Epstein-barr virus vaccine

Abstract

The present invention relates to vaccines based on viral vectors for delivery of antigens against infectious diseases. In particular, the present invention relates to a recombinantly modified vaccinia virus Ankara (MVA) encoding EBV antigens that elicit infectious mononuclear hyperplasia (IM) and different cancer types. The invention also relates to medical application of the recombinant MVA in prevention of diseases caused by EBV (Epstein-Barr Virus).

Description

Field of the Invention

[0001] The present invention relates to the field of vaccines. More specifically, the present invention relates to vaccines based on viral vectors for delivering antigens against infectious diseases. Specifically, the present invention relates to a recombinant modified vaccinia virus Ankara (MVA) encoding EBV antigens that cause infectious mononucleosis (IM) and different types of cancer. The present invention also relates to recombinant MVA encoding partial EBV antigens (such as glycoproteins and transcriptional transactivators of EBV). The present invention also relates to the medical use of recombinant MVA in preventing diseases caused by EBV. Background Art

[0002] Epstein-Barr virus (EBV) is an oncogenic gammaherpesvirus that causes acute infectious mononucleosis (AIM) and has been associated with the development of a variety of human malignancies. Approaches to EBV vaccine development have been limited, in part, by the oncogenic potential of the EBV genome and the lack of animal models to test vaccine candidates. The EBV envelope glycoproteins gp350 / 220 have been proposed as vaccine antigens. However, in small-scale phase I / II clinical trials, vaccination with either vector constructs expressing gp350 / 220 or purified recombinant gp350 proteins failed to protect against EBV infection, although it did reduce the incidence of acute infectious mononucleosis (AIM) in young adults. Importantly, recombinant EBVΔgp350 / 220 can infect epithelial cells and primary B cells in vitro. Although previous studies have shown that immunity to gp350 / 220 can limit infection, the success rate of using gp350 / 220 as a single vaccine antigen has been low, and innovative approaches that utilize multiple EBV proteins are needed.

[0003] At least four EBV gp350 / 220 vaccine candidates have been tested in “clinical trials”, such as a vaccinia vector expressing gp350 / 220 (Gu et al., 1995 Phase I-Chinese population, EBV 1-3yearsold children)) and recombinant gp350 (non-splicing variant) in CHO cells (3-dose regimen with ASO4 as adjuvant) (Jackman et al., 1999; Moutchen et al., 2007. (Phase I / II) Safety and Immunogenicity inaged 18-37years old EBV Belgians; Sokal et al., 2007. Phase Irandomized, double-blind placebo control in aged 16-25 years EBV Belgians; Rees et al., 2009. Phase I chronic kidney disease kids awaiting organ transplants (UK)). However, none of these vaccine candidates were able to completely block EBV infection.

[0004] Notably, EBNA1, LMP2, and gp350 / 220 antigens have been developed and tested independently in various clinical trials as vaccine candidates against EBV-infected and EBV+ cells with promising results.

[0005] Candidate therapeutic vaccines in clinical trials include MVA vectors expressing EBNA-1 and LMP1 or LMP2 (Taylor et al., 2004 construction of the MVA vector expressing EBNA1 and or LMP2; Hui et al., 2013 EBNA1-LMP2 (Phase I targeting NPC patients in China); Taylor et al., 2014 EBNA1-LMP2 (APhase I Trial in UK Patients with EBV-Positive Cancer), and adoptive transfer of PBMCs for the treatment of PTLD and NPC (Louis et al., 2009, 2010, Heslop et al. 1996 T cells adoptive transfer; and Chia et al., 2012 Phase I targeting NPC patients in China. Dendritic cells are transduced with adenovirus vector Recent Phase I clinical trials of recombinant modified vaccinia virus Ankara (MVA) vectors encoding a vaccine candidate with the Gly-Ala region deleted from the EBNA1 sequence fused to LMP2 have elicited strong EBV-specific CD4+ and CD8+ T cell responses in humans. However, the strategy used to deliver these two important EBV antigens, known for their oncogenic potential, may pose significant health risks, especially for immunosuppressed individuals. Furthermore, due to the choice of nonstructural viral proteins as antigens, these vaccine candidates are unable to generate neutralizing antibodies to eliminate reactivated or new EBV infections.

[0006] Therefore, there is an urgent need for safe EBV vaccines that prevent EBV infection and / or limit EBV disease symptoms and that, by preventing or at least better controlling infection, would also reduce the burden of EBV-induced malignancies. Summary of the invention

[0007] The object of the present invention is to provide a vaccine against EBV infection and related diseases. In particular, the object of the present invention is to provide such a vaccine, which involves T cell as well as antibody responses to vaccine candidates.

[0008] The inventors have discovered that a multivalent EBV vaccine based on the MVA-BN vaccine vector can elicit robust antibody and T cell responses. The compositions and techniques disclosed herein satisfy a need in the art.

[0009] In one aspect, the present invention relates to a recombinant poxvirus comprising two or more EBV envelope glycoproteins and one or more T cell antigens. In some embodiments, the EBV envelope glycoproteins include gp350, gB, gp42, gH, gL, gM, gN, BMRF2, BDLF2, BDLF3, BILF1, BILF2 and BARF1. In some embodiments, the T cell antigens include EBNA1, EBNA2, EBNA-3A, EBNA-3B, EBNA-3C, EBNA-leader protein, late membrane protein 1 (LMP1) and LMP2. In some embodiments, MVA also includes BRLF1 and BZLF1 proteins.

[0010] In a related aspect, the present disclosure relates to a pharmaceutical composition comprising a therapeutically effective amount of a recombinant poxvirus comprising two or more EBV envelope glycoproteins and one or more T cell antigens. In some embodiments, the EBV envelope glycoproteins include gp350, gB, gp42, gH, gL, and any other known EBV envelope glycoproteins, such as gM, gN, BMRF2, BDLF2, BDLF3, BILF2, BILF1, and BARF1. In some embodiments, the T cell antigens include EBV nuclear antigen 1 (EBNA1), EBNA2, EBNA-3A, EBNA-3B, EBNA-3C, EBNA-leader protein, and / or LPMP1 and LMP2. In some embodiments, MVA further comprises BRLF1 and BZLF1 proteins.

[0011] In some embodiments, the vaccine composition or pharmaceutical composition further comprises one or more additional pharmaceutically acceptable antigens. In some embodiments, the pharmaceutical composition further comprises one or more adjuvants. In some embodiments, the vaccine composition or pharmaceutical composition further comprises one or more pharmaceutically acceptable carriers.

[0012] In a related aspect, the invention relates to a method of inducing an immune response in a subject, the method comprising administering a pharmaceutical composition to a subject in need thereof, wherein the immune response is a broad antibody or T cell response against EBV antigens in a human subject.

[0013] In a related aspect, the present invention relates to a method for preventing or treating EBV infection or a disease associated with EBV infection, comprising administering a preventively or therapeutically effective amount of the poxvirus or the above-mentioned pharmaceutical composition to a subject in need thereof.

[0014] In a related aspect, the present invention relates to an immunization regimen comprising administering to a subject in need thereof one or more doses of a prophylactically or therapeutically effective amount of MVA, or a pharmaceutical composition as described above.

[0015] In a related aspect, the present invention relates to a recombinant poxvirus or a pharmaceutical composition for use in a method for preventing or treating EBV infection or a condition associated with EBV infection.

[0016] In a related aspect, the invention relates to a recombinant poxvirus or a pharmaceutical composition for use in a method of inducing an immune response in a subject by administering the pharmaceutical composition of the invention to a subject in need thereof, thereby obtaining an immune response against one or more EBV antigens in a human subject.

[0017] These and other objects of the present invention will be further described in detail in conjunction with the detailed description of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate several embodiments of the invention and, together with the description, serve to explain the principles of the invention.

[0019] Figure 1 A schematic diagram of the vaccine candidate MVA-mBN443 is shown. The figure outlines the integration sites IGR44 / 45 and IGR88 / 89 used to generate MVA-mBN443. The reading frames of the inserted EBV-derived genes are represented by boxes. The arrows represent the promoters that drive the expression of the MVA-BN antigens.

[0020] Figure 2 Amino acids 1-434 of gp350 are shown fused to the yeast derived GCN4 multimerization domain (GCN4multi) via the hinge region and the cysteine ​​containing domain (Linker and Cys). The cysteine ​​containing domain should allow for disulfide bond formation between multimers.

[0021] Figure 3The organization structure (a) of BZLF1-BRLF1 fusion protein is shown. The following regions of full-length BRLF1 have been removed: dimerization domain (aa 2-23), nuclear localization domain (aa407-421). The following regions are removed from full-length BZLF1: transcription activation domain (aa 33-52 and aa 68-78), DNA binding domain (aa 180-187), dimerization domain (aa203-208), ankyrin-like Zank domain (aa 237-245). In addition, a part of BZLF1 protein (aa188-202) is reorganized to the N-terminal between BZLF1 domain aa 1-32 and aa 53-67. BRLF1 and BZLF1 sequence fusion produce BZLF1-BRLF1 fusion protein. (b) The amino acid sequence of the BZLF1-BRLF1 fusion protein of the resulting reorganization is shown. To prevent the formation of predicted neo-epitopes at the junctions between the different fragments of the BZLF1-BRLF1 fusion protein, several point mutations were introduced (highlighted in bold letters).

[0022] Figure 4 Modifications introduced into EBV-derived EBNA-3A at the amino acid sequence level are shown. Six potential nuclear localization signals in EBNA-3A (the first six deleted sequences) were deleted. In addition, the binding sites for the cellular transcription regulator Jκ (the second highlighted sequence) and CtBP (the last two deleted sequences) were eliminated by point mutation and deletion, respectively. Potential glycosylation sites were removed by mutating threonine to alanine (also highlighted). To avoid the formation of potential new epitopes, the deletion range extends beyond the corresponding motif. Finally, EBNA-3A was modified by adding an N-terminal secretion tag (the first highlighted sequence) and a C-terminal linker and transmembrane domain (the last highlighted sequence). Amino acid changes are indicated in bold letters and deleted amino acids are indicated in strikethrough letters.

[0023] Figure 5 The plasmid map of pBN640 is shown, which contains the genes for the gp350 multimer (under the control of the PrMVA13.5 long promoter), as well as the gH and gL genes (under the control of the PrS and PrH5m promoters). The complete expression cassette was inserted via the SacII and NheI restriction sites into pBNX202, which contains the MVA-BN DNA sequence of IGR 88 / 89 flanking the MVA-BN genome (F1 and F2 IGR88 / 89), and the IGR 88 / 89 repeat sequence called Flanking 2 Repeat (IGR 88 / 89F2rpt) for later excision of the selection cassette via homologous recombination in the absence of selection pressure, generating pBN640.

[0024] Figure 6 Shown is the BZLF1-BRLF1 fusion protein (under the control of the PrMVA13.5 long promoter) and EBNA-3A (under the control of the Pr1328 promoter) inserted into pBNX204 via SacII and SpeI restriction sites. pBNX204 contains the MVA-BN DNA sequence flanking IGR 44 / 45 of the MVA-BN genome (F1 and F2 IGR44 / 45) and two loxP sites for later excision of the selection cassette.

[0025] Figure 7 The expression plasmid pBN274 encoding the site-specific CRE recombinase is shown.

[0026] Figure 8 A flow chart showing the MVA-mBN443 production process.

[0027] Fig. 9 A schematic diagram of the vaccine candidate MVA-mBN444 is shown. The figure outlines the integration sites IGR44 / 45 and IGR88 / 89 used to generate MVA-mBN444. The reading frames of the inserted EBV-derived genes are represented by colored boxes. The arrows represent the promoters that drive the expression of the MVA-BN antigens.

[0028] Fig.10 The plasmid map of pBN641 is shown, which contains the genes for the full-length gp350 multimer (under the control of the PrMVA13.5 long promoter), as well as the gH and gL genes (under the control of the PrS and PrH5m promoters). The complete expression cassette was inserted into pBN640 via the SacII and MluI-HF restriction sites, from which the gp350-multi, GH-gL expression cassette was removed by digestion with SacII and MluI-HF restriction endonucleases, resulting in pBN641. Thus, plasmid pBN641 contains the same MVA-BN DNA sequences as IGR 88 / 89 flanking the MVA-BN genome (F1 and F2 IGR88 / 89), as well as IGR 88 / 89 repeat sequences called flanking 2 repeats (IGR 88 / 89F2rpt) for later excision of the selection cassette via homologous recombination in the absence of selection pressure.

[0029] Fig.11 A flow chart showing the MVA-mBN444 generation process.

[0030] Fig.12EBV-gp350-specific serum total IgG titers are shown. BALB / c mice were immunized with TBS (buffer control), MVA-mBN443 or MVA-BN444 on day 0 and boosted with the same test article by intramuscular route on day 28. Blood was drawn and serum was prepared on days 14, 26 and 42. EBV-gp350-specific total IgG titers were determined by multiple ELISA assays (EU=ELISA units) containing three types of beads coupled to three different EBV antigens (gp350 His tag, gH (DI-DIII) / gL / gp42 (extracellular domain) complex, gH extracellular domain). Bound antibodies were detected using PE-coupled Fc-specific goat anti-mouse IgG preparations. The gp350-specific fluorescence was measured using a Luminex 200 instrument. N=5 mice per group. On day 14, only two mice were blooded per group.

[0031] Fig.13 EBV-gH / gL specific serum total IgG titers are shown. BALB / c mice were immunized with TBS (buffer control), MVA-mBN443 or MVA-BN444 on day 0 and boosted with the same test article via intramuscular route on day 28. Blood was drawn and serum was prepared on days 14, 26 and 42. Total IgG titers specific for gH / gL / gp42 were determined by multiple ELISA assays, as Fig.12 As described in the figure legends. N = 5 mice per group. On day 14, only two mice per group were bled.

[0032] Fig.14EBV specific neutralization activity in immunization mouse serum is shown.BALB / c mice were immunized with TBS (buffer control), MVA-mBN443 or MVA-BN444 at day 0, and strengthened with the same test article by intramuscular route at day 28.Blood was drawn and serum was prepared at day 14, 26 and 42.Serum was added to the EBV virus preparation (strain B95 / 8) produced in Ramos cells with a dilution of 1:2, and after incubation for one hour at 37 ℃ and 5% CO2, virus-antiserum mixture was applied to the Ramos cells in V-shaped 96-well plates as indicator cells with a volume of 25 μl.After incubation for 30min at 37 ℃ and 5% CO2, cells were washed twice and incubated overnight at 37 ℃ and 5% CO2.Infected Ramos cells were detected using LSRFortessa flow cytometer by staining with anti-EBV monoclonal antibodies coupled to Alexa647. Negative serum controls must yield 0.05% to 0.5% EBV positive cells to meet the assay acceptance criteria. Neutralizing titers were calculated as the reciprocal of the dilution that achieved half maximal inhibition (IC50) of cell culture infection. N = 5 mice per group.

[0033] Fig.15 The ELISPOT reaction of murine splenocytes after two weeks of boosting is shown. Mice were immunized with TBS (buffer control), MVA-mBN443 or MVA-mBN444 on day 0 and boosted with the same test article by intramuscular route on day 28. After boosting, splenocytes were isolated on day 42 and restimulated with gH peptide #1 (EBV peptide #1 (LYEASTTYL)), BRLF1 peptide #11 (EBV peptide #11 (TYSKVLGVDRAAI)) and EBNA-3A peptide (EBV peptide #16 (MYIMYAMAIRQAI)) in ELISPOT assays. IFN-γ positive spots were counted. All counts were subtracted from background (vehicle control stimulation). N = 5 mice per group.

[0034] A brief description of the sequence

[0035] SEQ ID NO: 1 depicts the nucleic acid sequence of the gp350 multimer (1455 nucleotides).

[0036] SEQ ID NO: 2 shows the nucleic acid sequence of gH (2121 nucleotides).

[0037] SEQ ID NO: 3 shows the nucleic acid sequence of gL (414 nucleotides).

[0038] SEQ ID NO: 4 shows the nucleic acid sequence of BZLF1-BRLF1 (2283 nucleotides).

[0039] SEQ ID NO: 5 shows the nucleic acid sequence of EBNA-3A (2892 nucleotides).

[0040] SEQ ID NO: 6 depicts the DNA sequence of a loxPV site.

[0041] SEQ ID NO:7 shows the nucleic acid sequence of the Pr13.5 long promoter.

[0042] SEQ ID NO: 8 depicts the nucleic acid sequence of the PrS promoter.

[0043] SEQ ID NO:9 shows the nucleic acid sequence of the PrH5m promoter.

[0044] SEQ ID NO: 10 depicts the nucleic acid sequence of the Pr1328 promoter. DETAILED DESCRIPTION

[0045] Reference will now be made in detail to exemplary embodiments of the present invention, examples of which are illustrated in the accompanying drawings.

[0046] Provided herein is an expression system, vector, virus, vaccine / pharmaceutical composition for preventing or treating EBV infection. The single multivalent EBV subunit vaccine described in detail below can stimulate humoral (antibody) and T cell-mediated immunity, and produces preventive and therapeutic antiviral responses for EBV infection and EBV-related malignancies. As considered by the present invention, at least two EBV envelope proteins and at least one T cell antigen are expressed, and our goal is to increase the breadth of antibodies and T cell immune responses for EBV, and thereby improve the protective efficacy of the vaccine.

[0047] EBV uses multiple glycoproteins to initiate entry and infection of host cells, making these glycoproteins potential targets for preventive vaccines. gp350, gB, gp42, and the gH / gL complex or BMRF2 / BDLF2 complex are attachment / fusion glycoproteins that mediate EBV entry into host cells. They are expressed on virions and in infected cells and stimulate humoral and cellular immune responses in humans and animal models. gp350 cell receptor interactions initiate EBV attachment to B cells and trigger endocytosis of virions. Although this interaction enhances infection, it is not essential. To date, all clinical trials using gp350 proteins as the sole target protein for eliciting neutralizing antibodies have failed.

[0048] Antibodies provide the adaptive immune system's first line of defense against viral infection. Neutralizing antibodies (nAbs) against EBV envelope glycoproteins are present in humans, protect against neonatal infection, and are produced in response to human immunization. However, limited evidence for immune selection of persistent EBV infection and viral antigenic variants suggests that in vivo neutralization of EBV infection is suboptimal. Therefore, it is important to develop a multivalent EBV vaccine that can trigger both branches of the immune system to elicit robust humoral and cellular responses.

[0049] The ability of gB and gH / gL antibodies to neutralize infection is also well conserved in herpes simplex virus 1, cytomegalovirus, and Kaposi sarcoma-associated herpesvirus. Furthermore, gB acts as a fusion machinery, and gp42 and the gH / gL complex confer host cell specificity, mediating EBV entry into B cells and epithelial cells, respectively. Importantly, the gp42 protein is unique to EBV, and recombinant EBV lacking either gp42 or gH does not infect epithelial cells or primary B cells.

[0050] Although some functions of some viral protein subunits have been studied, the selection of the appropriate viral protein subunit is very important and unpredictable for the generation of an effective vaccine. Although the major EBV surface glycoprotein gp350 / 220 (gp350) has been recognized as an important antigen, attempts over the past four decades to develop a potent gp350-based vaccine have met with limited success. In four independent phase I / II clinical trials, vaccination with vector constructs expressing gp350 or purified recombinant non-spliced ​​variant gp350 soluble protein did not protect against EBV infection, although there was a reduction in acute infectious mononucleosis in young adults.

[0051] Selection of an appropriate platform is also important and difficult to predict. As disclosed herein, vaccinia virus (MVA) allows for the inclusion of multiple selected surface glycoproteins and intracellular T cell antigens in a multivalent vaccine.

[0052] Similar to other herpes viruses, EBV uses multiple surface glycoproteins to enter various cell types. Therefore, it is necessary to include multiple glycoproteins in the vaccine to overcome the limitations of using gp350 alone to prevent EBV infection. This article discloses a platform for expressing and presenting multiple EBV surface glycoproteins (gp350, gB, gp42 or gH / gL) to elicit antibodies that can neutralize EBV infection in vivo.

[0053] The current view in the field is that protection against EBV depends not only on the elicitation of nAbs, but also on the induction of CD4+ and CD8+ T cell immune responses specific for viral latent antigens (EBNA-1, EBNA-2, EBNA-3A, EBNA-3B, EBNA-3C, EBNA-LP, LMP1 or LMP2). Therefore, current EBV therapeutic vaccine candidates focus on enhancing such responses.

[0054] The main limitations of vaccines in preclinical and clinical trials to date are that none of them has been able to generate eliminating immunity (i.e., completely block viral infection) and that most strategies target only one branch of the immune system, either the humoral or T cell-mediated branch. Even when both branches of the immune system are targeted in a single vaccine, such as with EBV DNA packaging mutants, vaccine candidates suffer from limited immunogenicity, safety issues, and an inability to induce robust CD8+ T cell responses.

[0055] Therefore, disclosed herein is a novel single preventive and therapeutic multivalent poxvirus / MVA vaccine comprising two or more EBV envelope glycoproteins and one or more T cell antigens. In some embodiments, the MVA vaccine comprises two, three, four, five or more EBV envelope glycoproteins. In some embodiments, the MVA vaccine comprises two or more T cell antigens. In some embodiments, the MVA envelope glycoproteins include gp350, gB, gp42, gH, gL and any other known EBV envelope glycoproteins, such as gM, gN, BMRF2, BDLF2, BDLF3, BILF2, BILF1 and BARF1. In some embodiments, T cell antigens include EBNA-3A or any other EBV antigen. In some embodiments, the MVA vaccine comprises six selected proteins, including three EBV envelope glycoproteins: gp350, gH and gL, and a T cell antigen: EBNA3A. In some embodiments, MVA comprises BRLF1 and BZLF1 proteins in addition to EBV envelope glycoproteins and T cell antigens. In some embodiments, the MVA vaccine further comprises one or more adjuvants.

[0056] In some embodiments, a single vector of a co-expression of two or more EBV envelope glycoproteins (including gp350, gB, gp42, gH and gL) is disclosed herein, wherein each glycoprotein is separated from another glycoprotein. In general, the antigenic properties of the expressed vaccine glycoproteins should be as similar as possible to the counterparts in the EBV virion. The non-structural EBV proteins that serve as T cell targets are regulators of host cell function, and their corresponding activities should be disabled to avoid the adverse effects of the vaccine.

[0057] In some embodiments disclosed herein, EBV envelope glycoproteins, T cell antigens and other proteins to be expressed can be expressed by any suitable expression vector, including plasmid vectors and viral vectors. In some embodiments, modified vaccinia virus Ankara vectors can be used to co-express two or more EBV envelope glycoproteins. Individual glycoproteins and other vaccine target proteins can be connected by cleavage sequences so that the co-expressed glycoproteins and other proteins can self-cleave and self-assemble into two or more glycoproteins and other complexes.

[0058] According to the embodiments described herein, a kind of immunization scheme is provided.The immunization scheme includes the MVA comprising two or more EBV envelope glycoproteins and one or more T cell antigens.The immunization scheme can be applied via primary exemption / enhancement homologous (e.g., only using the same vaccine type) vaccination.The immunization scheme can be applied according to the dosage vaccination schedule involving two or more immunizations, and the immunization scheme can be applied at intervals of 1 week to 12 months.Those skilled in the art can use other suitable immunization schedules or schemes known in the art according to the embodiments described herein.

[0059] According to some embodiments, nucleic acid sequences encoding two or more EBV envelope glycoproteins are assembled into a single vector, wherein a linker sequence is inserted between the nucleic acid sequences encoding the two or more subunits.

[0060] The vaccine compositions described herein may comprise a therapeutically effective amount of an MVA as described herein, and may further comprise a pharmaceutically acceptable carrier according to standard methods. Examples of acceptable carriers include physiologically acceptable solutions, such as sterile saline and sterile buffered saline.

[0061] In some embodiments, the vaccine or pharmaceutical composition can be used in combination with a pharmaceutically effective amount of an adjuvant to enhance the anti-EBV effect. Any immune adjuvant that can stimulate the immune system and enhance the response to the vaccine, and that does not itself have any specific antigenic effect, can be used as an adjuvant. Many immune adjuvants mimic evolutionarily conserved molecules, i.e., pathogen-associated molecular patterns (PAMPs), and are recognized by a group of immune receptors called Toll-like receptors (TLRs). Examples of adjuvants that can be used according to the embodiments described herein include alum, Freund's complete adjuvant, Freund's incomplete adjuvant, double-stranded RNA (TLR3 ligand), LPS, LPS analogs such as monophosphoryl lipid A (MPL) (TLR4 ligand), flagellin (TLR5 ligand), lipoprotein, lipopeptide, single-stranded RNA, single-stranded DNA, imidazoquinoline analogs (TLR7 and TLR8 ligands), CpG DNA (TLR9 ​​ligand), Ribi adjuvant (monophosphoryl lipid A / trehalose diacetate), glycolipids (α-GalCer analogs), unmethylated CpG islands, oil emulsions, liposomes, virosomes, saponin (active fractions of saponin such as QS21), muramyl dipeptide, alum, aluminum hydroxide, squalene, BCG, cytokines such as GM-CSF and IL-12, chemokines such as MIP 1-α and RANTES, activated cell surface ligands such as CD40L, N-acetylmuramine-L-alanyl-D-isoglutamine (MDP) and thymosin α 1. The amount of the adjuvant used can be appropriately selected according to the degree of symptoms exhibited by humans or animals as part of the immune response after administration of such vaccines, such as skin softening, pain, erythema, fever, headache, and muscle pain.

[0062] In other embodiments, as discussed above, the use of various other adjuvants, drugs or additives with the vaccines of the present invention can enhance the therapeutic effect achieved by administering the vaccine or pharmaceutical composition. Pharmaceutically acceptable carriers may contain trace amounts of additives, such as substances that enhance isotonicity and chemical stability. Such additives should be non-toxic to humans or other mammals at the doses and concentrations used, and examples thereof include buffers such as phosphoric acid, citric acid, succinic acid, acetic acid and other organic acids and their salts; antioxidants such as ascorbic acid; low molecular weight (e.g., less than about 10 residues) polypeptides (e.g., polyarginine and tripeptides) proteins (e.g., serum albumin, gelatin and immunoglobulins); amino acids (e.g., glycine, glutamic acid, aspartic acid and arginine); monosaccharides, disaccharides and other carbohydrates (e.g., cellulose and its derivatives, glucose, mannose and dextrins), chelating agents (e.g., EDTA); sugar alcohols (e.g., mannitol and sorbitol); counterions (e.g., sodium); nonionic surfactants (e.g., polysorbates and poloxamers); antibiotics; and PEG.

[0063] Vaccines or pharmaceutical compositions containing the MVA described herein can be stored as an aqueous solution or a lyophilized product in unit or multi-dose containers, such as sealed ampoules or vials.

[0064] The expression systems, vectors and vaccines described herein can be used to treat or prevent any EBV infection or a disease associated with EBV infection, such as EBV+ lymphoma, cancer, PTLD, multiple sclerosis and the like.

[0065] In some embodiments, the vaccine composition or pharmaceutical composition described herein can be administered by direct injection of an MVA suspension prepared by suspending MVA in PBS (phosphate buffered saline), saline or other formulations into a local site, inhalation into the nasal cavity or respiratory tract, or intravascularly (iv) (e.g., intraarterial, intravenous, and portal), subcutaneously (sc), intradermally (ic), intradermally (id), or intraperitoneally (ip). The vaccine or pharmaceutical composition of the present invention can be administered more than once. More specifically, after the initial administration, one or more additional vaccinations can be given as a boost. One or more booster administrations can enhance the desired effect. After administration of the vaccine or pharmaceutical composition, a booster immunization can be performed with a pharmaceutical composition containing MVA as described herein.

[0066] definition

[0067] Before describing the present invention in detail below, it should be understood that the present invention is not limited to the specific methods, protocols and reagents described herein, as these may vary. It should also be understood that the terms used herein are only for the purpose of describing specific embodiments and are not intended to limit the scope of the present invention, which is limited only by the appended claims. Unless otherwise defined, all technical terms and scientific terms used herein have the same meaning as generally understood by those of ordinary skill in the art.

[0068] It must be noted that, as used herein, the singular forms "a", "an" and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a nucleic acid" includes one or more nucleic acid sequences, and reference to "the method" includes reference to equivalent steps and methods known to those of ordinary skill in the art that may modify or replace the methods described herein.

[0069] Unless otherwise indicated, the term "at least" preceding a series of elements is to be understood to refer to each element in the series. Those skilled in the art will recognize or be able to ascertain many equivalents to the specific embodiments of the invention described herein using only routine experimentation. Such equivalents are intended to be encompassed by the present invention.

[0070] As used herein, the connection term "and / or" between multiple listed elements is understood to include separate and combined options. For example, where two elements are connected by "and / or", the first option refers to the applicability of the first element without the second element. The second option refers to the applicability of the second element without the first element. The third option refers to the applicability of the first and second elements together. Any of these options is understood to fall within the meaning and therefore meets the requirements of the term "and / or" used herein. The simultaneous applicability of more than one option is also understood to fall within the meaning and therefore meets the requirements of the term "and / or".

[0071] Throughout the specification and the claims that follow, unless the context requires otherwise, the word "comprise" and variations such as "comprises" and "comprising" are to be understood as including the stated integer or step or group of integers or steps but not excluding any other integer or step or group of integers or steps. The term "comprises" when used in the context of one aspect or embodiment in the description of the invention may be modified and thus replaced by the terms "containing" or "including", or by the term "having" when used herein. Similarly, any of the above terms (comprise, contain, include, have), whenever used in the context of one aspect or embodiment in the description of the invention, include the terms "consisting of" or "consisting essentially of", each of which means a specific legal meaning depending on jurisdiction.

[0072] When used herein, "consisting of" excludes any element, step, or ingredient not specified in the claim elements. When used herein, "consisting essentially of" does not exclude materials or steps that do not materially affect the basic and novel characteristics of the claim.

[0073] The term "virus" means virus, virus particle and viral vector. The term includes wild-type virus, recombinant and non-recombinant virus, live virus and attenuated live virus.

[0074] The term "recombinant MVA" as described herein refers to an MVA comprising an exogenous nucleic acid sequence inserted into its genome, which does not naturally occur in the parental virus. Therefore, recombinant MVA refers to an MVA artificially combined from two or more fragments of a nucleic acid sequence of synthetic or semi-synthetic origin, which does not exist in nature or is connected to another nucleic acid in an arrangement not found in nature. Artificial combination is most commonly accomplished by artificial manipulation of isolated nucleic acid fragments using mature genetic engineering techniques. Generally, "recombinant MVA" as described herein refers to an MVA produced by standard genetic engineering methods, such as recombinant MVA is therefore genetically engineered or genetically modified MVA. The term "recombinant MVA" therefore includes an MVA (e.g., MVA-BN) in which at least one recombinant nucleic acid is integrated into its genome, preferably in the form of a transcription unit. The transcription unit may include a promoter, an enhancer, a terminator and / or a silencer. The recombinant MVA of the present invention can express heterologous antigenic determinants, polypeptides or proteins (antigens) after inducing a regulatory element, such as a promoter.

[0075] "Sequence homology or identity percentage (%)" about nucleic acid sequences described herein is defined as the percentage of nucleotides identical with the nucleotides in the reference sequence (i.e., the nucleic acid sequence from which it is derived) in the candidate sequence after aligning the sequences and introducing spaces (which are conventional steps for aligning sequences to assess homology or identity) (if necessary) to achieve the maximum percentage of sequence identity, and without considering any conservative substitutions as part of the sequence identity. The comparison for determining nucleotide sequence identity or homology percentage can be achieved in a variety of ways within the technical scope of the art, for example, using publicly available computer software, such as BLAST, ALIGN or Megalign (DNASTAR) software. Those skilled in the art can determine the appropriate parameters for measuring the comparison, including any algorithm required for achieving the maximum comparison over the full length of the compared sequence.

[0076] For example, Smith and Waterman, (1981), Advances in Applied Mathematics 2:482-489 local homology algorithm provides suitable comparison of nucleotide sequences. This algorithm can be developed by using by Dayhoff, Atlas of Protein Sequences and Structure, MO Dayhoff, 5th Supplement 3:353-358, National Biomedical Research Foundation, Washington, DC, USA, and by Gribskov (1986), Nucl. Acids Res. 14 (6): 6745-6763 standardized scoring matrix and applied to amino acid sequences. An exemplary implementation of this algorithm for determining sequence identity percentage is provided by the genetics computer group (Madison, Wis.) in the "BestFit" practical application program. The default parameters of this method are described in Wisconsin Sequence Analysis Package Program Manual, 8th Edition (1995) (available from Genetics Computer Group, Madison, Wis.). A preferred method for establishing percent identity in the context of the present invention is to use the MPS RCH program package, copyrighted by the Uni versity of Edinburgh, developed by John F. Collins and Shane S. Sturr ok, and distributed by IntelliGenetics, Inc. (Mountain View, Calif). From this package, the Smith-Waterman algorithm can be used, with default parameters used for the score table (e.g., a gap open penalty of 12, a gap extension penalty of one, and a gap of six). From the generated data, the "Match" value reflects the "sequence identity". Other suitable programs for calculating percent identity or similarity between sequences are generally known in the art, for example, another alignment program is BLAS T using default parameters. For example, BLASTN and BLASTP can be used with the following default parameters: genetic code = standard; filter = none; strands = two; cutoff = 60; expectation = 10; matrix = BL OSUM62; description = 50 sequences; sorting = high score; database = non-redundant, GenBank + EMBL + DDBJ + PDB + GenBank CDS translation + Swiss protein + Spu pdate + PIR. Details of these programs can be found at the following website: http: / / http: / / blast.ncbi.nlm.nih.gov / .

[0077] As used herein, the term "CD4+ or CD8+ T cell response" refers to a T cell immune response characterized in that a high proportion of immunogen-specific CD4+ T cells or CD8+ T cells are observed in the total reactive T cell population after vaccination. The total immunogen-specific T cell response can be determined by IFN-γ ELISPOT assay. The immunogen-specific CD4+ or CD8+ T cell immune response can be determined by ICS assay.

[0078] The term "adjuvant" is defined as one or more substances that cause stimulation of the immune system. In this case, the adjuvant is used to enhance the immune response to the plasmid and / or MVA vector of the present application.

[0079] The term "recombinant" molecule refers to a molecule produced using molecular biology techniques. Thus, a "recombinant DNA molecule" refers to a DNA molecule composed of DNA segments joined together with the aid of molecular biology techniques. As used herein, a "recombinant protein" or "recombinant polypeptide" refers to a protein molecule expressed using a recombinant DNA molecule.

[0080] When referring to the relationship between nucleic acid sequences and / or amino acid sequences, "operable combination" and "operably linked" refer to the connection (i.e., fusion) of the sequences in a framework so that they function as intended. For example, operably linking a promoter sequence to a nucleotide sequence of interest refers to linking the promoter sequence and the nucleotide sequence of interest in a manner such that the promoter sequence is capable of directing the transcription of the nucleotide sequence of interest and / or the synthesis of a polypeptide encoded by the nucleotide sequence of interest.

[0081] "Epstein-Barr virus," "EBV," "human herpesvirus 4," and "HHV-4" are used interchangeably and refer to oncogenic human herpesviruses. EBV is the cause of acute infectious mononucleosis (AIM, also known as glandular fever). It is also associated with certain forms of cancer, such as Hodgkin lymphoma, Burkitt's lymphoma, nasopharyngeal carcinoma, and conditions associated with the human immunodeficiency virus (HIV), such as hairy leukoplakia and central nervous system lymphomas. EBV infects the B cells and epithelial cells of the immune system. Once the initial lytic infection of the virus is controlled, EBV remains latent in the individual's B cells and accompanies the individual throughout his or her life due to its complex life cycle, which includes alternating latent and lytic phases.

[0082] "Symptoms of EBV infection" include the presence of acute infectious mononucleosis (AIM, also known as glandular fever) and / or EBV-associated cancers. "EBV-associated cancers" refer to cancers that are caused and / or exacerbated at least in part by EBV infection, such as Hodgkin's lymphoma, Burkitt's lymphoma, nasopharyngeal carcinoma, cervical cancer, hairy leukoplakia, and central nervous system lymphomas.

[0083] The terms "antigen," "immunogen," "antigenic," "immunogenic," "antigenic activity," and "immunologically active" when referring to molecules refer to any substance capable of inducing a specific humoral and / or cell-mediated immune response. In certain embodiments, an antigen comprises at least a portion or an extracellular domain.

[0084] "EBV antigens" refer to antigens from EBV, such as "gB, gH, gL and gp350 / 220" and tumor-associated EBV antigens.

[0085] The term "EBV envelope glycoprotein" includes gp350, gB, gp42, gH, gL, gM, gN, BMRF2, BDLF2, BDLF3, BILF1, BILF2 and BARF1. The term "T cell antigen" refers to EBNA1, EBNA2, EBNA3a, EBNA3b, EBNA3c, EBNA-leader protein and LMP2.

[0086] The term "gp350 / 220" is the major EBV envelope protein. The interaction between EBV gp350 / 220 and complement receptor type 2 (CR2) CD21 and / or (CR1) CD35 on B cells is required for cell attachment and initiation of latent infection (SEQ ID NO: 1)

[0087] The term "gH" refers to the glycoprotein gp85 precursor of human herpesvirus 4 and is exemplified by SEQ ID NO: 2, NCBI reference sequence: YP_401700.1.

[0088] The terms "gL" and "BKRF2" are used interchangeably and are exemplified by SEQ ID NO: 3, NCBI reference sequence: YP_001129472.1.

[0089] The term "BZLF1-BRLF1 fusion" refers to the transcriptional activator of the EBV early gene, and is exemplified by SEQ ID NO:4.

[0090] "EBNA-3A" is exemplified by SEQ ID NO: 5, NCBI reference sequence: YP_401677.1.

[0091] "Tumor-associated EBV antigens" are EBV antigens associated with tumors in subjects infected with EBV. Exemplary tumor-associated EBV antigens include EBNA1, LMP1, LMP2, and BARF1, which are described in the following literature: Lin et al. "CD4 andCD8 T cell responses to tumor-associated Epstein-Barr virus antigens in nasopharyngeal carcinoma patients." Cancer Immunol Immunother. 2008 July; 57(7):963-75; Kohrt et al. "Dynamic CD8 T cell responses to tumor-associated Epstein-Barr virus antigens in patients with Epstein-Barr virus-negative Hodgkin's disease," Oncol Res. 2009; 18(5-6):287-92; Parmita et al., "Humoral immune responses to Epstein-Barr virus encoded tumor associated proteins and their putativeextracellular domains in nasopharyngeal carcinoma patients and regional controls," J Med Virol. 2011 Apr;83(4):665-78.

[0092] Physiologically acceptable "carriers" and "diluents" for vaccine preparation include water, saline, human serum albumin, oil, polyethylene glycol, aqueous glucose, glycerol, propylene glycol or other synthetic solvents. The carrier can be a liquid carrier (such as water, saline, culture medium, saline, aqueous glucose and ethylene glycol) or a solid carrier (such as carbohydrates, such as starch, glucose, lactose, sucrose and dextran, antioxidants, such as ascorbic acid and glutathione, and hydrolyzed protein).

[0093] The term "expression vector" refers to a nucleotide sequence containing a desired coding sequence and an appropriate nucleic acid sequence required for the operably linked coding sequence to be expressed (i.e., transcribed into RNA and / or translated into a polypeptide) in a specific host cell. Expression vectors include, but are not limited to, plasmids, phagemids, shuttle vectors, cosmids, viruses, chromosomes, mitochondrial DNA, plastid DNA, and nucleic acid fragments thereof. Nucleic acid sequences for expression in prokaryotes include promoters, optional operator sequences, ribosome binding sites, and possible other sequences. It is known that eukaryotic cells utilize promoters, enhancers, terminators, and polyadenylation signals.

[0094] "Mammalian subjects" include humans, non-human primates, rodents, ovines, bovines, ruminants, lagomorphs, porcines, goats, equines, canines, felines, AVCs, etc.

[0095] A subject "in need of" alleviation of one or more symptoms of a disease and / or "in need of" a specific treatment for a disease (such as immunization) includes a subject that exhibits one or more symptoms of the disease and / or is at risk of exhibiting one or more symptoms of the disease. For example, a subject may be at risk due to family history, genetic factors, environmental factors, etc. This term includes animal models of the disease. Therefore, administering a composition (which alleviates the disease and / or alleviates one or more symptoms of the disease) to a subject in need of alleviation of a disease and / or alleviation of one or more symptoms of a disease includes prophylactic administration of the composition (i.e., before the disease and / or one or more symptoms of the disease are detectable) and / or therapeutic administration of the composition (i.e., after the disease and / or one or more symptoms of the disease are detectable). The compositions and The method is also useful for subjects who are "at risk of disease", which refers to subjects who are prone to contracting the disease and / or showing one or more symptoms of the disease. This tendency may be genetic (e.g., a specific genetic tendency to show one or more symptoms of a disease, such as a genetic disorder, etc.), or due to other factors (e.g., environmental conditions, exposure to harmful compounds present in the environment, including carcinogens, etc.). The term "at risk" subjects includes subjects who are "suffering from the disease", i.e., subjects who are experiencing one or more symptoms of the disease. The present invention is not intended to be limited to any specific signs or symptoms. Therefore, the present invention is intended to cover subjects who experience any range of diseases, from subclinical symptoms to full-blown diseases, wherein the subject exhibits at least one sign (e.g., signs and symptoms) associated with the disease.

[0096] An "immunogenically effective amount" refers to the amount of a molecule that elicits and / or increases the production of an "immune response" (i.e., the production of specific antibodies and / or the induction of a cytotoxic T lymphocyte (CTL) response) in a host following vaccination with the molecule.

[0097] "Antibody" refers to an immunoglobulin (eg, IgG, IgM, IgA, IgE, IgD, etc.) and / or a portion thereof that contains a "variable domain" (also called "Fv region") that specifically binds to an antigen.

[0098] When referring to the binding of an antibody to a molecule (e.g., a peptide) or the binding of a cell (e.g., a T cell) to a peptide, the terms "specifically bind" and "specific binding" refer to the interaction of an antibody or cell with one or more epitopes on a molecule, where the interaction depends on the presence of a specific structure on the molecule. For example, if the antibody is specific for epitope "A" on a molecule, then in a reaction containing labeled "A" and the antibody, the presence of a protein containing epitope A (or free, unlabeled A) will reduce the amount of labeled A bound to the antibody; in one embodiment, the level of binding of the antibody to the molecule is determined using "IC50," or "half-maximal inhibitory concentration," which refers to the concentration of a substance (e.g., inhibitor, antagonist, etc.) that produces 50% inhibition of a given biological process or component of a process (e.g., enzyme, antibody, cell, cell receptor, microorganism, etc.). IC50 is often used as a measure of the potency of antagonist substances.

[0099] As used herein, the term "effective amount" refers to the amount of the composition that produces the desired effect. For example, a cell population can be infected with an effective amount of a viral vector to study its in vitro effect (e.g., cell culture) or to produce the desired therapeutic effect in vitro or in vitro. An effective amount of the composition can be used to produce a preventive or therapeutic effect in a subject, such as preventing or treating a target disease, alleviating symptoms associated with the disease, or producing a desired physiological effect. In this case, the effective amount of the composition is a "therapeutically effective amount," "therapeutically effective concentration," or "therapeutically effective dose." The precise effective amount or therapeutically effective amount is the amount of the composition that will produce the most effective results in therapeutic efficacy in a given subject or cell population. This amount will vary according to a variety of factors, including but not limited to the properties of the composition (including activity, pharmacokinetics, pharmacodynamics, and bioavailability), the patient's physiological condition (including age, sex, disease type and stage, general physical condition, response to a given dose, and drug type), the properties of the carrier in a pharmaceutically acceptable carrier or formulation, and the route of administration. In addition, the effective amount or therapeutically effective amount may vary, depending on whether the composition is administered alone or in combination with another composition, drug, therapy, or other treatment method or approach. Those skilled in the clinical and pharmacological arts will be able to determine an effective amount or therapeutically effective amount by routine experimentation, i.e., by monitoring the response of cells or subjects to administration of the composition and adjusting the dosage accordingly. For further guidance, see Remington: The Science and Practice of Pharmacy, 21st Edition, Univ. of Sciences in Philadelphia (USIP), Lippincott Williams & Wilkins, Philadelphia, Pa., 2005, which is hereby incorporated by reference as if fully set forth herein.

[0100] "Treating" or "treatment" of a disease may refer to preventing the disease, slowing the onset or development of the disease, reducing the risk of developing the disease, preventing or delaying the development of symptoms associated with the disease, alleviating or stopping symptoms associated with the disease, causing complete or partial regression of the disease, or some combination thereof. Treatment may also refer to prophylactic or preventive treatment of a disease.

[0101] As used herein, the term "infection" refers to the invasion of a host by a pathogenic agent. When a pathogenic agent is able to invade a host and replicate or reproduce in the host, it is considered to be "infectious". Examples of infectious agents include viruses, such as EBV and certain types of adenovirus, prions, bacteria, fungi, protozoa, etc. "EBV infection" specifically refers to the invasion of EBV into a host organism, such as cells and tissues of a host organism.

[0102] As used herein, the term "inducing an immune response" when used with reference to the methods described herein encompasses causing a desired immune response or effect against EBV or EBV infection in a subject in need thereof. "Inducing an immune response" also encompasses providing therapeutic immunity against a pathogen (i.e., EBV). As used herein, the term "therapeutic immunity" or "therapeutic immune response" means that a vaccinated subject infected with EBV is able to control infection of the pathogen (i.e., EBV) against which the vaccination is performed.

[0103] As used herein, the term "inducing a broad antibody response" is defined as inducing antibodies against multiple epitopes on more than one, preferably multiple, viral envelope proteins. Similarly, "inducing a broad T-cell response" is defined as inducing CD4 and CD8 T-cell lymphocytes with multiple specificities against multiple viral antigens (including at least one, preferably multiple, viral proteins defined as T-cell antigens). In general, these two expressions can be combined as "inducing a broad immune response."

[0104] The term "pharmaceutically acceptable" means that the carrier or excipient does not substantially cause undesirable or harmful effects in the subject to which it is administered at the dosages and concentrations employed. A "pharmaceutically acceptable carrier or excipient" is any inert substance that is combined with an active molecule (such as a virus) to prepare a pleasant or convenient dosage form.

[0105] The term "homologous prime-boost vaccination" refers to a vaccination regimen in which the first (prime) administration and any subsequent booster administrations use the same recombinant MVA as described herein.

[0106] The term "heterologous prime-boost vaccination" refers to a vaccination regimen in which only the first (prime) administration or only subsequent booster administrations use a recombinant MVA as described herein.

[0107] As used herein, "TCID 50 ” refers to tissue culture infectious dose 50, expressed as TCID 50 Given in the form of TCID 50 The amount of the tissue culture infectious dose 50 (TCID 50 ) determination. 50 The assay is a method for titrating the infectivity of modified vaccinia virus Ankara (MVA) vectors using 10-fold dilutions in 96-well plates as described in Example 2 of WO 03 / 053463. The infectivity of poxviruses such as MVA can be determined by various methods known to those skilled in the art, such as, for example, by flow cytometry-based assays or tissue culture infectious doses. 50 (TCID 50) determination. In one exemplary aspect, in a TCID-based 50 MVA titration was performed using 10-fold dilutions in a 96-well format in the assay. At the assay endpoint, infected cells were visualized using anti-vaccinia virus antibodies and appropriate staining solutions. Primary CEF cells were prepared and cultured at a given density in T-flasks in RPMI containing 10% serum and 1% gentamicin for 2-3 days, followed by trypsinization and staining at 1x10 in RPMI containing 7% serum. 5 The expected titer of the sample determines the number of 10-fold serial dilutions, which are performed in a deep-well plate from column 1 to, for example, column 10, using 100 μL transferred to the next well. After dilution, 100 μL is inoculated into each well of the 96-well plate. The cells are incubated at 34-38°C and 4-6% CO2 for 5 days to allow infection and viral replication.

[0108] Five days after infection, cells were stained with MVA-specific antibodies. For detection of specific antibodies, horseradish peroxidase (HRP)-coupled secondary antibodies were used. For example, MVA-specific antibodies can be anti-vaccinia virus antibodies, rabbit polyclonal antibodies, or IgG fractions (Quartett, Berlin, Germany #9503-2057). For example, secondary antibodies can be anti-rabbit IgG antibodies or HRP-coupled goat polyclonal antibodies (Promega, Mannheim, Germany, #W4011). Precipitated TMB substrate was used to visualize the secondary antibodies. In the color development reaction, all wells containing positive cells were marked as positive for calculation of TCID 50 Titers were calculated using the Spearman-Kaerber calculation method. Data can also be expressed as the logarithm of viral titer, which is the relative difference at any given time point from the T=0 time point.

[0109] An alternative method for quantifying viral concentration is through the viral plaque assay, which is a standard method for determining viral concentration as an infectious dose well known to those skilled in the art. Briefly, a confluent monolayer of host cells is infected with various dilutions of the virus and covered with a semisolid medium. Viral plaques are formed when the virus infects the cells in the cell monolayer, and the number of plaques can be counted in combination with the dilution factor to calculate the number of plaque forming units per sample volume (pfu / mL). pfu / mL represents the number of infectious particles in the sample. Due to the significant differences in the assay methods and principles, TCID 50 It is not necessarily equivalent to pfu / mL or other infectivity determination results. For MVA, both methods (TCID 50 Both the viral plaque assay and the viral plaque assay can be used, and the dose of MVA vectors for clinical administration to humans is usually expressed in pfu or TCID50 The adenoviral vector can also be provided in pfu or TCID50 For administration to humans, doses of adenoviral vectors are usually given in viral particles (vp), and concentrations are expressed in vp / mL.

[0110] Another assay that can be used to determine the infectious titer of MVA suspensions is a flow cytometry-based assay or FACS assay. In this assay, the infectious titer is calculated based on the number of infected cells after inoculation of an MVA permissive cell monolayer with increasing dilutions of MVA virus. Secondary spread of MVA in the permissive cell line is avoided by the addition of the drug rifampicin, which prevents the formation of infectious progeny viruses but allows viral gene expression, which is necessary for the production of viral antigens for virus-specific staining of infected cells. All dilutions that result in infected cells between 10% and 30% are suitable for calculating the infectious titer, which is given in infectious units (infU), as determined by vaccinia virus-specific antibody staining and flow cytometry.

[0111] In some embodiments, the vaccine or pharmaceutical composition described herein can be used in combination with other known pharmaceutical products, such as peptides and antibacterial agents (synthetic antibacterial agents) that promote immune responses. Vaccines or pharmaceutical compositions may also include other drugs and additives. Examples of drugs or additives that can be used with vaccines or pharmaceutical compositions described herein include drugs, liposomes, and other drugs and / or additives that help transfection (e.g., fluorocarbon emulsifiers, volutes, tubules, gold particles, biodegradable microspheres, and cationic polymers) that help intracellular uptake of the compositions disclosed herein or vaccines.

[0112] Several documents are cited in the full text of this specification. Each document cited herein (including all patents, patent applications, scientific publications, manufacturer specifications, descriptions, etc.), whether above or below, is hereby incorporated by reference in its entirety. To the extent that the material incorporated by reference contradicts or is inconsistent with this specification, this specification will replace any such material. Nothing herein should be construed as admitting that the present invention is not entitled to be disclosed earlier than such disclosure due to prior invention.

[0113] Epstein-Barr Virus (EBV) and Current Approaches

[0114] Epstein-Barr virus (EBV) is an oncogenic herpesvirus that infects more than 95% of the adult population worldwide. It is associated with the development of various types of lymphoproliferative disorders (LPDs), lymphomas, and cancers. It is estimated that EBV infection causes approximately 200,000 cases of cancer worldwide each year. In low-income areas, primary EBV infection usually occurs in early childhood and is thought to be mostly asymptomatic. However, in malaria-endemic areas, childhood infection increases the risk of EBV-positive Burkitt lymphoma (BL). In high-income areas, primary EBV infection is often delayed until adolescence; and causes 50%-70% of adolescents to develop acute infectious mononucleosis (AIM). Although the disease is self-limited, long-term AIM or chronic active EBV infection may result in fatal outcomes or significantly increase the risk of developing EBV-positive Hodgkin lymphoma. EBV is also highly associated with nasopharyngeal carcinoma and gastric cancer, reflecting the epithelial tropism of the virus. In infected individuals, EBV is controlled by T cells and is usually maintained in a quiescent state in memory B cells. However, under conditions of immunosuppression, the virus can reactivate, leading to expansion of EBV-infected cells and increasing the likelihood of de novo infection, as well as transformation of infected B cells, as seen in BL, EBV-positive post-transplant lymphoproliferative disorder (PTLD), and AIDS-related B-cell lymphoma. Management of EBV-related diseases is problematic due to difficulties in diagnosis, monitoring, and treatment. At a 2011 meeting held at the National Institutes of Health (NIH), participants agreed that a safe and effective vaccine is urgently needed to prevent and / or treat EBV-related diseases. Currently, several strategies to generate EBV vaccines based on viral glycoproteins 350 / 220 (gp350 / 220), latent membrane proteins (LMP1-2), and EBV nuclear antigen 1 (EBNA-1) are in experimental stages and / or clinical trials. However, most of these strategies have a low safety profile and are designed to elicit the production of neutralizing antibodies (nAbs) against EBV envelope proteins (prophylactic) or T cell responses against latent EBV antigens (therapeutic). None of the currently proposed vaccines can simultaneously address both branches of immune function in a single vaccine candidate. Our vaccine utilizes the MVA platform, which combines selected multiple viral surface glycoproteins in addition to intracellular T cell antigens to produce a multivalent vaccine.

[0115] Antibodies (Abs) provide the first line of defense against viral infection. Neutralizing Abs against EBV envelope glycoproteins exist in humans, maternal nAbs protect against neonatal infection, and they have been shown to be induced in response to immunization in humans and other animals. However, limited evidence for persistent EBV infection and immune selection against viral antigenic variants suggests that in vivo neutralization of EBV infection is suboptimal. This was observed in four independent phase I / II clinical trials in which vaccination with vector constructs expressing gp350 / 220 or purified recombinant non-spliced ​​variant gp350 soluble protein reduced the incidence of AIM by more than 70% in young adults but did not prevent infection. Importantly, primary B cells can be infected with recombinant EBV lacking gp350 / 220; this suggests that other viral ligands may mediate EBV infection in the absence of gp350 / 220. These observations suggest that targeting viral neutralization using gp350 / 220 as the sole immunogen (monovalent vaccine) is overly simplistic and may explain the varying degrees of success achieved using only this protein in EBV vaccine development.

[0116] In EBV infection, the attachment protein EBVgp350 / 220 binds to the B cell receptors CD21 and CD35, initiating the first contact of the virus with the host cell and subsequently triggering endocytosis of the virion. This interaction enhances infection but is not essential. Fusion between the viral envelope and the cell membrane is a required step for entry of all human herpesviruses. For EBV, the viral glycoproteins required for fusion of the viral envelope with host cell receptors or glycoprotein B (gB), the complex of gH and gL (gH / gL), and gp42. These complexes mediate infection and confer host cell specificity. EBV entry into B cells is mediated by gB, gH / gL, and gp42; whereas entry into epithelial cells is facilitated by the interaction between gB and gH / gL. Notably, co-expression of EBVgH and gL is required for trafficking of gH to the cell surface, thereby forming a stable gH / gL complex. Recently, integrins have been identified as epithelial receptors for EBVgH / gL, and this interaction initiates fusion in a two-step cascade. Recombinant EBV lacking gH infects neither epithelial cells nor primary B cells.

[0117] Although Abs against EBVgH / gL are not produced in large quantities in vivo during natural infection (probably due to masking by the immunodominant gp350 / 220), immunization of mice with recombinant gH can enhance immunogenicity and produce Abs capable of blocking EBV infection. The ability of gH / gL Abs to neutralize infection is also well conserved in herpes simplex virus 1, cytomegalovirus, and Kaposi's sarcoma herpesvirus (KSHV). Monoclonal Abs against the gH protein or the gH / gL complex can block EBV infection, indicating that gH / gL plays a key role in EBV infection. No specific nAbs against EBVgL or -gB have been reported. nAbs against EBVgp42 have been identified.

[0118] T cell-mediated responses can effectively control persistent EBV infection, as evidenced by the development of some form of immunosuppression that often precedes EBV-associated lymphoma and PTLD. Furthermore, adoptive transfer of EBV-specific T cells can induce remission in transplant patients.

[0119] The current hypothesis is that protection against EBV depends on the induction of CD4 + and CD8 + T cell immune responses, and the development of EBV therapeutic vaccine candidates focuses on enhancing such responses. + and CD8 + T cells are frequently detected in EBV-infected individuals, and both T cell subsets are effective in controlling the growth of EBV-immortalized B cells. Notably, EBNA1, LMP2, and gp350 / 220 antigens have been developed and tested independently in various clinical trials as vaccine candidates against EBV+ cells and EBV infection with promising results. A recent Phase I clinical trial of a recombinant modified vaccinia virus Ankara vector encoding an EBNA1 sequence fused to LMP2 with a deleted Gly-Ala region (known to impair presentation of cis-linked sequences) as a vaccine candidate elicited strong EBV-specific CD4+ and CD8 + T cell response. However, the strategy (known for its carcinogenic potential) for delivering these two important EBV antigens (DNA vaccines) may bring major health risks, such as inducing antibody responses to DNA or DNA integration into undesirable positions in the host genome leading to uncontrolled cell growth, especially in immunosuppressed individuals. In addition, these vaccine candidates cannot induce nAb to eliminate reactivated EBV infection or prevent new EBV infection. Due to the unregulated amount of protein produced and secreted in vivo, there is also a risk of vaccine tolerance. EBV DNA packaging mutants and the incapacitated virions lacking major oncoproteins are also proposed as alternative strategies.

[0120] Poxvirus

[0121] Poxviruses are large, usually enveloped viruses that carry double-stranded DNA. Poxviruses belong to the Poxviridae family and include 71 currently known species grouped into 16 genera. Virus Taxonomy: Published 2017. The two most well-known orthopoxviruses are variola virus (the cause of human smallpox) and vaccinia virus (which was turned into a vaccine to eliminate smallpox).

[0122] Poxviruses, such as vaccinia virus, are well known to those skilled in the art and have been used to generate recombinant vaccines against infectious organisms and, more recently, cancer (Mastrangelo et al. J Clin Invest. 2000; 105(8): 1031-1034).

[0123] In the context of the present disclosure, poxviruses preferably include orthopoxviruses. Orthopoxviruses include, but are not limited to, smallpox virus, vaccinia virus, cowpox virus, and monkeypox virus. Preferably, the orthopoxvirus is vaccinia virus.

[0124] The term "vaccinia virus" can refer to various strains or isolates of the replicating vaccinia virus (VACV), including, for example, Ankara, VACV Western Reserve (WR), VACV Copenhagen (VACV-COP), Temple of Heaven, Paris, Budapest, Dairen, Gam, MRIVP, Per, Tashkent, TBK, Tian Tan, Tom, Bern, Patwadangar, BIEM, B-15, EM-63, IHD-J, IHD-W, Ikeda, DryVax (also known as VACV Wyeth or New York City Department of Health [NYCBH] strain), NYVAC, ACAM1000, ACAM2000, vaccinia virus Lister (also known as Elstree), LC16m0, LC16m8.

[0125] Modified Vaccinia Virus Ankara (“MVA”)

[0126] The artificially attenuated modified vaccinia virus Ankara ("MVA") was generated by more than 570 serial passages of the chorioallantoic vaccinia virus Ankara (CVA) strain in chicken embryo fibroblasts (for review, see Mayr, A., et al. Infection 3, 6-14 (1975)). As a result of these long passages, the genome of the resulting MVA virus lacks approximately 27 kilobases of genomic sequence compared to its predecessor, CVA, and has therefore been described as a host cell that highly restricts replication to avian cells (Meyer, H. et al., J. Gen. Virol. 72, 1031-1038 (1991), Meisinger et al. J. Gen. Virol 88, 3249-3259 (2007)). The resulting MVA was shown in multiple animal models to be nontoxic compared to the fully replication-competent starting material (Mayr, A. and Danner, K., Dev. Biol. Stand. 41:225-34 (1978)).

[0127] MVA viruses useful in the practice of the present invention may include, but are not limited to, MVA-572 (deposited on January 27, 1994 as ECACC V94012707); MVA-575 (deposited on December 7, 2000 as ECACC V00120707), MVA-I721 (cited in Suter et al., Vaccine 2009), NIH clone 1 (deposited on March 27, 2003 as PTA-5095 deposited) and MVA-BN (deposited with the European Collection of Cell Cultures (ECACC) on August 30, 2000 under the number V00083008).

[0128] More preferably, the MVA used according to the present invention includes MVA-BN and MVA-BN derivatives. MVA-BN has been described in International PCT Publication WO 02 / 042480. As used herein, "MVA-BN derivative" refers to any virus that exhibits substantially the same replication characteristics as MVA-BN but exhibits differences in one or more parts of its genome.

[0129] MVA-BN and MVA-BN derivatives cannot replicate, meaning that they cannot replicate reproductively in vivo and in vitro. More specifically, in vitro, MVA-BN or MVA-BN derivatives have been described as being able to replicate reproductively in chicken embryo fibroblasts (CEF), but not in human keratinocytes HaCat (Boukamp et al. (1988) J. Cell Biol. 106: 761-771), human bone osteosarcoma cell line 143B (ECACC deposit number 91112502), human embryonic kidney cell line 293 (ECACC deposit number 85120602) and human cervical adenocarcinoma cell line HeLa (ATCC deposit number CCL-2). In addition, the viral amplification rate of MVA-BN or MVA-BN derivatives in Hela cells and HaCaT cell lines is at least two times smaller than that of MVA-575, and more preferably three times smaller. Testing and determination of these properties of MVA-BN and MVA-BN derivatives are described in WO 02 / 42480 (US Patent Application No. 2003 / 0206926) and WO 03 / 048184 (US Patent Application No. 2006 / 0159699).

[0130] The term "incapable of reproductive replication" or "incompetent of reproductive replication" in a human cell line in vitro as described in the previous paragraph is described, for example, in WO 02 / 42480, which also teaches how to obtain MVAs having the desired properties as described above. The term applies to viruses having an in vitro viral amplification rate of less than 1 at 4 days post infection using the assay described in WO 02 / 42480 or U.S. Pat. No. 6,761,893.

[0131] The term "incapable of reproductive replication" means that the virus has a viral amplification rate of less than 1 in an in vitro human cell line as described in the previous paragraph 4 days after infection. The assay described in WO 02 / 42480 or US Pat. No. 6,761,893 can be adapted for determination of viral amplification rate.

[0132] The amplification or replication of viruses in in vitro human cell lines as described in the previous paragraphs is usually expressed as the ratio of the virus produced by infected cells (output) to the amount of virus originally used to infect cells (input), which is called the "amplification rate". An amplification rate of "1" defines an amplification state in which the amount of virus produced from infected cells is the same as the amount originally used to infect cells, meaning that infected cells allow viral infection and propagation. In contrast, an amplification rate of less than 1, i.e., a reduction in output compared to the input level, indicates a lack of propagation replication, and therefore the virus is weakened.

[0133] In a preferred embodiment of the present application, the MVA vector comprises nucleic acids encoding two or more EBV envelope glycoproteins and one or more T cell antigens.

[0134] EBV antigenic proteins can be inserted into one or more intergenic regions (IGR) of MVA. In one embodiment of the present application, IGR is selected from IGR07 / 08, IGR 44 / 45, IGR 64 / 65, IGR 88 / 89, IGR 136 / 137 and IGR 148 / 149. In one embodiment of the present application, less than 5, 4, 3 or 2 IGRs of recombinant MVA include heterologous nucleotide sequences encoding antigenic determinants. Additionally or alternatively, heterologous nucleotide sequences can be inserted into one or more naturally occurring deletion sites, especially into the major deletion sites I, II, III, IV, V or VI of the MVA genome. In one embodiment of the present application, less than 5, 4, 3 or 2 naturally occurring deletion sites of recombinant MVA include heterologous nucleotide sequences encoding antigenic determinants.

[0135] The number of insertion sites of the MVA comprising a heterologous nucleotide sequence encoding an antigenic determinant of an EBV protein can be 1, 2, 3, 4, 5, 6, 7 or more. In one embodiment of the present application, the heterologous nucleotide sequence is inserted into 4, 3, 2 or fewer insertion sites. Preferably, two insertion sites are used. In one embodiment of the present application, three insertion sites are used. Preferably, the recombinant MVA comprises at least 2, 3, 4, 5, 6 or 7 genes inserted into 2 or 3 insertion sites.

[0136] The recombinant MVA viruses provided herein can be produced by conventional methods known in the art. Methods for obtaining recombinant poxviruses or inserting exogenous coding sequences into poxvirus genomes are well known to those skilled in the art. For example, standard molecular biology techniques, such as DNA cloning, DNA and RNA separation, Western blot analysis, RT-PCR and PCR amplification techniques are described in Molecular Cloning, A laboratory Manual (2nd edition, Sambrook et al., Cold Spring Harbor Laboratory Press (1989)), and techniques for handling and manipulating viruses are described in Virology Methods Manual (BWJ Mahy et al. (ed.), Academic Press (1996)). Likewise, techniques and expertise for the handling, manipulation and genetic engineering of MVA are described in Molecular Virology: A Practical Approach (AJ Davison and RM Elliott (eds.), The Practical Approach Series, IRL Press at Oxford University Press, Oxford, UK (1993) (see, e.g., Chapter 9: Expression of genes by Vaccinia virus vectors)) and Current Protocols in Molecular Biology (John Wiley & Son, Inc. (1998) (see, e.g., Chapter 16, Part IV: Expression of proteins in mammalian cells using vaccinia viral vectors)).

[0137] For the production of various recombinant MVA disclosed herein, different methods can be applied. The DNA sequence to be inserted into the virus can be placed in an E. coli plasmid construct, into which DNA homologous to the DNA segment of MVA is inserted. In addition, the DNA sequence to be inserted can be connected to a promoter. The promoter-gene linkage can be positioned in the plasmid construct so that the two ends of the promoter-gene linkage are flanked by DNA homologous to the DNA sequence, which is flanked by the MVA DNA region containing the non-essential locus. The resulting plasmid construct can be amplified and separated by propagation in E. coli. The isolated plasmid containing the DNA gene sequence to be inserted can be transfected into, for example, chicken embryo fibroblast (CEF) cell culture, and the culture is infected with MVA at the same time. The recombination between the homologous MVA DNA in the plasmid and the viral genome can produce MVA modified due to the presence of exogenous DNA sequences, respectively.

[0138] According to a preferred embodiment, cells of a suitable cell culture, such as CEF cells, can be infected with a poxvirus. The infected cells can then be transfected with a first plasmid vector comprising one or more exogenous or heterologous genes, preferably under the transcriptional control of a poxvirus expression control element. As described above, the plasmid vector also includes a sequence capable of directing the insertion of the exogenous sequence into a selected portion of the poxvirus genome. Optionally, the plasmid vector also contains a cassette comprising a marker and / or selection gene operably linked to a poxvirus promoter.

[0139] Suitable markers or selection genes are, for example, genes encoding green fluorescent protein, beta-galactosidase, neomycin-phosphoribosyltransferase or other markers. The use of a selection or marker box simplifies the identification and isolation of the recombinant poxvirus produced. However, the recombinant poxvirus can also be identified by PCR technology. Subsequently, another cell can be infected with the recombinant poxvirus obtained as described above and transfected with a second vector comprising one or more second exogenous or heterologous genes. If this gene is introduced into different insertion sites of the poxvirus genome, the second vector is also different in terms of the poxvirus homologous sequences that guide the integration of one or more second exogenous genes into the poxvirus genome. After homologous recombination occurs, recombinant viruses containing two or more foreign or heterologous genes can be isolated. For the introduction of additional exogenous genes into the recombinant virus, the steps of infection and transfection can be repeated by infecting with the recombinant virus isolated in the previous step and transfecting with another vector comprising another one or more exogenous genes.

[0140] Alternatively, the infection and transfection steps described above are interchangeable, i.e., suitable cells may be first transfected with a plasmid vector comprising the exogenous gene and then infected with a poxvirus. As another alternative, each exogenous gene may be introduced into a different virus, cells co-infected with all the recombinant viruses obtained, and recombinants comprising all the exogenous genes may be screened. A third alternative is to connect the DNA genome and the exogenous sequence in vitro and to reconstruct the recombinant vaccinia virus DNA genome using a helper virus. A fourth alternative is to perform homologous recombination between a vaccinia virus genome (such as MVA) cloned as a bacterial artificial chromosome (BAC) and a linear exogenous sequence in Escherichia coli or another bacterial species, wherein the linear exogenous sequence is flanked by a DNA sequence homologous to the sequence flanking the desired integration site in the vaccinia virus genome.

[0141] The heterologous EBV genes (e.g., glycoproteins, T cell antigens, and fusion proteins) may be under the control of (i.e., operably linked to) one or more poxvirus promoters. In one embodiment of the present application, the poxvirus promoter is a Pr13.5 promoter, a PrS promoter, a PrH5m promoter, a Pr1328 promoter, a synthetic or natural early or late promoter, or a vaccinia virus ATI promoter.

[0142] Methods for producing non-recombinant and recombinant poxviruses

[0143] Methods for obtaining recombinant poxviruses, such as MVA, or for inserting exogenous coding sequences into the genome of poxviruses (e.g., MVA) are well known to those skilled in the art. For example, standard molecular biology techniques, such as methods for DNA cloning, DNA and RNA isolation, Western blot analysis, RT-PCR, and PCR amplification techniques are described in Molecular Cloning, Alaboratory Manual 2nd Edition (J. Sambrook et al., Cold Spring Harbor Laboratory Press (1989)), and techniques for handling and manipulating viruses are described in Virology Methods Manual (BWJ Mahy et al. (eds.), Academic Press (1996)). Similarly, techniques and expertise for the handling, manipulation and genetic engineering of poxviruses are described in Molecular Virology: A Practical Approach (AJ Davison and RM Elliott (eds.), The Practical Approach Series, IRL Press at Oxford University Press, Oxford, UK (1993), see, e.g., Chapter 9: Expression of genes by Vaccinia virus vectors); Current Protocols in Molecular Biology (John Wiley & Son, Inc. (1998), see, e.g., Chapter 16, Section IV: Expression of proteins in mammalian cells using vaccinia viral vector); and Genetic Engineering, Recent Developments in Applications, Apple Academic Press (2011), Dana M. Santos, see, e.g., Chapter 3: Recombinant-mediated Genetic Engineering of a Bacterial Artificial Chromosome Clone of Modified Vaccinia Virus Ankara (MVA)).The construction and isolation of recombinant MVA is also described in Methods and Protocols, Vaccinia Virus and Poxvirology, ISBN 978-1-58829-229-2 (Staib et al.), Humana Press (2004), see e.g. Chapter 7.

[0144] The method for producing and purifying virus-based materials (such as viral vectors and / or viruses) is known to those skilled in the art. The method includes infecting suitable cell culture (for example, chicken embryo fibroblasts (CEF cells) or cell lines, such as cell lines and EB66 cells derived from DF-1, ducks, MDCK, quail or chickens) and subsequently amplifying viruses under suitable conditions well known to those skilled in the art. Although it is preferred to use a method without animal materials (such as cell culture media), serum-free culture conditions (such as culture media) and serum-containing culture methods can be used for virus production. The term "serum-free" culture media refers to any cell culture media that does not contain serum from animal or human sources. As used herein, "animal-free" refers to any compound or compound set (except for the cell or cell line used to produce and purify virus-based materials) that is not produced in the animal cells of an organism or is not produced by the animal cells of an organism. Suitable cell culture media are known to those skilled in the art, and these culture media include salts, vitamins, buffers, energy sources, amino acids and other substances. Examples of culture media suitable for serum-free culture of CEF cells are medium 199 (Morgan, Morton and Parker; Proc Soc. Exp. Biol. Med. 1950 January; 73 (1): 1-8; particularly available from Life Technologies) or VP-SFM (Invitrogen Ltd.), which are preferred. For example, serum-free methods for culturing viruses and amplifying viruses in CEF cells are described in WO 2004 / 022729. The upstream and downstream processes for the production and purification of viral material are described in WO 2012 / 010280. Other methods suitable for purifying the viruses of the present application are described in WO 03 / 054175, WO 07 / 147528, WO 2008 / 138533, WO 2009 / 100521 and WO 2010 / 130753. Leon et al. described a suitable method for propagating and purifying recombinant poxviruses in duck embryo-derived cells, such as but not limited to EB66 cells (Leon et al. (2016), The EB66 cell line is a valuable cell substrate for MVA-based vaccines production, Vaccine 34:5878-5885).

[0145] Exemplary Generation of Recombinant Poxviruses

[0146] For the production of various recombinant MVA viruses disclosed herein, different methods can be applied. The DNA sequence to be inserted into the virus can be placed in an E. coli plasmid construct, into which DNA homologous to the poxvirus DNA segment is inserted. In addition, the DNA sequence to be inserted can be connected to a promoter. The promoter-gene linkage can be positioned in the plasmid construct so that the two ends of the promoter-gene linkage are flanked by DNA homologous to the DNA sequence, and the DNA sequence is flanked by the poxvirus DNA region containing the non-essential locus. The resulting plasmid construct can be amplified and isolated by propagation in E. coli. The isolated plasmid containing the DNA gene sequence to be inserted can be transfected into, for example, a chicken embryo fibroblast (CEF) cell culture, and the culture is infected with MVA virus at the same time. The recombination between the homologous MVA virus DNA in the plasmid and the viral genome can produce poxviruses modified due to the presence of exogenous DNA sequences, respectively.

[0147] According to a preferred embodiment, cells of a suitable cell culture, such as CEF cells, can be infected with MVA virus. The infected cells can then be transfected with a first plasmid vector comprising one or more exogenous or heterologous genes, such as one or more nucleic acids provided in the present disclosure; preferably under the transcriptional control of a poxvirus expression control element. As described above, the plasmid vector also includes a sequence capable of directing the insertion of an exogenous sequence into a selected portion of the MVA virus genome. Optionally, the plasmid vector also contains a cassette comprising a marker and / or selection gene operably linked to a poxvirus promoter. The use of a selection or marker cassette simplifies the identification and isolation of the recombinant poxvirus produced. However, the recombinant poxvirus can also be identified by PCR technology. Subsequently, another cell can be infected with the recombinant poxvirus obtained as described above and transfected with a second vector comprising one or more second exogenous or heterologous genes. If this gene is introduced into a different insertion site of the poxvirus genome, the second vector also differs in the poxvirus homologous sequence that directs the integration of the one or more second exogenous genes into the poxvirus genome. After homologous recombination occurs, a recombinant virus comprising two or more foreign or heterologous genes can be isolated. For introducing additional foreign genes into the recombinant virus, the steps of infection and transfection can be repeated by infecting using the recombinant virus isolated in the previous step and by transfecting using another vector containing another foreign gene or genes.

[0148] Vaccines, compositions, medicaments and immunogenic compositions

[0149] The application also relates to pharmaceutical compositions and vaccines comprising one or more EBV antigens, polynucleotides encoding one or more EBV antigens according to the application and / or carriers.Any EBV antigen, polynucleotides (including RNA and DNA) and / or carriers of the application as described herein can be used in pharmaceutical compositions and vaccines of the application.

[0150] According to the embodiment of the present application, the polynucleotide in the vaccine composition can be connected or separated, so that the EBV antigen expressed from such polynucleotides is fused together or produced as a separate protein, whether expressed from the same or different polynucleotides. In one embodiment, the first and second polynucleotides are present in a separate viral vector, and these vectors are used in combination in the same or separate composition so that the expressed protein is also a separate protein, but is used in combination. In another embodiment, the EBV antigen encoded by the first and second polynucleotides can be expressed from the same viral vector.

[0151] In a specific embodiment of the present application, the first vector is a first viral vector, and the second vector is a second viral vector. Preferably, each of the first and second viral vectors is an MVA vector, which comprises an expression cassette comprising a polynucleotide encoding an EBV antigen of the present application; an upstream sequence operably linked to the polynucleotide encoding the EBV antigen, the upstream sequence comprising a promoter sequence from the 5' end to the 3' end, preferably the Pr13.5 promoter sequence of SEQ ID NO: 7, the PrS promoter of SEQ ID NO: 8, the PrH5m promoter of SEQ ID NO: 9, or the Pr1328 promoter of SEQ ID NO: 10.

[0152] The composition of the present application may also include a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers are nontoxic and do not interfere with the efficacy of active ingredients. Pharmaceutically acceptable carriers may include one or more excipients, such as adhesives, disintegrants, expanders, suspending agents, emulsifiers, wetting agents, lubricants, flavoring agents, sweeteners, preservatives, dyes, solubilizers and coating agents. The precise properties of carriers or other materials may depend on the route of administration, such as intramuscular, intradermal, subcutaneous, oral, intravenous, skin, mucosal (such as digestive tract), intranasal or intraperitoneal routes. For liquid injection preparations, such as suspensions and solutions, suitable carriers and additives include water, ethylene glycol, oil, alcohol, preservatives, colorants, etc. For solid oral preparations, such as powders, capsules, caplets, capsule-shaped tablets and tablets, suitable carriers and additives include starch, sugar, diluents, granulators, lubricants, binders, disintegrants, etc. For nasal spray / inhalant mixtures, the aqueous solutions / suspensions may contain water, glycols, oils, emollients, stabilizers, wetting agents, preservatives, fragrances, flavoring agents, etc. as suitable carriers and additives.

[0153] The composition of the present application can be formulated into any mode suitable for use to a subject, to facilitate use and improve efficacy, including but not limited to oral (enteral) administration and parenteral injection. Parenteral injection includes intravenous injection or infusion, subcutaneous injection, intradermal injection, intramuscular injection. The composition of the present application can also be formulated for other routes of administration, including transmucosal, eye, rectum, long-acting implantation, sublingual administration, sublingual, bypassing portal circulation, suction or intranasal from oral mucosa.

[0154] In a preferred embodiment of the present application, the composition of the present application is formulated for parenteral injection, preferably subcutaneous injection, intradermal injection or intramuscular injection, more preferably intramuscular injection.

[0155] According to the embodiment of the application, the composition for administration generally includes a pharmaceutically acceptable carrier, for example, an aqueous carrier such as a buffer solution in a buffered saline, for example phosphate buffered saline (PBS). The composition may also contain a pharmaceutically acceptable substance as needed to approach physiological conditions, such as a pH adjusting agent and a buffer. In a typical embodiment, the composition of the application comprising plasmid DNA may contain phosphate buffered saline (PBS) as a pharmaceutically acceptable carrier. Plasmid DNA can exist in a concentration of, for example, 0.5 mg / mL to 5 mg / mL, such as 0.5 mg / mL, 1 mg / mL, 2 mg / mL, 3 mg / mL, 4 mg / mL or 5 mg / mL, preferably 1 mg / mL.

[0156] The compositions of the present application can be formulated as vaccines (also referred to as "immunogenic compositions") according to methods well known in the art. Such compositions may include adjuvants to enhance the immune response. In view of the present disclosure, the optimal ratio of each component in the formulation can be determined by techniques well known to those skilled in the art.

[0157] In one embodiment of the present application, the adjuvant is included in the composition or immunogenic combination of the present application, or is co-administered with the composition or immunogenic combination of the present application. The use of an adjuvant is optional, and the immune response can be further enhanced when the composition is used for vaccination purposes. According to the present application, the adjuvant suitable for co-administration or included in the composition should preferably be an adjuvant with potential safety, good tolerance and effectiveness for people. The adjuvant can be a small molecule or an antibody, including but not limited to immune checkpoint inhibitors (e.g., anti-PD1, anti-RIM-3, etc.), Toll-like receptor inhibitors, RIG-1 inhibitors, IL-15 superagonists (Altor Bioscience), mutant IRF3 and IRF7 gene adjuvants, STING agonists (Aduro), FLT3L gene adjuvants, IL-12 gene adjuvants and IL-7-hyFc.

[0158] The embodiment of the application further relates to the method for preparing the composition and immunogenic combination of the application. According to the embodiment of the application, the method for producing the composition or immunogenic combination comprises mixing the separation polynucleotides of the coding EBV antigen, carrier and / or polypeptide of the application with one or more pharmaceutically acceptable carriers. Those of ordinary skill in the art will be familiar with the conventional techniques for preparing such compositions.

[0159] Methods of inducing / enhancing immune responses

[0160] In another general aspect, the present application relates to a method for inducing a broad immune response against Epstein-Barr virus (EBV) in a subject in need thereof, comprising administering to the subject an immunologically effective amount of a composition or immunogenic composition of the present application. Any composition and immunogenic combination of the present application described herein can be used in the method of the present application.

[0161] The present application provides an improved method for eliciting and boosting immune responses to EBV antigenic proteins or immunogenic polypeptides thereof in human subjects using an MVA vector combination.

[0162] According to a general aspect of the present application, a method of inducing a broad immune response in a human subject comprises administering a pharmaceutical composition to a subject in need thereof, wherein the broad immune response is a broad antibody or T cell response against an EBV antigen in the human subject.

[0163] According to another general aspect of the present application, a method for preventing or treating EBV infection or a disease associated with EBV infection comprises administering a therapeutically effective amount of the above-mentioned poxvirus or pharmaceutical composition to a subject in need thereof.

[0164] According to another general aspect of the present application, a recombinant poxvirus or a pharmaceutical composition is provided for use in a method for preventing or treating EBV infection or a disease associated with EBV infection.

[0165] According to another general aspect of the present application, a recombinant poxvirus or a pharmaceutical composition is provided for use in a method of inducing an immune response in a subject by administering the pharmaceutical composition of the present invention to a subject in need thereof, thereby obtaining a broad immune response against EBV antigens in a human subject.

[0166] According to an embodiment of the present application, the broad immune response includes a broad antibody response against EBV antigenic proteins in a human subject.

[0167] Preferably, the broad immune response also includes a CD4+ response or CD8+T cell response to EBV antigen proteins in human subjects. The CD4+T cell response produced by the method according to the embodiment of the present application can be, for example, an increase or induction of a dominant CD4+T cell response to EBV antigen proteins in human subjects, and / or an increase or induction of multifunctional CD4+T cells specific to EBV antigen proteins. Multifunctional CD4+T cells express more than one cytokine, such as two or more of IFN-γ, IL-2 and TNF-α. The CD8+T cell response produced by the method according to the embodiment of the present application can be, for example, an increase or induction of multifunctional CD8+T cells specific to EBV antigen proteins in human subjects.

[0168] More preferably, the broad immune response generated by the method according to the embodiments of the present application includes CD4+ T cell response, antibody response and CD8+ T cell response specific to EBV antigen protein in the human subject.

[0169] Typically, administration of compositions and immunogenic combinations according to embodiments of the application will have the therapeutic purpose of generating an immune response against EBV following EBV infection or development of symptoms characteristic of EBV infection, ie, for therapeutic vaccination.

[0170] Delivery Method

[0171] In view of the present disclosure, the compositions and immunogenic combinations of the present application can be administered to a subject by any method known in the art, including but not limited to parenteral administration (e.g., intramuscular, subcutaneous, intravenous or intradermal injection), oral administration, transdermal administration and nasal administration. Preferably, the compositions and immunogenic combinations are administered parenterally (e.g., by intramuscular or intradermal injection) or transdermally.

[0172] In some embodiments of the present application, wherein the composition or immunogenic combination comprises one or more viral vectors, administration may be performed by skin injection, such as intramuscular injection or intradermal injection, preferably intramuscular injection.

[0173] In other embodiments of the present application, wherein the composition or immunogenic combination comprises one or more DNA plasmids, the method of administration is transdermal. Transdermal administration can be combined with epidermal skin abrasions to facilitate delivery of the DNA plasmids to cells. For example, a dermatological patch can be used for epidermal skin abrasions. After the dermatological patch is removed, the composition or immunogenic combination can be deposited on the abraded skin.

[0174] The delivery method is not limited to the above embodiments, and any means for intracellular delivery can be used. Other intracellular delivery methods contemplated by the methods of the present application include, but are not limited to, liposome encapsulation, nanoparticles, and the like.

[0175] Adjuvant

[0176] In some embodiments of the present application, the method of inducing an immune response against EBV further comprises administering an adjuvant.

[0177] According to the embodiment of the present application, the adjuvant may be present in the immunogenic combination or composition of the present application, or applied as a separate composition. The adjuvant may be, for example, a small molecule or an antibody. Examples of adjuvants suitable for the present application include, but are not limited to, immune checkpoint inhibitors (e.g., anti-PD1, anti-RIM-3, etc.), Toll-like receptor inhibitors, RIG-1 inhibitors, IL-15 superagonists (Altor Bioscience), mutant IRF3 and IRF7 gene adjuvants, STING agonists (Aduro), FLT3L gene adjuvants, IL-12 gene adjuvants, and IL-7-hyFc.

[0178] Primary / boost vaccination method

[0179] The embodiment of the present application also contemplates the composition or immunogenic combination of applying an immunologically effective amount to a subject, and subsequently applying the composition or immunogenic combination of an immunologically effective amount of another dosage to the same subject with a so-called primary immunization-boosting regimen. Therefore, in one embodiment, the composition or immunogenic combination of the present application is a primary immunization vaccine for eliciting an immune response. In another embodiment, the composition or immunogenic combination of the present application is a booster vaccine for boosting an immune response. The primary immunization and booster vaccines according to the embodiment of the present application can be used in the method of the present application as described herein. The general concept of this primary immunization-boosting immunization regimen is well known to the technician in the vaccine field. Any composition and immunogenic combination of the present application as described herein can be used as a primary immunization and / or booster vaccine, for eliciting and / or strengthening the immune response for EBV.

[0180] According to the embodiment of the application, the composition or immunogenic combination of the application can be used at least once for primary immunity vaccination. The composition or immunogenic combination can be used again for booster vaccination. As required, the further enhanced administration of the composition or vaccine combination can be optionally added to the scheme. An adjuvant may be present in the composition of the application for booster vaccination, in a separate composition to be used with the composition or immunogenic combination of the application for booster vaccination, or is used alone as a booster vaccination. In those embodiments in which an adjuvant is included in the scheme, the adjuvant is preferably used for booster vaccination.

[0181] The exemplary and non-limiting examples of the prime-boost regimen include administering a single dose of an immunologically effective amount of the composition or immunogenic combination of the present application to the subject to induce an immune response; and subsequently administering another dose of an immunologically effective amount of the composition or immunogenic combination of the present application to enhance the immune response, wherein the booster immunization is first administered about one to fifty-two weeks (1 to 52), about two to twelve weeks (2 to 12), about two to ten weeks (2 to 10), about two to six weeks (2 to 6), preferably about four weeks, preferably about eight weeks after the initial administration of the primary immunization. In one embodiment of the present application, the booster immunization is administered at least one week after the primary immunization. In one embodiment of the present application, the booster immunization is administered at least two weeks after the primary immunization. Optionally, about 10 to 14 weeks, preferably 12 weeks after the initial administration of the primary immunization, a further booster immunization of the composition or immunogenic combination or other adjuvant is administered.

[0182] Pill Box

[0183] The present application also provides a kit comprising the immunogenic combination of the present application. The kit may include the first polynucleotide and the second polynucleotide in separate compositions, or the kit may include the first polynucleotide and the second polynucleotide in a single composition. The kit may also include one or more adjuvants or immunostimulants.

[0184] The ability of inducing or stimulating anti-EBV immune response after administration in animals or human organisms can be assessed in vitro or in vivo using a variety of standard assays in the art. For a general description of the technology for assessing the start and activation of immune responses, see, for example, Coligan et al. (1992 and 1994, Current Protocols in Immunology; Editing JWiley & Sons Inc, National Institute of Health). Cellular immunity can be measured by measuring the cytokine spectrum (e.g., quantifying the production of IL-10 or IFNγ cells by ELISPOT) secreted by activated effector cells (including cells derived from CD4+ and CD8+T cells), by determining the activation state of immune effector cells (e.g., by classical [3H] thymidine uptake for T cell proliferation assay), by measuring antigen-specific T lymphocytes (e.g., peptide-specific lysis in cytotoxic assays, etc.) in sensitized subjects.

[0185] The ability to stimulate cellular and / or humoral responses can be determined by antibody binding and / or binding competition (see, e.g., Harlow, 1989, Antibodies, Cold Spring Harbor Press). For example, the titer of antibodies produced in response to administration of a composition providing an immunogen can be measured by an enzyme-linked immunosorbent assay (ELISA). The immune response can also be measured by a neutralizing antibody assay, where neutralization of the virus is defined as loss of infectivity by reaction / inhibition / neutralization of the virus with a specific antibody. The immune response can be further measured by an antibody-dependent cellular phagocytosis (ADCP) assay.

[0186] Example

[0187] The following detailed examples are intended to help better understand the present invention. However, the present invention is not limited by the examples. Other embodiments of the present invention will be apparent to those skilled in the art by considering the description and practice of the present invention disclosed herein.

[0188] Example 1: Source of inserted gene

[0189] Several genes of EBV strain B95-8 were selected for insertion into the MVA-BN genome: BLLF1 encoding gp350, BXLF2 encoding gH, BKRF2 encoding gL, BRLF1, BZLF1, and EBNA-3A.

[0190] EBV glycoproteins such as gp350, gH and gL are necessary for entry into B cells and epithelial cells. They are also the main targets of antibody responses. In MVA-mBN443, a truncated version of the gp350 protein (amino acids 1-434) is secreted when expressed and fused to a synthetic multimerization domain derived from yeast GCN4. This gp350 multimer is inserted into the intergenic region (IGR) 88 / 89 of the MVA-BN genome along with the full-length versions of gH and gL.

[0191] The following three EBV-derived transgenes were modified to eliminate their functional properties. BZLF1 and BRLF1 are both transcriptional transactivators that control the switch from latent to lytic replication. Peptides of both proteins act as strong T-cell antigens. In MVA-mBN443, several biologically active regions of BRLF1 and BZLF1 were removed, and a portion of the BZLF1 protein was shuffled to produce a BZLF1-BRLF1 fusion protein. EBNA-3A is a nuclear protein with the ability to bind to cellular transcriptional regulators. In MVA-mBN443, all six potential nuclear localization sites of EBNA-3A have been eliminated. In addition, several protein-protein interaction sites are deleted.

[0192] Finally, EBNA-3A was further modified with an N-terminal secretion tag (murine Igκ chain V-J2-C signal peptide) and a C-terminal transmembrane domain (derived from human platelet-derived growth factor receptor β isoform 2). Both the BZLF1-BRLF1 fusion and EBNA-3A were inserted into IGR 44 / 45 of the MVA genome.

[0193] The gp350 protein sequence is based on GenBank entry YP 401667.1, and the yeast derived GCN4 sequence is based on 2IPZ_A. Both gH and gL show 100% identity to GenBank entries YP_401700.1 and YP_401678.1, respectively. The EBNA-3A sequence is based on GenBank entry YP_401669.1, and the BZLF1-BRLF1 fusion protein is based on GenBank sequences YP_401674.1 (BRLF1) and YP_401673.1 (BZLF1).

[0194] All of the above protein sequences are optimized for human codon usage at the nucleotide level, and repeats and nucleotide stretches are removed. The coding sequences of all EBV-derived transgenics are listed under the brief description of the sequence. The sequences were used to clone recombinant plasmids pBN640 and pBN654 containing gp350 polymers, gH, gL or BZLF1-BRLF1 fusions, EBNA-3A boxes, respectively.

[0195] Example 2: loxP sites

[0196] The NPTII-heGFP selection cassette in the intermediate recombinant MVA-mBN443A is flanked by two defined loxPV sites. After transfection of the CRE recombinase expression plasmid in cell culture, this site-specific recombinase catalyzes the precise excision of all DNA flanked by its target sequence loxPV, thereby completely removing the selection cassette. The established process reduces work steps, time and labor, and controls the loss of the selection cassette.

[0197] Example 3: Source of Inserted Promoter

[0198] The Pr13.5 long promoter contains a 124 bp intergenic region between 014L / 13.5L, driving the expression of the natural MVA13.5L gene and showing very strong early expression caused by two early promoter core sequences (A novel naturally occurring tandem promoter in modified vaccinia virus ankara drives very early gene expression and potent immune responses: PLoS One 2013 Aug 12; 8(8): e73511). In recombinant MVA-mBN443, Pr13.5 long is driving the expression of BZLF1-BRLF1-fusion and gp350-multimer.

[0199] The promoter PrS is a synthetic promoter designed from the consensus sequence of the early and late elements of the vaccinia virus promoter (Chakrabarti S, Sisler JR, Moss B. Compact, synthetic, vaccinia virus early / late promoter for protein expression. BioTechniques. 1997; 23(6): 1094-7). PrS drives gH expression in the early and late stages of infection by the recombinant virus MVA-mBN443.

[0200] The promoter PrH5m is a modified version of the promoter of the vaccinia virus H5 gene (Wyatt LS, Shors ST, Murphy BR, Moss B. Development of a replication-deficient recombinant vaccinia virus vaccine effective against parainfluenza virus 3 infection in an animal model. Vaccine. 1996; 14(15): 1451-8). It drives the expression of gL in both the early and late stages of infection by the recombinant virus MVA-mBN443.

[0201] Pr1328 is a 100 bp natural immediate early promoter that drives the B2R gene of the Western Reserve strain of vaccinia virus. The sequence is highly similar to the MVA168R promoter in MVA-BN, with only one nucleotide difference. In recombinant MVA-mBN443, Pr1328 is driving the expression of EBNA-3A.

[0202] Example 4: Construction of recombinant MVA

[0203] An insert carrying the gp350 multimer (under the control of the PrMVA13.5 long promoter) and the gH and gL genes (under the control of the PrS and PrH5m promoters) was generated by gene synthesis and inserted into pBNX202 containing the IGR88 / 89 flanking regions of MVA, resulting in the recombinant plasmid pBN640 ( Figure 5 For the recombinant plasmid pBN641 carrying the full-length gp350 gene under the control of the PrMVA13.5 long promoter, the corresponding full-length gp350 gene and gH and gL genes (under the control of the PrS and PrH5m promoters) were generated by gene synthesis. The gp350-multi-gH-gL insert was removed from pBN640 containing the IGR88 / 89 flanking region of MVA by restriction digestion with SacII and MluI-HF and replaced with the PrMVA13.5-long-full-length-gp350 / PrS-gH / PrH5m-gL gene to obtain pBN641 ( Fig.10 ).

[0204] An insert carrying the BZLF1-BRLF1 fusion (under the control of the PrMVA13.5 long promoter) and EBNA-3A (under the control of the Pr1328 promoter) was generated by gene synthesis and inserted into pBNX204 containing the IGR44 / 45 flanking regions of MVA, resulting in the recombinant plasmid pBN654 ( Figure 6 ).

[0205] Example 5: Additional plasmids required for the generation of MVA-mBN443 and MVA-mBN444

[0206] For the production of recombinant MVA-mBN443 and MVA-mBN444, the selection cassette inserted via recombination with pBN654 was removed using the CRE / loxP system. For this purpose, a plasmid encoding the CRE recombinase (pBN274, Figure 7 ). CRE recombinase is a site-specific recombinase that catalyzes the precise excision of all DNA flanked by loxP of its target sequence, thereby completely removing the selection cassette.

[0207] Example 6: Production of recombinant MVA-mBN443

[0208] A multistep approach was chosen to create recombinant MVA-BN expressing EBV-derived gp350 multimers, gH, gL, Zta (encoded by BZLF1), Rta (encoded by BRLF1), and EBNA-3A.

[0209] In the first step, a recombinant virus MVA-mBN423A encoding the gp350 multimers in IGR 88 / 89 and gH and gL was generated. A second recombinant virus MVA-mBN440A encoding the BZLF1-BRLF1 fusion and EBNA-3A in IGR 44 / 45 was generated. CEF cells were co-infected with two recombinant viruses MVA-mBN423A and MVA-mBN440A to obtain the parental virus MVA-mBN443A, which contains all five transgenes and a selection cassette. Finally, the selection cassette was removed from MVA-mBN443A to produce MVA-mBN443B, a recombinant without a selection cassette. The recombinant plasmids of all recombinant viruses were constructed as described above.

[0210] For the production of MVA-mBN423A, primary CEF cells were infected with MVA-BN, and then transfected with recombinant plasmid pBN640. After amplification and plaque purification under GPT selective conditions (using mycophenolic acid, xanthine and hypoxanthine), recombinant vaccine candidate MVA-mBN423A P11PP3#20 was obtained. For the production of MVA-mBN440A, primary CEF cells were infected with MVA-BN, and then transfected with recombinant plasmid pBN654. Amplification and plaque purification were performed under NPTII selective conditions (using G418) to produce MVA-mBN440A P11PP3#15. Via MVA-mBN423A P11PP3#20 and MVA-mBN440A P11PP3#15 co-infection, final recombinant virus MVA-mBN443A P18PP5#28 was obtained via plaque purification. After further amplification and plaque purification of MVA-mBN443A under non-selective conditions, the final recombinant virus MVA-mBN443BP21PP5#68 was isolated, which lacked both selection cassettes.

[0211] Serum-free VP-SFM medium was used at all stages. The production of recombinant MVA-mBN443 is summarized in Figure 8 middle.

[0212] Example 7: Production of recombinant MVA-mBN444

[0213] A multistep approach was chosen to create recombinant MVA-BN mBN444 (mBN444) expressing EBV-derived gp350 full length (fl), gH, gL, Zta (encoded by BZLF1), Rta (encoded by BRLF1), and EBNA-3A. Fig. 9 ).

[0214] In the first step, a recombinant virus MVA-mBN424A encoding full-length gp350 as well as gH and gL in IGR 88 / 89 was generated. A second recombinant virus MVA-mBN440A encoding the BZLF1-BRLF1 fusion and EBNA-3A in IGR 44 / 45 was generated. CEF cells were co-infected with two recombinant viruses MVA-mBN424A and MVA-mBN440A to obtain the parental virus MVA-mBN444A, which contains all five transgenes and a selection cassette. Finally, the selection cassette was removed from MVA-mBN444A to produce MVA-mBN444B, a recombinant without a selection cassette. The recombinant plasmids of all recombinant viruses were constructed as described above.

[0215] For the production of MVA-mBN424A, primary CEF cells were infected with MVA-BN and subsequently with the recombinant plasmid pBN641 ( Fig.10 ) transfection. After amplification and plaque purification under GPT selective conditions (using mycophenolic acid, xanthine and hypoxanthine), the recombinant vaccine candidate MVA-mBN424A P11PP3#16 was obtained. The production of MVA-mBN440A is described above. The final recombinant virus MVA-mBN444AP12PP5#26 was obtained by co-infection of MVA-mBN424A P11PP3#16 and MVA-mBN440A P11PP3#15 followed by plaque purification. After further amplification and plaque purification of MVA-mBN444A under non-selective conditions, the final recombinant virus MVA-mBN444B P33PP9#89 was isolated, which does not have two selection boxes.

[0216] At all stages, serum-free VP-SFM medium was used. The production of recombinant MVA-mBN444 is summarized in Fig.11 middle.

[0217] Example 8: Induction of EBV gp350-specific IgG response

[0218] On days 0 and 28, mice were fed 8.25 × 10 7 TCID 50 BALB / c mice were immunized intramuscularly and serum IgG antibody responses against gp350 were analyzed by a multiplex ELISA-based assay using full-length gp350 as capture antigen. Serum IgG specific for gp350 was detectable already on day 14 after the first immunization ( Fig.12). Anti-gp350 IgG remained at very similar levels until d26 after the first immunization. After the second immunization on day 28, serum anti-gp350 IgG levels were significantly increased as measured on day 42 (14 days after the second immunization) ( Fig.12 ). After the first immunization, mBN444, encoding the full-length gp350, induced higher levels of anti-gp350 than mBN443, encoding a portion of the gp350 extracellular domain multimerized with the GCN-4 domain (gp350-multi). After a booster immunization applied on day 28, on day 42, there was no longer a significant difference between the anti-gp350 IgG titers induced by the two recombinant MVA-BN-EBV constructs.

[0219] Example 9: Induction of EBV gH / gL-specific IgG response

[0220] We also analyzed mice that had been treated with two recombinant MVA-BN-EBV constructs at 8.25 x 10 per mouse on days 0 and 28. 7 TCID 50 Serum IgG antibody responses against the gH / gL complex of the same BALB / c mice immunized intramuscularly. Since it is not possible to express antigenically authentic gH and gL antigens independently of each other and from the third complex component gp42, the gH / gL-specific IgG response was measured in a multiplex ELISA assay using the commercially available gH / gL / gp42 complex as antigen. Serum IgG specific for gH / gL was detectable already on day 14 after the first immunization ( Fig.13 ). Anti-gH / gL IgG remained at very similar levels until d26 after the first immunization. After the second immunization on day 28, serum anti-gH / gL IgG levels were significantly increased on day 42 (14 days after the second immunization) ( Fig.13). Throughout the entire period tested, mBN444, encoding full-length gp350, and mBN443, encoding gp350-multi, induced very similar levels of anti-gH / gL. The latter was an expected result, since the gH and gL expression cassettes in both recombinant MVA-BN-EBV constructs were identical. In summary, both constructs induced high levels of anti-gH / gL as well as anti-gp350 antibodies, indicating that all three antigens were expressed in an immunogenic form by both recombinant MVA constructs. For the gH / gL complex, this was inferred from the fact that high levels of antibodies reactive with the authentic gH / gL / gp42 complex were induced, which is probably only possible when gL and gH are expressed simultaneously, since they require each other to be correctly folded and transported to the surface of MVA-BN-EBV infected cells, where they can be accessed by the immune system.

[0221] Example 10: Induction of EBV neutralizing antibody response

[0222] The EBV whole virus neutralization assay was also analyzed in mice that had been treated with two recombinant MVA-BN-EBV constructs at 8.25×10 per mouse on days 0 and 28. 7 TCID 50 The same BALB / c mice immunized intramuscularly were able to induce antibodies that neutralize EBV. No neutralizing antibodies were detected at two time points after the first immunization (d14 and d26), but significant neutralizing titers were detected in the sera of both groups of mice 14 days after the second immunization (d42). Fig.14 ). Therefore, both MVA-BN-EBV constructs were able to induce neutralizing antibody responses against EBV.

[0223] Example 11: Induction of T cell responses against EBV gH, BRLF1 and EBNA-3A

[0224] We also analyzed mice that had been treated with two recombinant MVA-BN-EBV constructs at 8.25 x 10 per mouse on days 0 and 28. 7 TCID 50 Induction of T cells against EBV gH and two non-enveloped antigens encoded in the MVA-BN-EBV constructs in the same BALB / c mice immunized intramuscularly. As a control, CD8 T cell responses against the MVA protein E3L were determined. MVA-E3L contains the MVA immunodominant CD8 T cell epitope present in the MHC I H-2d haplotype in BALB / c mice. Both constructs induced high and very comparable CD8 T cell responses against the MVA vector antigen E3L ( Fig.15Using peptide antigens defined against the three EBV proteins gH, BZLF1, and EBNA-3A, the induction of T cell responses against these three proteins was demonstrated after two immunizations with each of the two MVA-BN-EBV constructs ( Fig.12 ). Thus, it was confirmed that both MVA-BN-EBV constructs expressed gH, BZLF1, and EBNA-3C antigens, and the immunogenicity of these recombinant antigens in terms of T cell induction was demonstrated. Combined with the following facts: i) gH is unlikely to induce antibodies if gL is not expressed, ii) IgG antibody responses to gp350 were observed (see above), and iii) the BRLF1 protein, against which T cells are induced, was expressed as a fusion protein with BZLF1, these findings indicate that all EBV transgenes are expressed by both recombinant MVA-BN-EBV constructs and are immunogenic following intramuscular injection of both recombinant MVA-BN-EBV constructs into mice.

[0225] sequence

[0226] SEQ ID NO: 1 Nucleic acid sequence of gp350 multimer (1455 nucleotides).

[0227] atg tgatag

[0228] SEQ ID NO: 2gH nucleic acid sequence (2121 nucleotides).

[0229] atg tga

[0230] The nucleic acid sequence of SEQ ID NO:3 gL (414 nucleotides).

[0231] atg agagccgtgggagtgttcctggccatctgcctcgtgaccatcttcgtgctgcccacctggggtaactgggcttacccttgttgccacgtgacccagctgagagcccagcatctgctggcactggagaacatcagcgacatctacctggtgtccaaccagacctgcgacggcttcagcctggcatccctgaacagtcccaagaacggcagcaatcagctcgtgatctccagatgtgccaacggactgaacgtggtgtccttcttcatctccatcctgaagcggagcagcagcgctctgacaggccacctgagagagctgctgaccaccctggaaaccctgtacggcagcttcagcgtggaagatctgttcggagccaacctgaacagatacgcctggcacagaggaggc tga

[0232] The nucleic acid sequence of SEQ ID NO:4 BZLF1 - BRLF1 (2283 nucleotides).

[0233] atg tgataa

[0234] SEQ ID NO:5 Nucleic acid sequence of EBNA-3A (2892 nucleotides).

[0235] atg tgataa

[0236] SEQ ID NO:6 Nucleic acid sequence of a loxPV site.

[0237] ATAACTTCGTATAGGATACTTTATACGAAGTTAT

[0238] SEQ ID NO:7 Nucleic acid sequence of Pr13.5 long promoter.

[0239] taaaaatagaaactataatcatataatagtgtaggttggtagtattgctcttgtgactagagactttagttaaggtactgtaaaaatagaaactataatcatataatagtgtaggttggtagta

[0240] SEQ ID NO:8 Nucleic acid sequence of PrS promoter.

[0241] aaaaattgaaattttattttttttttttggaatataa

[0242] SEQ ID NO:9 Nucleic acid sequence of PrH5m promoter.

[0243] taaaaattgaaaataaatacaaaggttcttgagggttgtgttaaattgaaagcgagaaataatcataaataatttcattatcgcgatatccgttaagtttgtatcgta

[0244] SEQ ID NO:10 Nucleic acid sequence of Pr1328 promoter.

[0245] tatattattaagtgtggtgtttggtcgatgtaaaatttttgtcgataaaaattaaaaaataacttaatttattattgatctcgtgtgtacaaccgaaatc

Claims

1. A recombinant poxvirus comprising two or more EBV envelope glycoproteins and one or more T cell antigens.

2. The poxvirus of claim 1, wherein the two or more EBV envelope glycoproteins include gp350, gB, gp42, gH, gL, gM, gN, BMRF2, BDLF2, BDLF3, BILF1, BILF2, and BARF1.

3. The poxvirus of claim 1, wherein the one or more T cell antigens include EBNA1, EBNA-2, EBNA-3a, EBNA-3b, EBNA-3c, EBNA-leader protein, and LMP2.

4. The poxvirus of any one of claims 1 to 3, comprising gp350, EBNA-3A, gH and gL.

5. The poxvirus of any one of claims 1 to 4, further comprising a BRLF1-BZLF1 fusion protein.

6. The poxvirus of any one of claims 1 to 5, wherein gp350 is encoded by a nucleic acid sequence having at least 90% identity to SEQ ID NO: 1, preferably said gp350 comprises the sequence of SEQ ID NO:

1.

7. The poxvirus according to any one of claims 1 to 5, wherein EBNA-3A is encoded by a nucleic acid sequence having at least 90% identity with SEQ ID NO:5, preferably said EBNA-3A comprises the sequence of SEQ ID NO:

5.

8. The poxvirus according to any one of claims 1 to 5, wherein the gH is encoded by a nucleic acid sequence having at least 90% identity with SEQ ID NO: 2, preferably the gH comprises the sequence of SEQ ID NO:

2.

9. The poxvirus according to any one of claims 1 to 5, wherein the gL is encoded by a nucleic acid sequence having at least 90% identity with SEQ ID NO: 3, preferably the gL comprises the sequence of SEQ ID NO:

3.

10. The poxvirus according to any one of claims 1 to 5, wherein the BRLF1-BZLF1 fusion protein is encoded by a nucleic acid sequence having at least 90% identity with SEQ ID NO: 4, preferably the BRLF1-BZLF1 fusion protein comprises the sequence of SEQ ID NO:

4.

11. The poxvirus of any one of claims 1 to 10, wherein the poxvirus is a recombinant modified vaccinia virus Ankara (MVA).

12. The poxvirus of claim 11, wherein the MVA comprises MVA-BN or a derivative thereof.

13. The poxvirus of any one of claims 1 to 12, wherein the gp350, gH and gL are inserted into the intergenic region (IGR) 88 / 89 of the MVA genome.

14. The poxvirus of any one of claims 1 to 12, wherein the EBNA-3A and BRLF1-BZLF1 fusion is inserted into the intergenic region (IGR) 44 / 45 of the MVA genome.

15. The poxvirus of any one of claims 1 to 14, wherein gp350, gH, gL, EBNA-3A, and BRLF1-BZLF1 fusion are each under the control of a separate promoter.

16. A pharmaceutical composition comprising a therapeutically effective amount of the recombinant poxvirus according to any one of claims 1 to 15 and a pharmaceutically effective carrier.

17. The pharmaceutical composition of claim 16, further comprising one or more adjuvants.

18. A method for inducing a broad immune response in a subject, the method comprising administering to a subject in need thereof a pharmaceutical composition as described in any one of claims 16-17, thereby obtaining a broad antibody and T cell response against EBV in the human subject.

19. The method of claim 18, wherein the broad immune response comprises an antibody response in the human subject to the EBV antigen.

20. The method of claim 18, wherein the broad immune response comprises a CD8+ T cell response against the EBV antigen in the human subject.

21. The method of claim 18, wherein the broad immune response comprises a CD4+ T cell response against the EBV antigen in the human subject.

22. A method for preventing or treating EBV infection or a condition associated with EBV infection, comprising administering the pharmaceutical composition of any one of claims 16-17 to a subject in need thereof.

23. The method of any one of claims 18-22, wherein the pharmaceutical composition of claims 16-17 is administered as a prime administration and a boost administration.

24. The method of claim 23, wherein the boosting is performed 1-52 weeks, preferably 2-12 weeks, more preferably 2-10 weeks, and most preferably at least 2-6 weeks after the priming administration.

25. The recombinant poxvirus according to any one of claims 1 to 15 or the pharmaceutical composition according to any one of claims 16 to 17, for use in a method for preventing or treating EBV infection or a condition associated with EBV infection.

26. The recombinant poxvirus of any one of claims 1 to 15 or the pharmaceutical composition of any one of claims 16 to 17, for use in a method for inducing an immune response in a subject, the method comprising administering the pharmaceutical composition of any one of claims 16 to 17 to a subject in need thereof, thereby obtaining a broad immune response against the EBV antigen in the human subject.

Images