccctgccc
[0186] ttttcctggcgttttcttgtcgcgtgttttagtcgcataaagtagaatacttgcgactagaaccggagacatta
[0187] cgccatgaacaagagcgccgccgctggcctgctgggctatgcccgcgtcagcaccgacgaccagga
[0188] cttgaccaaccaacgggccgaactgcacgcggccggctgcaccaagctgttttccgagaagatcaccg
[0189] gcaccaggcgcgaccgcccggagctggccaggatgcttgaccacctacgccctggcgacgttgtgac
[0190] agtgaccaggctagaccgcctggcccgcagcacccgcgacctactggacattgccgagcgcatccag
[0191] gaggccggcgcgggcctgcgtagcctggcagagccgtgggccgacaccaccacgccggccggcc
[0192] gcatggtgttgaccgtgttcgccggcattgccgagttcgagcgttccctaatcatcgaccgcacccggag
[0193] cgggcgcgaggccgccaaggcccgaggcgtgaagtttggcccccgcctaccctcaccccggcaca
[0194] gatcgcgcacgcccgcgagctgatcgaccaggaagggccgcaccgtgaaagaggcggctgcactgct
[0195] tggcgtgcatcgctcgaccctgtaccgcgcacttgagcgcagcgaggaagtgacgcccaccgaggcc
[0196] aggcggcgcggtgccttccgtgaggacgcattgaccgaggccgacgccctggcggccgccgagaat
[0197] gaacgccaaaggaacaagcatgaaacgcaccaggacgggccaggacgaaccgtttttcattaccga
[0198] agagatcgaggcggagatgatcgcggccgggtacgtgttcgagccgcccgcgcacgtctcaaccgtg
[0199] cggctgcatgaaatcctggccggtttgtctgatgccaagctggcggcctggccggccagcttggccgct
[0200] gaaaccgagcgccgccgtctaaaaggtgatgtgtatttgagtaaaacagcttgcgtcatgcggtc
[0201] gctgcgtatatgatgcgatgagtaataaaaaataacgcaaggggaacgcatgaaggttatcgctgtact
[0202] taaccagaaaggcgggtcaggcaagacgaccatcgcaacccatctagcccgcgccctgcaactcgcc
[0203] ggggccgatgttctgttagtcgattccgatccccagggcagtgcccgcgattgggcggccgtgcggga
[0204] agatcaaccgctaaccgttgtcggcatcgaccgcccgacgattgaccgcgacgtgaaggccatcggcc
[0205] ggcgcgacttcgtagtgatcgacggagcgccccaggcggcggacttggctgtgtccgcgatcaaggc
[0206] agccgacttcgtgctgattccggtgcagccaagcccttacgacatatgggccaccgccgacctggtgga
[0207] gctggttaagcagcgcattgaggtcacggatggaaggctacaagcggcctttgtcgtgtcgcgggcgat
[0208] caaaggcacgcgcatcggcggtgaggttgccgaggcgctggccgggtacgagctgcccattcttgagt
[0209] cccgtatcacgcagcgcgtgagctacccaggcactgccgccgccggcacaaccgttcttgaatcagaa
[0210] cccgagggcgacgctgcccgcgaggtccaggcgctggccgctgaaattaaatcaaaactcatttgagtt
[0211] aatgaggtaaagagaaaatgagcaaaagcacaaacacgctaagtgccggccgtccgagcgcacgca
[0212] gcagcaaggctgcaacgttggccagcctggcagacacgccagccatgaagcgggtcaactttcagttg
[0213] ccggcggaggatcacaccaagctgaagatgtacgcggtacgccaaggcaagaccattaccgagctgc
[0214] tatctgaatacatcgcgcagctaccagagtaaatgagcaaatgaataaatgagtagatgaattttagcggc
[0215] taaaggaggcggcatggaaaatcaagaacaaccaggcaccgacgccgtggaatgccccatgtgtgga
[0216] ggaacgggcggttggccaggcgtaagcggctgggttgtctgccggccctgcaatggcactggaaccc
[0217] ccaagcccgaggaatcggcgtgacggtcgcaaaccatccggcccggtacaaatcggcgcggcgctg
[0218] ggtgatgacctggtggagaagttgaaggccgcgcaggccgcccagcggcaacgcatcgaggcagaa
[0219] gcacgccccggtgaatcgtggcaagcggccgctgatcgaatccgcaaagaatcccggcaaccgccg
[0220] gcagccggtgcgccgtcgattaggaagccgcccaagggcgacgagcaaccagattttttcgttccgat
[0221] gctctatgacgtgggcacccgcgatagtcgcagcatcatggacgtggccgttttccgtctgtcgaagcgt
[0222] gaccgacgagctggcgaggtgatccgctacgagcttccagacgggcacgtagaggtttccgcagggc
[0223] cggccggcatggccagtgtgtgggattacgacctggtactgatggcggtttcccatctaaccgaatccat
[0224] gaaccgataccgggaagggaagggagacaagcccggccgcgtgttccgtccacacgttgcggacgt
[0225] actcaagttctgccggcgagccgatggcggaaagcagaaagacgacctggtagaaacctgcattcggt
[0226] taaacaccacgcacgttgccatgcagcgtacgaagaaggccaagaacggccgcctggtgacggtatc
[0227] cgagggtgaagccttgattagccgctacaagatcgtaaagagcgaaaccgggcggccggagtacatc
[0228] gagatcgagctagctgattggatgtaccgcgagatcacagaaggcaagaacccggacgtgctgacggt
[0229] tcaccccgattactttttgatcgatcccggcatcggccgttttctctaccgcctggcacgccgcgccgcag
[0230] gcaaggcagaagccagatggttgttcaagacgatctacgaacgcagtggcagcgccggagagttcaa
[0231] gaagttctgtttcaccgtgcgcaagctgatcgggtcaaatgacctgccggagtacgatttgaaggagga
[0232] ggcggggcaggctggcccgatcctagtcatgcgctaccgcaacctgatcgagggcgaagcatccgcc
[0233] ggttcctaatgtacggagcagatgctagggcaaattgccctagcaggggaaaaaggtcgaaaagcact
[0234] ctttcctgtggatagcacgtacattgggaacccaaagccgtacattgggaaccggaacccgtacattggg
[0235] aacccaaagccgtacattgggaaccggtcacacatgtaagtgactgatataaaagagaaaaaaggcga
[0236] tttttccgcctaaaactctttaaaacttattaaaactcttaaaacccgcctggcctgtgcataactgtctggcc
[0237] agcgcacagccgaagagctgcaaaaagcgcctacccttcggtcgctgcgctccctacgccccgccgct
[0238] tcgcgtcggcctatcgcggccgctggccgctcaaaaatggctggcctacggccaggcaatctaccagg
[0239] gcgcggacaagccgcgccgtcgccactcgaccgccggcgcccacatcaaggcaccctgcctcgcgc
[0240] gtttcggtgatgacggtgaaaacctctgacacatgcagctcccggagacggtcacagcttgtctgtaagc
[0241] ggatgccgggagcagacaagcccgtcagggcgcgtcagcgggtgttggcgggtgtcggggcgcag
[0242] ccatgacccagtcacgtagcgatagcggagtgtatactggcttaactatgcggcatcagagcagattgta
[0243] ctgagagtgcaccatatgcggtgtgaaataccgcacagatgcgtaaggagaaaataccgcatcaggcg
[0244] ctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcact
[0245] caaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaagg
[0246] ccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctga
[0247] cgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccag
[0248] gcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgc
[0249] ctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgtt
[0250] cgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactat
[0251] cgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagc
[0252] agagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaagg
[0253] acagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggc
[0254] aaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggat
[0255] ctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattt
[0256] tggtcatgcattctaggtactaaaacaattcatccagtaaaatataatattttattttctcccaatcaggcttgat
[0257] ccccagtaagtcaaaaaatagctcgacatactgttcttccccgatatcctccctgatcgaccggacgcag
[0258] aaggcaatgtcataccacttgtccgccctgccgcttctcccaagatcaataaagccacttactttgccatctt
[0259] tcacaaagatgttgctgtctcccaggtcgccgtgggaaaagacaagttcctcttcgggcttttccgtcttta
[0260] aaaaatcatacagctcgcgcggatctttaaatggagtgtcttcttcccagttttcgcaatccacatcggcca
[0261] gatcgttattcagtaagtaatccaattcggctaagcggctgtctaagctattcgtatagggacaatccgatat
[0262] gtcgatggagtgaaagagcctgatgcactccgcatacagctcgataatcttttcagggctttgttcatcttc
[0263] atactcttccgagcaaaggacgccatcggcctcactcatgagcagattgctccagccatcatgccgttca
[0264] aagtgcaggacctttggaacaggcagctttccttccagccatagcatcatgtccttttcccgttccacatcat
[0265] aggtggtccctttataccggctgtccgtcatttttaaatataggttttcattttctcccaccagcttatatacctta
[0266] gcaggagacattccttccgtatcttttacgcagcggtatttttcgatcagttttttcaattccggtgatattctca
[0267] ttttagccatttattatttccttcctcttttctacagtatttaaagataccccaagaagctaattataacaagacg
[0268] aactccaattcactgttccttgcattctaaaaccttaaataccagaaaacagctttttcaaagttgttttcaaag
[0269] ttggcgtataacatagtatcgacggagccgattttgaaaccgcggtgatcacaggcagcaacgctctgtc
[0270] atcgttacaatcaacatgctaccctccgcgagatcatccgtgtttcaaacccggcagcttagttgccgttctt
[0271] ccgaatagcatcggtaacatgagcaaagtctgccgccttacaacggctctcccgctgacgccgtcccgg
[0272] actgatgggctgcctgtatcgagtggtgattttgtgccgagctgccggtcggggagctgttggctggctg
[0273] gtggcaggatatattgtggtgtaaacaaattgacgcttagacaacttaataacacattgcggacgtttttaat
[0274] gtactgaattaacgccgaattaattcgggggatctggattttagtactggattttggttttaggaattagaaat
[0275] tttattgatagaagtattttacaaatacaaatacatactaagggtttcttatatgctcaacacatgagcgaaac
[0276] cctataggaaccctaattcccttatctgggaactactcacacattattatggagaaactcgagtcaaggtag
[0277] atcccaaagagaattcaaatcacaaaggttgaaatcccaaaaggagtcatcatcaacatttggaaactcc
[0278] attaagttctcctcttgtaatgaagagcatgacccaattttctcactgtctacatgttctcccaagttccacaaa
[0279] ctgtcacaccacatttcacatggtattggggcattacctagatctggttttgaagtagaagcacactctctac
[0280] caatttgatttgaagccatattctctgagtaatcaagatctctaggaatactatttttccccttcaaccaatttga
[0281] atgacttgacaaagttataggacgaggtttaataacttcatgagctttcatggtttccttaggtttatcgttttct
[0282] ttctcttcttccttttctgaaaccactttctttgccaaatttgtgtgccaatagttcttcacatcattagctgttcta
[0283] cccggaagccttccagcaatcaatgaccatctatttcctagtagtttgtgtaaccttaggatcaaatcttcttc
[0284] atcctcagaaaatcttcctctgttgatgttggggcttaagtaatttaaccacctcaatctacaactttttctgcat
[0285] ctattcaatccagatctctgaggaactaaattccattttccttcaccgtacgtgttaatgcaagccttgagtag
[0286] ctcatcttccttgtaagtccatgcgccttttctcacacctccggtattctccatctcgagagagatagatttgta
[0287] gagagagactggtgatttcagcgtgtcctctccaaatgaaatgaacttccttatatagaggaaggtcttgc
[0288] gaaggatagtgggattgtgcgtcatcccttacgtcagtggagatatcacatcaatccacttgctttgaagac
[0289] gtggttggaacgtcttctttttccacgatgctcctcgtgggtgggggtccatctttgggaccactgtcggca
[0290] gaggcatcttgaacgatagcctttcctttatcgcaatgatggcatttgtaggtgccaccttccttttctactgtc
[0291] cttttgatgaagtgacagatagctgggcaatggaatccgaggaggtttcccgatattaccctttgttgaaaa
[0292] gtctcaatagccctttggtcttctgagactgtatctttgatattcttggagtagacgagagtgtcgtgctccac
[0293] catgttatcacatcaatccacttgctttgaagacgtggttggaacgtcttctttttccacgatgctcctcgtgg
[0294] gtgggggtccatctttgggaccactgtcggcagaggcatcttgaacgatagcctttcctttatcgcaatgat
[0295] ggcatttgtaggtgccaccttccttttctactgtccttttgatgaagtgacagatagctgggcaatggaatcc
[0296] gaggaggtttcccgatattaccctttgttgaaaagtctcaatagccctttggtcttctgagactgtatctttgat
[0297] attcttggagtagacgagagtgtcgtgctccaccatgttggcaagctgctctagccaatacgcaaaccgc
[0298] ctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggca
[0299] gtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccgg
[0300] ctcgtatgttgtgtggaattgtgagcggataacaatttcacacaggaaacagctatgaccatgattacgcc White sweet clover MaPDS gene sequence (SEQ ID NO.2):
[0301] atggctctttcttgccctatattttcaccaaacttgaattggcaaattgggccaaaaaccatatcaaaatcaa
[0302] gctcttctatgaactcatacaccacaatttcgttatcattttctagtagcatgtcaatgggtcttaacttgaggtt
[0303] caatcttgcttcagcttcaactcgtgcttctaagagtaacaggtttaggaaccatggttctcctttgaaggttg
[0304] tttgcattgattatccacgccctgagcttgataatactgttaatttcattgaagctgcttatttgtcttccaccttt
[0305] cgtgcttctcctcgtcctattaaacctttgaaggttgttattgctggtgcaggtaacaattatccatcttgttttat
[0306] ggttcaagattgtaactttgctactgaatttgttgtttttgttgattttgttctattgggtgtttttgaattaggagtt
[0307] atttttactggtccattagttgattaattgacttgagttttgtcttctaatgatcatagaaactatgaagcaccga
[0308] cacaaatacataacacgacactcgacaccagtagtaatttgtaaaaaatgacataattgaatgtaatcaca
[0309] agagtggtgtcatgtcggacacggacacgtgttggacacccaggccttcaatcagaattgtcgatgctgc
[0310] ataggtggaaagtgagaatgggataggattgtcaattatattatgagcttcttgcttggtatcttaggcagat
[0311] atattctttatgcctgaaaggaatttgtagttcctttcttatgtgtaagttgttttataagctatcgtggagtgttta
[0312] tagaaaaaagctgaaaatagcttatgaacatgttataagttgttttcattagctctgccaaacagtctcccaat
[0313] tgtttatgttagtagtagataaggctagacatatctgaaggcattatcacataatgtgagatccagtgccaat
[0314] tagaaaaaaattacggaatttattgtagcattttcaatttttaaaatttaaaattaaaatgaaggtacaccatattaac
[0315] atgttggatatttaagcgaaaatcgattgtgatatttgtgtatgagttttggccgctttctttctcttttggattgat
[0316] ttgttcttcaatttatcacaggactggctggtttgtcaactgcaaaatatttggcagatgctggtcacaagcct
[0317] atattgctgggaggcaagagacgttctaggtggaaaggttttccgactaatttaatctcatttgtcaataagctt
[0318] ctttttgtgcttcttgtattgatcattttagcttgctgtttagttaaatatgaaacctgttcttatttgactgttccta
[0319] actaatttaattcaagttcttgatgaattatttctggctctttggagtggtaatgttgaacttcatcatcaagtt
[0320] tttttaaagattcaacagtacgtgcaagttattattataattcaattttaaatgttttcatactattttcttattttcta
[0321] aggttgctgcgtggaaagatgaagagggagattggtatgagaccggcctacatatattttgttagttcatta
[0322] caatgtctagcttaacttttataatacacatttgtcaatttaataatacatctttagtaaaaccttttttccatcgct
[0323] aagagagataaaaaagtaaaactggagttatgaattctcctaaagctttgaagacaccacaggaga
[0324] aaaaaagtagtagagaaaaaatgacataaaaaccattctttgaccttttcctagtgtatgctctcggtag
[0325] ttttggtctttgacgcaatcccaactaccaagtccaatgccttttgccttcatgactcagacatctaattaaga
[0326] accaaatttcagataaaagaaggcatgggttaacctgtgctctgtccaagcttcaatctcaaaggactttt
[0327] gcatgagtgggaaatttgttcttaacactgcatgtggaccagttagcccttggcacatgtattgaactatttt
[0328] gatattctttttagtttgccattctaataataataatttactggaactcaatgctagtatttaatcaatatggtcatt
[0329] tttattatttgaatccttgtttataactatcctgacttaacgttttctttttccgaagctttggggcttaccctaat
[0330] gtgcagaacctatttggagagctcagtattaatgatcggttacaatggaagggcattcgatgatctttgct
[0331] atgccaagcaagcctggagagtttagtcgatttgattttcccgaagtccttccatctccgttaaatggtaaga
[0332] tgtaagactttacatatgtagttgcatattcgtataactacctgaagttgaaagtttctttaatgcacatgaagt
[0333] gtataatacatatagtatctggcaattttcattccaatgtgatggccagtgccacaaaaacctgagttcag
[0334] attaaggaataacccttggaagttggaagatttaacacagcatgccagttaaaatttgtttttgaatatattttg
[0335] atgtattttgaagctattctggtagtcttttagtataaatgaagaaaaaggaatagattgatatgatatgccatt
[0336] taaattttttagtataaataaattgctctatggtatgatcaagatattaaaacttactagatctctttttcatatattc
[0337] taacacatttgataatcattgaaaccagatgtgataaattggttccattttatgtgaagtgaaatcacaaatgg
[0338] ggatcaagggttttgttgtttaaaagggattccgatattctttgacgctcttattttatttctttttctttcgtcacta
[0339] atctggtttgcggggctgctatatacttttctcttttaaaaaggaccaacttattttcttacttaatattagcaaat
[0340] gtttacaagttgcatgctgtgaatgtgataacaggaatatgggcaatcttgaggaataatgagatgctgac
[0341] ctggccagagaaaatcaaatttgcaattggacttcttccagctatgcttggtggacaggcgtatgtcgagg
[0342] ctcaagatggtgtttctgtaaaagaatggatgaaaaagcaggtatggcagttgtcttgattccgtaactgtg
[0343] gcagttcattaatatatttatattccttggctatatcaccagtcaaggtcatggcctgttgtgacttaaaaatttc
[0344] aaagggaaatcttgtcagtttgtaaatggagtggagtcttaaccatcttagtgatactgatgataagtattca
[0345] atctgaaatgggttgatttaggatggatttccagtgacttgatgatgataataaggagtcctttaatcattgaa
[0346] aatcaaattatctcagatgaacctctgtgttaatttattttcatgctacttatagttatcaactcgaaaacaaact
[0347] atgatattatatttgtattaaataatgcactaaaactccggtgttgtttttttctcaaaaaaaaataataaattgtta
[0348] gaaatctggggggctaactcatccttacaaaaccggcttgtgaggtgaaggattgcccccacttataaagtc
[0349] attgtcaggccatcacttatccgatgtgggactatttaacataaattaaagcactaaaagatctttttgtaaag
[0350] aaagagtttacttacttccaagtgtgggtgaatattaaattgtgtactttgttttatctcctaactatggcagtcc
[0351] taataactttcactactgggaaataaagaaaggatatctgtagtttttgatgttatattaaattattactttgaga
[0352] ataaatgttctctaccttctgttgaattcacctgaacatattgcattcttctcatggtgtacacgttgcaaatagt
[0353] ttgagaatagattatcaaaaagaaaaaatatatatagttttagaataacacattgtttattccatattatagggc
[0354] attcctgaacgggtaactgatgaagtattcatagcaatgtcgaaggctctaaacttcatcaaccctgatgaa
[0355] cttcaatgcaatgtattttgattgctttaaaccgatttcttcaggtgcgatcatttcattttcttaaacattattctg
[0356] cctatgtaaatgtttgtttaacaaggccattccattcatattacttttgaacataatccgatttgcaataaactca
[0357] ttccatccagggtttatgaaacataggatcaagtgcttcttcttctcaactaattattatattattgaattcttcaa
[0358] taggagaagcatggttctaaaatggcctttttagatggaaatccccctgaaagactttgtatgccaattgttg
[0359] atcatattcggtccttgggtggtgaagtccatcttaattcacgcattaaaaatattgagctaaacgatgatag
[0360] cacagtgaagagctttttactaactaatgggaaggtgattgaaggggatgcttatgtgtctgcagcaccag
[0361] gtatgtttaaaagacttccacactattaattaattgttcatcgaactcttggtctccatttcttacatttttgagga
[0362] tttccgccccttaaacagtggatattctgaagcttcttcttcctgagaactggaaaggggttccatatttcca
[0363] gagattggagaaattagttggagttccagtcataaatgttcacatatggtaagtaatggcttttgatgtcgaa
[0364] aactaagtccatgcaaaagttatactccaattttttgttaaatattgtggtcattattatttttttctttctaccaaat
[0365] atataaactctcatgtttactgaaaaatttggaatagaaatctgtgccagttgtagatatcttaaattttactaat
[0366] gacaaaatgcgtaagttatattcttctttgactggttgtaatagttttggttaatgaaaaaaatatatgtaaaaat
[0367] aaggtaattgtggaaaaacctatttcaatatgtaaactaatcgctggcactaactgatgcagtaatatacttc
[0368] tgttattgttaaaagaaaattctcattatactgacgtatcttctccaaattcagattaacaactaaattagtttgta
[0369] atatttgtcagtgaggattacattatcagctccaccagagtgctgacatactatttatgtttcaaatttgcaggt
[0370] ttgacagaaaattgaagaacacatatgatcaccttctctttagcaaggttttcctcacactttgaaacacttgt
[0371] gatgcctagatagggatgaaaagatagtggatttttacttgtgtggtgtgtgtagcaaatgtatgatggtttta
[0372] gctgtgaagatcacttcctttttgttgtttgaaacggacatctttctttctttgcattcatgatatcacttgtgaatt
[0373] ataaatacatcttttcatcaactcacatctacaatttctatttcgcttcatgcagaagtccccttctgagtgtata
[0374] tgccgacatgtcagtaacttgtaaggtaaaagccgccactcaaatgtattgattagcactgatgtatttcctc
[0375] tatccatgccaaagttgtggccttaatggtctctagggtaacatacacatgtatatgtttgtattcaattgagat
[0376] acctgcatgaatttgagatagtgctttctggataaacagtaaactccgcacaaattatttcagttttttgtaatc
[0377] tgtgaccgaatttcttctgcatataactatttgtttggttacaactgaactttgtaatgctgtttggtaactgtgttt
[0378] cactatcttatgtaggaatactataacccaaaccagtctctatgttggagctggtttttgcaccagccgaagaa
[0379] tggatttcacgtagtgatgaggatattattggtgccacaatgtctgaacttgccaaactcttccctgatgaaa
[0380] tttctgcagaccaaagcaaagcaaaaatcatcaagtaccacgttgttaaaactccaaggtttgagtcccac
[0381] tgagttggattatttcttttaacatcttttaccaaacatatgctgtaattatgacattttattttgtcttctgagtcct
[0382] aatgtaactgacatccttgtttcaggtcggtttacaaaactgttccaaattgtgaaccatgtcgtcccataca
[0383] aagatctcctatagaaggtttctatttagctggagattacacaaaacaaaaatatttagcttccatggaaggt
[0384] gctgttctttctgggaagctttgtgcacaggctattgtacaggattcggagctacttactgctcggggccag
[0385] aaaagaatagctcaagcaagtactgtttaa。
Claims
1. A genome editing system for Osmanthus fragrans, characterized in that, The editing system is CRISPR_2.0-MtLAP1-KO-MaPDS, where MtLAP1 is the LAP1 gene of alfalfa, and KO-MaPDS indicates that the editing system targets the MaPDS gene of sweet clover. The nucleotide sequence of the editing system is shown in SEQ ID NO.
1.
2. A method for efficiently editing the MaPDS gene in the hairy roots of Osmanthus fragrans using the editing system described in claim 1, characterized in that, The method includes the following steps: Step 1: Take the hypocotyl of sterile 3-5 day old sweet osmanthus seedlings and make a wound on the hypocotyl using a sterile needle to use as an explant for inducing hairy roots of sweet osmanthus. Step 2: Thaw Agrobacterium rhizogenes LBA9402 competent cells on ice, add CRISPR_2.0-MtLAP1-KO-MaPDS plasmid DNA, incubate on ice for 30 min, freeze in liquid nitrogen for 2-3 min; incubate at 37℃ for 3 min, add antibiotic-free LB medium, incubate at 28℃~200rpm~2h; spread on solid LB medium containing kanamycin and rifampin, incubate upside down at 28℃; identify single clones by PCR, and preserve positive colonies; Step 3: The bacterial suspension obtained in Step 2 was inoculated into liquid LB basal medium containing kanamycin and rifampicin resistance, and cultured at 28℃~200rpm; when the bacterial suspension concentration OD 600 When the OD value reaches 0.6-0.8, centrifuge to enrich the bacterial cells; resuspend the bacterial culture in sterile SH liquid medium to OD. 600 Values of 0.3-0.4 were used as an infection solution to induce the hairy roots of Osmanthus fragrans var. spp.; The SH liquid culture medium is SH basal culture medium with a final concentration of 15 g·L. -1 sucrose + 100 μmol·L -1 Acetyleugenol, pH 5.95; Step 4: Place the hypocotyl explants prepared in Step 1 into the infection solution for inducing hairy roots of Osmanthus fragrans, vacuum for 5 minutes, shake and incubate for 30 minutes, and then place them on sterile filter paper to air dry; after co-culturing on co-culture medium for 2 days, transfer them to hairy root induction medium to induce hairy root development; change the induction medium every 15 days. The co-culture medium is SH basal medium + 30 g·L -1 Sucrose + 7.8g·L -1 Agar + 4 mg / L -1 2,4-D + 0.5 mg·L -1 6-BA + 100 μmol·L -1 Acetyleugenol, pH 5.95; The hairy root induction medium is 1 / 2 MS basal medium + 15 g·L⁻¹ -1 Sucrose + 7.8g·L -1 Agar + 400 mg / L -1 Termetidine + 1 mg / L -1 glufosinate + 0.1 mg·L -1 IBA, pH value 5.95; Step 5: Select the purplish-red hairy roots of the white-flowered sweet osmanthus by visual inspection, extract DNA using the CTAB method, and perform PCR amplification and sequencing.
Citation Information
Patent Citations
Induction method for rapidly obtaining sweet clover hairy roots
CN118266404A