Application of substance for inhibiting PHGDH gene expression in preparation of brain tumor radiotherapy sensitizer

Abstract

The invention belongs to the field of biomedicine, and discloses application of a substance for inhibiting PHGDH gene expression in preparation of a brain tumor radiotherapy sensitizer. The technical problem to be solved by the invention is how to prepare the brain tumor radiotherapy sensitizer. The invention finds that the knockout or knockdown of the PHGDH gene combined with radiotherapy can promote the death of brain tumor cells, inhibit the growth of brain tumors and prolong the lifetime of tumor-bearing animals, which indicates that the deficiency of PHGDH can increase the sensitivity of GBM transplanted tumors to radiotherapy and improve the therapeutic effect of GBM transplanted tumors, and PHGDH can be used as a potential target for treating GBM patients.

Description

Technical Field

[0001] The invention belongs to the field of biomedicine, and specifically relates to the application of a substance for inhibiting PHGDH gene expression in the preparation of a brain tumor radiotherapy sensitizer. Background Art

[0002] Gliomas are a type of tumor that originates from the neuroepithelium and are the most common intracranial malignant tumors, accounting for 40%-50% of all brain tumors. According to the classification standards of the World Health Organization (WHO), the malignancy of gliomas gradually increases from grade I to grade IV. Gliomas of different grades include astrocytoma, medulloblastoma, glioblastoma multiforme (GBM), ependymoma and oligodendroglioma. Among them, GBM is the most invasive and malignant glioma. Even if patients receive the most aggressive treatment such as surgery, radiotherapy and chemotherapy, the average survival period is only 12-15 months.

[0003] Gliomas have significant invasive growth characteristics and unclear boundaries with normal brain tissue, which makes it difficult to completely remove tumor tissue during surgery, and residual tumor cells are prone to recurrence. GBM has a high invasiveness, extremely fast diffusion and metastasis, high recurrence rate and extremely poor prognosis. Although radiotherapy and chemotherapy can inhibit tumor growth in the short term, GBM shows significant resistance to these treatments, and the five-year survival rate of patients is still less than 5%. There is a special cell population in GBM tissue, called glioma stem-like cells (GSCs). GSCs share many stem cell markers with normal neural stem cells (NSCs), such as CD133, Nestin, SOX2 and Olig2. These GSCs not only have the ability to self-renew and proliferate indefinitely, but also can initiate and maintain tumor formation. More and more studies have shown that GSCs play a key role in the occurrence, continued growth and recurrence of GBM.

[0004] Studies have shown that the presence of GSCs is closely related to the high invasiveness and treatment resistance of GBM. GSCs can evade the attack of traditional treatment methods, leading to tumor recurrence and deterioration. Therefore, in-depth research on the biological characteristics and molecular mechanisms of GSCs can reveal the occurrence and development of brain gliomas and provide new targets and strategies for treatment. Current research is exploring methods to target GSCs, such as small molecule inhibitors, immunotherapy, and gene editing technology, in order to inhibit tumor growth and recurrence and improve patient prognosis. Summary of the invention

[0005] The technical problem to be solved by the present invention is how to prepare a brain tumor radiotherapy sensitizer.

[0006] To solve the above technical problems, the present invention provides any of the following applications:

[0007] 1. Application of substances that inhibit PHGDH gene expression or knock out PHGDH gene in the preparation of brain tumor radiotherapy sensitizers;

[0008] 2. Application of substances that reduce the content or activity of PHGDH protein in the preparation of brain tumor radiotherapy sensitizers.

[0009] The present invention also provides a brain tumor radiotherapy sensitizer, which contains (or has as its active ingredient) a substance that inhibits PHGDH gene expression or knocks out PHGDH gene, or a substance that reduces PHGDH protein content or activity.

[0010] Wherein, the radiotherapy sensitizer may be a sensitizer for X-rays. The radiotherapy sensitizer may be a sensitizer for 3Gy.

[0011] Another technical problem to be solved by the present invention is how to treat and / or prevent brain tumors.

[0012] To solve the above technical problems, the present invention provides any of the following applications:

[0013] 1. Use of substances that inhibit PHGDH gene expression or knock out PHGDH gene in the preparation of products for treating and / or preventing brain tumors;

[0014] 2. Use of a system in the preparation of a product for treating and / or preventing brain tumors, the system comprising a substance for inhibiting PHGDH gene expression or knocking out PHGDH gene and a radiotherapy device;

[0015] 3. Use of substances that reduce the content or activity of PHGDH protein in the preparation of products for treating and / or preventing brain tumors;

[0016] 4. Use of a system in preparing a product for treating and / or preventing brain tumors, the system comprising a substance that reduces the content or activity of PHGDH protein and a radiotherapy device.

[0017] The present invention also provides a product for treating and / or preventing brain tumors, which is composed of a substance that inhibits PHGDH gene expression or knocks out PHGDH gene and a radiotherapy device, or a substance that reduces PHGDH protein content or activity and a radiotherapy device.

[0018] In the present invention, the brain tumor may be a glioma. The glioma may be a tumor initiated by glioma stem cells (GSC). In one embodiment of the present invention, the glioma stem cells (GSC) are GSC19 and GSC29.

[0019] In the present invention, the substance that inhibits the expression of PHGDH gene or knocks out PHGDH gene can be a substance that reduces the expression of PHGDH gene using the specific shRNA of PHGDH gene or a substance that knocks out PHGDH gene using CRISPR / Cas9 gene knockout system. The substance that reduces the expression of PHGDH gene using the specific shRNA of PHGDH gene can be an shRNA that can specifically reduce the expression of PHGDH gene, or an expression cassette that can express the shRNA, or a recombinant vector containing the expression cassette, or a cell line containing the recombinant vector (excluding breeding materials). The targeting sequence of the shRNA can be SEQ ID No.4 or SEQ ID No.5 in the sequence table.

[0020] In the present invention, the radiotherapy device can release X-rays.

[0021] In the present invention, the treatment and / or prevention of brain glioma can be embodied in inhibiting the growth of glioma and / or prolonging the survival period of glioma animals.

[0022] In the present invention, the animal may be a mammal or a human. The mammal may be a mouse.

[0023] In the present invention, PHGDH protein is a protein encoded by PHGDH gene (NCBI ID: 26227, updated on May 5, 2024), and PHGDH gene is phosphoglycerate dehydrogenase gene (Genebank accession: NM_006623.4, updated on May 2, 2024).

[0024] Experiments have shown that knockout or knockdown of the PHGDH gene combined with radiotherapy can promote the death of brain tumor cells, inhibit tumor growth, and prolong the survival of tumor-bearing animals. This shows that PHGDH deficiency can increase the sensitivity of GBM transplanted tumors to radiotherapy and improve their therapeutic effects. PHGDH can be used as a potential target for the treatment of GBM patients.

[0025] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1The expression of proteins was detected by WB. a is the expression of PHGDH, SOX2, and Olig2 proteins detected by WB after PHGDH was knocked out in GSC19 and GSC29; b is the expression of PHGDH, SOX2, and Olig2 proteins detected by WB after DOX-induced knockdown of PHGDH in GSC19 and GSC29.

[0027] Figure 2 The synergistic effect of PHGDH deficiency and radiotherapy inhibited GBM tumor growth and prolonged the survival of tumor-bearing mice. a. Live imaging real-time dynamic monitoring of tumor growth in mice injected with GSC19-shPHGDH, and quantitative statistics; b. Quantitative statistical analysis of bioluminescence intensity in each group of tumor-bearing mice injected with GSC19-shPHGDH; c. Kaplan-Meier survival curve analysis of the survival period of each group of tumor-bearing mice injected with GSC19-shPHGDH; d. Live imaging real-time dynamic monitoring of tumor growth in mice injected with GSC29-shPHGDH, and quantitative statistics; e. Quantitative statistical analysis of bioluminescence intensity in each group of tumor-bearing mice injected with GSC29-shPHGDH; f. Kaplan-Meier survival curve analysis of the survival period of each group of tumor-bearing mice injected with GSC29-shPHGDH.

[0028] Figure 3 PHGDH deficiency promotes the radiosensitivity of GBM tumor cells. a. After the tumor tissue sections of the four groups of mice injected with GSC19-shPHGDH, immunofluorescence staining was used to analyze the apoptosis marker Cleaved-Caspase3, and the proportion of Cleaved-Caspase3-positive tumor cells was counted; b. After the tumor tissue sections of the four groups of mice injected with GSC29-shPHGDH, immunofluorescence staining was used to analyze the apoptosis marker Cleaved-Caspase3, and the proportion of Cleaved-Caspase3-positive tumor cells was counted.

[0029] A p value of <0.05 indicates that the difference reaches a significant level, and a p value of <0.001 or smaller indicates that the difference reaches an extremely significant level. DETAILED DESCRIPTION

[0030] The experimental methods in the following examples are conventional methods unless otherwise specified, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. The materials, reagents, instruments, etc. used in the following examples are all commercially available unless otherwise specified. The quantitative tests in the following examples are all repeated at least three times, and the results are averaged.

[0031] GSC19 and GSC29 in the following examples are all described in the literature (Chen L, Qi Q, Jiang X, Wu J, Li Y, Liu Z, Cai Y, Ran H, Zhang S, Zhang C, Wu H, Cao S, Mi L, Xiao D, Huang H, Jiang S, WuJ, Li B, Xie J, Qi J, Li F, Liang P, Han Q, Wu M, Zhou W,Wang C,Zhang W,Jiang X,ZhangK,Li H,Zhang ofprint.PMID:38563585.)(Figure 1 Figure H), the public can obtain from the applicant, these biological materials are only used to repeat the relevant experiments of the present invention, and cannot be used for other purposes. GSC19 and GSC29 are glioma stem cells isolated from tumor tissues of different GBM patients, and have undergone a series of functional verifications of tumor stem cells. They express the same stem cell markers as normal neural stem cells (NSC), such as CD133, Nestin, SOX2, Olig2, etc., and also have the ability of self-renewal, unlimited proliferation, and tumorigenesis.

[0032] psPAX2: Addgene, catalog number #12260.

[0033] pOI-VSVG: Addgene, catalog number #1733.

[0034] PHGDH antibody: Anti-PHGDH antibody, Proteintech, catalog number 14719-1-AP.

[0035] SOX2 antibody: Anti-SOX2 antibody, R&D Systems, catalog number AF2018.

[0036] Olig2 antibody: Anti-Olig2 antibody, R&D Systems, catalog number AF2418.

[0037] GAPDH antibody: Anti-GAPDH antibody, Proteintech, catalog number 60004-1-Ig.

[0038] Secondary antibodies: Rabbit secondary antibody Peroxidase-conjugated goat anti-rabbit IgG (H+L), Proteintech (Cat. No. SA00001-2); Mouse secondary antibody Peroxidase-conjugated goat anti-Mouse IgG (H+L), Proteintech (Cat. No. SA00001-1); Sheep secondary antibody Peroxidase-conjugated donkey anti-Goat IgG (H+L), Proteintech (Cat. No. SA00001-3).

[0039] Example 1: Knockout of PHGDH gene combined with IR can treat glioma

[0040] 1. Knockout of PHGDH gene

[0041] 1. Knockout of PHGDH gene using CRISPR / Cas9 gene knockout system

[0042] Two different sgRNA targets were designed for the PHGDH gene (full name: phosphoglyceratedehydrogenase; Genebank accossion: NM_006623.4, updated on May 2, 2024) (encoding PHGDH protein, NCBI ID: 26227, updated on May 5, 2024) using the CRISPR / Cas9 gene knockout system, named #1 target (target sequence is SEQ ID No.1 in the sequence list) and #2 target (target sequence is SEQ ID No.2 in the sequence list), and a negative control (Negative control, denoted as Ctrl, whose target sequence is SEQID No.3 in the sequence list) was set up. Subsequently, the PHGDH gene was stably knocked out in the glioma stem cell lines GSC19 and GSC29 by lentiviral infection. The target sequences are as follows:

[0043] #1 target: TTCGATGAAGGACGGCAAAT (SEQ ID No. 1);

[0044] #2 target: AGCTGCGTTGATGACATCAG (SEQ ID No. 2);

[0045] Negative control target sequence: CCTAAGGTTAAGTCGCCCTCG (SEQ ID No. 3).

[0046] The specific implementation steps are as follows:

[0047] 1) Construction of Lenti-PHGDH-sgRNA plasmid

[0048] (1) Design and synthesis of PHGDH sgRNA primer sequences

[0049] Design specific sgRNA knockout sequences for the PHGDH gene. Then submit these designed sgRNA primer sequences to Invitrogen for synthesis. The primer sequences are shown in Table 1 below:

[0050] Table 1. PHGDH sgRNA primer sequences

[0051] Primers Nucleotide sequence (5'-3') PHGDH sgRNA 1# F CACCGTTCGATGAAGGACGGCAAAT PHGDH sgRNA 1# R AAAC ATTTGCCGTCCTTCATCGAA C PHGDH sgRNA 2# F CACCG AGCTGCGTTGATGACATCAG PHGDH sgRNA 2# R AAAC CTGATGTCATCAACGCAGCT C

[0052] (2) PHGDH sgRNA primer annealing

[0053] To ensure the effectiveness and stability of the primers, the primers synthesized by the company were first diluted to a final concentration of 10 μmol / L in aqueous solution. Subsequently, annealing treatment was performed according to the annealing system listed in Table 2.

[0054] Table 2. PHGDH sgRNA annealing system

[0055] Element Volume / μL Upstream primer F 5 Downstream primer R 5 0.5mol / L NaCl 6 <![CDATA[ddH 2 The]]> 24 Total volume 40

[0056] The mixed annealing system was placed in a 95°C water bath and heated for 10 minutes, then the water bath was turned off and the system was allowed to cool naturally to room temperature to achieve the annealing process of the primers. The annealing products were stored in a 4°C refrigerator. Among them, the annealing product of PHGDHsgRNA 1#F and PHGDH sgRNA 1#R was marked as annealing product 1; the annealing product of PHGDH sgRNA 2#F and PHGDHsgRNA 2#R was marked as annealing product 2.

[0057] (3) Enzyme digestion of LentiGuide-puro empty vector

[0058] The LentiGuide-puro empty vector (Addgene, catalog number #52963) was digested with BsmB I restriction endonuclease. After the digestion was completed, the LentiGuide-puro vector was recovered using a gel recovery kit.

[0059] (4) Ligation reaction

[0060] The recovered LentiGuide-puro vector after enzyme digestion was ligated with annealing product 1 and annealing product 2. After successful ligation, the recombinant vectors with correct sequences were named Lenti-PHGDH-sgRNA1 and Lenti-PHGDH-sgRNA2.

[0061] Following the same steps, a negative control Ctrl plasmid for SEQ ID No. 3 in the sequence listing was constructed.

[0062] 2) Detection of PHGDH sgRNA knockout efficiency

[0063] (1) Virus packaging

[0064] To prepare lentiviral particles, 1.5×10^6 HEK293 cells were first seeded in a 10 cm culture dish 24 hours in advance. Subsequently, the lentiviral packaging plasmids psPAX2 (5 μg) and pCI-VSVG (5 μg), as well as the successfully constructed Lenti-PHGDH-sgRNA1 plasmid (5 μg) were co-transfected into HEK293 cells using the calcium phosphate transfection method. 12 hours after transfection, the culture medium was replaced with NBM complete medium, which was prepared by adding 10 mL B27-supplement serum replacement (Thermo Fisher, Catalog No. 12580-010), 20 ng / ml EGF (R&D, Catalog No. Cat#236-EG) and 20 ng / ml bFGF (R&D, Catalog No. Cat#4114-TC) to 500 mL of basal culture medium Neurobasal Medium (ThermoFisher, Catalog No. 12348-017). After 72 hours of cell culture, the viral supernatant was collected, centrifuged at 3000 rpm for 3 minutes to remove cell debris, and then filtered using a 0.45 μm filter. The filtered lentivirus (labeled as PHGDHsgRNA1 virus) was stored in a -80°C refrigerator.

[0065] According to the same transfection and collection method as above, the Lenti-PHGDH-sgRNA1 plasmid was replaced with the Lenti-PHGDH-sgRNA2 plasmid and the negative control Ctrl plasmid to obtain the PHGDH sgRNA2 virus and the negative control virus, respectively.

[0066] (2) Virus infection, screening, and knockout effect verification

[0067] First, 1.5×10^6 GSCs (GSC19 or GSC29 cell lines) were inoculated in a 10 cm culture dish. Subsequently, 5 ml of supernatant containing PHGDH sgRNA1, PHGDH sgRNA2 or negative control Ctrl virus was added, and the total volume was supplemented with NBM complete medium to 10 mL. After the cells were cultured in an incubator for 48 hours, the cells were digested to a single cell state using Accutase enzyme, and the cells were resuspended in complete medium containing 1 μg / mL puromycin for screening.

[0068] After screening, cell samples were collected and the knockout effect of the PHGDH gene was detected by Western Blot (WB) technology. In GSC19, the cells obtained by knocking out the PHGDH gene with targets #1 and #2 were named GSC19-ΔPHGDH-#1 and GSC19-ΔPHGDH-#2, respectively; similarly, in GSC29, the cells obtained by knocking out the PHGDH gene with targets #1 and #2 were named GSC29-ΔPHGDH#1 and GSC29-ΔPHGDH#2, respectively. GSC19 and GSC29 cells infected with the negative control Ctrl virus were marked as GSC19-Ctrl and GSC29-Ctrl, respectively, as the control group for subsequent experiments.

[0069] In WB analysis, the expression of PHGDH protein and stem cell markers SOX2 and Olig2 in cells after PHGDH knockout was detected. The experiment used GAPDH as an internal reference, and the primary antibodies were PHGDH antibody, SOX2 antibody, Olig2 antibody and GAPDH antibody, and the secondary antibody was uniformly Peroxidase-conjugated Goat (or Donkey) Anti-Rabbit (or Anti-Mouse, Anti-Goat) IgG (H+L). The experimental results showed that both targets achieved good PHGDH gene knockout effects, and the knockout of PHGDH significantly inhibited the protein expression of stem cell markers SOX2 and Olig2 (such as Figure 1 (shown in a).

[0070] 2. Knockdown of PHGDH gene using DOX-inducible-shPHGDH

[0071] The Doxycycline (DOX)-inducible-shPHGDH inducible knockdown method was used to induce knockdown of the PHGDH gene in cells GSC19 and GSC29. The specific implementation steps are as follows:

[0072] 1) Construction of Tet-on-inducible-shPHGDH plasmid

[0073] (1) Design and synthesis of PHGDH shRNA primer sequences

[0074] Two PHGDH shRNA interference sequences were designed that were specific to the PHGDH gene and were verified to be suitable for the Tet-pLKO-puro vector (addgene, catalog number #21915), and were named shRNA#1 target (the targeting sequence was SEQ ID No. 4 in the sequence listing) and shRNA#2 target (the targeting sequence was SEQ ID No. 5 in the sequence listing). The designed PHGDH shRNA sequences were submitted to Invitrogen for synthesis.

[0075] shRNA #1 target sequence: CAGGACTGTGAAGGCCTTATT (SEQ ID No. 4)

[0076] shRNA#2 target sequence: CTTCGATGAAGGACGGCAAAT (SEQ ID No. 5).

[0077] The primer sequences are shown in Table 3:

[0078] Table 3. PHGDH shRNA primer sequences

[0079] Primers Nucleotide sequence (5'-3') PHGDH shRNA1# F CCGGCAGGACTGTGAAGGCCTTATTCTCGAGAATAAGGCCTTCACAGTCCTGTTTTTG PHGDH shRNA1# R AATTCAAAAACAGGACTGTGAAGGCCTTATTCTCGAGAATAAGGCCTTCACAGTCCTG PHGDH shRNA2# F CCGGCTTCGATGAAGGACGGCAAATCTCGAGATTTGCCGTCCTTCATCGAAGTTTTTG PHGDH shRNA2# R AATTCAAAAACTTCGATGAAGGACGGCAAATCTCGAGATTTGCCGTCCTTCATCGAAG

[0080] (2) PHGDH shRNA primer annealing

[0081] To ensure the effectiveness and stability of the primers, the primers synthesized by the company were first diluted to a final concentration of 10 μmol / L in aqueous solution. Subsequently, annealing treatment was performed according to the annealing system listed in Table 4.

[0082] Table 4. PHGDH shRNA annealing system

[0083] Element Volume / μL Upstream primer F 5 Downstream primer R 5 0.5mol / L NaCl 6 <![CDATA[ddH 2 The]]> 24 Total volume 40

[0084] The mixed annealing system was placed in a 95°C water bath and heated for 10 minutes, then the water bath was turned off and the system was allowed to cool naturally to room temperature to achieve the annealing process of the primers. The annealing products were stored in a 4°C refrigerator. Among them, the annealing product of PHGDHshRNA 1#F and PHGDHshRNA 1#R was marked as annealing product 1; the annealing product of PHGDHshRNA 2#F and PHGDHshRNA 2#R was marked as annealing product 2.

[0085] (3) Preparation of Tet-pLKO-puro vector skeleton

[0086] The Tet-pLKO-puro empty vector was digested by EcoR I and Age I double digestion method, and then the vector skeleton of Tet-pLKO-puro was recovered and purified.

[0087] (4) Construction of Tet-on-inducible-shPHGDH recombinant vector

[0088] The Tet-pLKO-puro vector backbone obtained in step (3) is subjected to a ligation reaction with the shPHGDH annealing product 1 and the annealing product 2 prepared in step (2). After successful ligation, the recombinant vectors with correct sequences are named Tet-on-inducible-shPHGDH1 and Tet-on-inducible-shPHGDH2, respectively. The recombinant vector has the characteristic of tetracycline (DOX)-induced expression, that is, only under the condition of adding DOX, will the specific shRNA for the PHGDH gene be expressed, thereby effectively reducing the expression level of the PHGDH gene; and under the condition of not adding DOX, the shRNA is not expressed.

[0089] 2) Virus packaging

[0090] 24 hours before transfection, 1.5×10^6 HEK293 cells were seeded into a 10 cm culture dish. Then, the lentiviral packaging plasmids psPAX2 (5 μg) and pCI-VSVG (5 μg), as well as the previously successfully constructed Tet-on-inducible-shPHGDH1 or Tet-on-inducible-shPHGDH2 plasmids, were co-transfected into HEK293 cells using the calcium phosphate transfection method. 12 hours after the transfection was completed, the culture medium was replaced with NBM complete medium. After the cells were cultured for another 72 hours, the cell supernatant containing the virus was collected and the cell debris was removed by centrifugation at 3000 rpm for 3 minutes. Subsequently, the supernatant was filtered using a 0.45 μm filter to remove residual impurities and cell debris. The filtered viruses (referred to as Tet-on-inducible-shPHGDH1 virus and Tet-on-inducible-shPHGDH2 virus) were collected and stored at -80°C for subsequent experiments.

[0091] 3) Infection, screening and verification of knockdown effect

[0092] 1.5×10^6 GSC (GSC19 or GSC29 cell line) cells were inoculated in a 10 cm culture dish, and 5 mL of Tet-on-inducible-shPHGDH1 or Tet-on-inducible-shPHGDH2 virus supernatant was added, and then the volume was filled to 10 mL with NBM complete medium. After the cells were cultured in the incubator for 48 hours, they were digested into single cells with Accutase enzyme, and then resuspended with NBM complete medium containing 1 μg / mL puromycin to screen for successfully infected positive cells.

[0093] Next, the positive cells screened were divided into two groups: a control group (DOX-) and an induced knockdown PHGDH group (DOX+). The control group did not add Doxycycline (DOX), while the induced knockdown PHGDH group added DOX to the system every two days to a final concentration of 100 ng / mL. After six days of continuous culture, cell samples were collected and the induced knockdown effect of PHGDH was detected using the Western Blot method.

[0094] To facilitate subsequent analysis, the cells obtained by knocking out the PHGDH gene with targets #1 and #2 in GSC19 were named GSC19-shPHGDH#1 and GSC19-shPHGDH#2, respectively; similarly, the cells obtained by knocking out the PHGDH gene with targets #1 and #2 in GSC29 were named GSC29-shPHGDH#1 and GSC29-shPHGDH#2, respectively. The transfected cells were labeled as GSC19DOX-shPHGDH and GSC29 DOX-shPHGDH, respectively. The cells treated with DOX were labeled as GSC19DOX+ and GSC29 DOX+, respectively, while the untreated cells were labeled as GSC19 DOX- and GSC29 DOX-, respectively.

[0095] Western Blot was used to detect the expression of PHGDH and stem cell markers SOX2 and Olig2 in cells after DOX-induced knockdown of PHGDH, and cells not treated with DOX were used as controls. The experiment used GAPDH as an internal reference, and the primary antibodies were PHGDH antibody, SOX2 antibody, Olig2 antibody and PAGDH antibody, and the secondary antibody was Peroxidase-conjugated Goat (or Donkey) Anti-Rabbit (or Anti-Mouse, Anti-Goat) IgG (H+L). The experimental results showed that after six days of DOX treatment, the expression of PHGDH protein was significantly reduced, and this knockdown could inhibit the protein expression of stem cell markers SOX2 and Olig2 (such as Figure 1(as shown in b).

[0096] 2. In vivo induction knockdown of PHGDH gene combined with IR for glioma treatment

[0097] Immunodeficient mice: BALB / c-nu (Hubei Beient Biotechnology Co., Ltd.), 4 weeks old, weighing 15-17 g.

[0098] 1. GSC19 DOX-shPHGDH

[0099] Cells: GSC19 DOX-shPHGDH from step 1.

[0100] In the process of constructing a glioblastoma (GBM) transplant tumor model, Neurobasal Medium (NBM, Thermo Fisher, Cat. No. 12348-017) was first used as the basal culture medium, and the GSC19DOX-shPHGDH cells prepared in step 1 were diluted and injected in situ into the right frontal lobe of the skull of immunodeficient mice. The number of cells injected into each mouse was 5×10^4. Subsequently, the growth of the tumor was monitored in real time every week from the date of injection (D1) using in vivo imaging technology.

[0101] When the tumor grew to the predetermined size (7th day after injection, D7), the mice were randomly divided into four groups: control group (Ctrl), radiotherapy group (IR), DOX-induced PHGDH knockdown group (DOX), and DOX combined with radiotherapy group (DOX+IR), each group containing 6 mice.

[0102] The treatment measures for each group are as follows:

[0103] Control group (Ctrl): mice maintained normal drinking water.

[0104] Radiotherapy group (IR): Radiotherapy was performed using RS2000 series biological X-ray irradiator (RAD SOURCE, USA). The first radiotherapy was performed on the 7th day after injection, and then radiotherapy was performed every 7 days, with each dose of 3 Gy, for a total of three radiotherapy sessions with a total dose of 9 Gy.

[0105] DOX-induced PHGDH knockdown group (DOX): Doxycycline (DOX, MCE, catalog number HY-N0565A) was added to the drinking water at a concentration of 2 mg / ml, and the mice were allowed to drink freely.

[0106] DOX combined with radiotherapy group (DOX+IR): DOX (same concentration as above) was added to the drinking water, and the mice drank freely and received radiotherapy at the same time. The radiotherapy regimen was the same as that of the IR group.

[0107] During the experiment, in vivo imaging technology was used to continuously observe tumor growth, and the Luciferase fluorescence readings and mouse survival were recorded.

[0108] 2. GSC29 DOX-shPHGDH

[0109] Referring to the method in step 1, GSC29 DOX-shPHGDH was replaced with GSC19 DOX-shPHGDH cells in step 1. Grouping was performed on the 9th day after cell injection, and each group was treated according to the treatment measures of the corresponding group in step 1. The effect of PHGDH gene knockout combined with IR in the treatment of glioma was detected, and tumor growth was observed in real time using in vivo imaging, and Luciferase fluorescence readings and the survival of tumor-bearing mice were recorded. The details are as follows:

[0110] The GSC29 DOX-shPHGDH cells prepared in step 1 were diluted and injected orally into the right frontal lobe of the skull of immunodeficient mice. The number of cells injected into each mouse was 5×10^4. Subsequently, the growth of the tumor was monitored in real time every week from the day of injection (D1) using in vivo imaging technology.

[0111] When the tumor grew to the predetermined size (9th day after injection, D9), the mice were randomly divided into four groups: control group (Ctrl), radiotherapy group (IR), DOX-induced PHGDH knockdown group (DOX), and DOX combined with radiotherapy group (DOX+IR), each group containing 6 mice.

[0112] The treatment measures for each group are as follows:

[0113] Control group (Ctrl): mice maintained normal drinking water.

[0114] Radiotherapy group (IR): Radiotherapy was performed using RS2000 series biological X-ray irradiator (RAD SOURCE, USA). The first radiotherapy was performed on the 9th day after injection, and the second and third radiotherapy were performed on the 16th and 23rd days after injection, respectively. The dose of each treatment was 3 Gy, and a total of three radiotherapy treatments were performed with a total dose of 9 Gy.

[0115] DOX-induced PHGDH knockdown group (DOX): Doxycycline (DOX, MCE, catalog number HY-N0565A) was added to the drinking water at a concentration of 2 mg / ml, and the mice were allowed to drink freely.

[0116] DOX combined with radiotherapy group (DOX+IR): DOX (same concentration as above) was added to the drinking water, and the mice drank freely and received radiotherapy at the same time. The radiotherapy regimen was the same as that of the IR group.

[0117] During the experiment, in vivo imaging technology was used to continuously observe tumor growth, and the Luciferase fluorescence readings and mouse survival were recorded.

[0118] 3. Results Analysis

[0119] The results showed that: in the IR alone treatment group, compared with the control group, although the tumor growth was inhibited to a certain extent, the effect was not significant, and the effect of prolonging the survival of mice was not obvious. This finding is consistent with the phenomenon that some clinical glioma patients are insensitive to radiotherapy; for the DOX group, the inhibitory effect on tumor growth was more obvious, and the survival period of mice was also prolonged; the most striking was the DOX+IR combined treatment group, in which the tumor growth of tumor-bearing mice was significantly inhibited and the survival period was significantly prolonged ( Figure 2 (shown in af).

[0120] The experimental data of each group of mice injected with GSC19 Dox-shPHGDH were analyzed as follows: On the 7th day after injection, there was no significant difference in the tumor size of each group. However, as time went on, on the 14th day, the Lucifer values ​​(unit: p / s / cm2 / sr) of the tumor in vivo imaging of the control group, IR group, DOX group and DOX+IR combined treatment group were 2642166.67±370638.77, 1560666.67±149584.02, 1058766.67±38306.60 and 602333.33±43780.40, respectively, showing a significant inhibitory effect of the DOX+IR combined treatment group on tumor growth. On the 21st day, the inhibitory effect was more significant, with Lucifer values ​​of 58813333.33±6382594.91, 26800000±3324962.16, 15390333.33±3028970.14, and 2166833.33±249161.45, respectively, indicating that the DOX+IR combined treatment group can significantly reduce tumor volume. At the same time, after GSC19 Dox-shPHGDH injection, the median survival time of mice in the DOX+IR combined treatment group reached 66.5 days, which was significantly longer than that of the control group (32 days), IR group (43 days), and DOX group (46 days).

[0121] For the groups of mice injected with GSC29 Dox-shPHGDH, there was no significant difference in tumor size among the groups on day 9. However, on day 16, the Lucifer values ​​of the control group, IR group, DOX group, and DOX+IR combined treatment group were 3507800±825612.59, 1284860±313052.22, 1353800±254580.13, and 325520±43111.84, respectively, which once again verified the significant inhibitory effect of DOX+IR combined treatment on tumor growth. By day 23, the Lucifer values ​​were 627500000±108900000, 64284000±7660285.63, 55224000±13330000, and 4693620±1499794.92, respectively, further confirming the significant effect of DOX+IR combined treatment. In terms of survival, after GSC29 Dox-shPHGDH injection, the median survival of mice in the DOX+IR combined treatment group reached 57.5 days, which was significantly longer than that in the control group (29 days), IR group (39.5 days) and DOX group (41.5 days).

[0122] 4. Slice analysis

[0123] When the mice were close to the end of life, the whole brain tissues of GSC19 Dox-shPHGDH and GSC29 Dox-shPHGDH groups were collected, sectioned and fluorescently stained for the apoptosis marker Cleaved-Caspase 3. The Cleaved-Caspase 3 antibody used in this experiment was a product of Proteintech, with the catalog number 19677-1-AP.

[0124] The analysis results showed that the proportion of apoptotic tumor cells in both the GSC19 Dox-shPHGDH and GSC29 Dox-shPHGDH models increased compared with the control group. Most notably, the proportion of apoptotic tumor cells in the DOX+IR combined treatment group increased significantly ( Figure 3 (a and b). Specifically, in the GSC19 Dox-shPHGDH model, the percentages of Cleaved-Caspase 3-positive cells in the control group, IR group, DOX group, and DOX+IR combined treatment group were 1.70±0.64%, 13.56±0.87%, 13.36±1.58%, and 30.54±1.71%, respectively. Similarly, in the GSC29 Dox-shPHGDH model, the corresponding percentages in each group were 2.50±0.53%, 10.54±1.19%, 10.32±1.59%, and 28.08±1.90%, respectively.

[0125] These data suggest that the loss of PHGDH can significantly enhance the sensitivity of GBM xenografts to radiotherapy, thereby improving the therapeutic effect. Therefore, PHGDH is a potential target for the treatment of GBM patients.

[0126] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. Application of substances that inhibit PHGDH gene expression or knock out PHGDH gene in the preparation of brain tumor radiotherapy sensitizers.

2. Use of substances that inhibit PHGDH gene expression or knock out PHGDH gene in the preparation of products for treating and / or preventing brain tumors.

3. Use of a system in the preparation of a product for treating and / or preventing brain tumors, the system comprising a substance that inhibits PHGDH gene expression or knocks out PHGDH gene and a radiotherapy device.

4. The use according to any one of claims 1 to 3, characterized in that: The substance for inhibiting PHGDH gene expression or knocking out PHGDH gene is a PHGDH gene-specific shRNA, or a substance for reducing PHGDH gene expression using PHGDH gene-specific shRNA, or a substance for knocking out PHGDH gene using CRISPR / Cas9 gene knockout system.

5. Application of substances that reduce the content or activity of PHGDH protein in the preparation of brain tumor radiotherapy sensitizers.

6. Use of a substance that reduces the content or activity of PHGDH protein in the preparation of a product for treating and / or preventing brain tumors.

7. Use of a system in preparing a product for treating and / or preventing brain tumors, the system comprising a substance that reduces the content or activity of PHGDH protein and a radiotherapy device.

8. The use according to any one of claims 1 to 7, characterized in that: The brain tumor is a glioma.

9. A brain tumor radiotherapy sensitizer containing a substance that inhibits PHGDH gene expression or knocks out PHGDH gene, or a substance that reduces the content or activity of PHGDH protein.

10. Products for treating and / or preventing brain tumors, consisting of substances that inhibit PHGDH gene expression or knock out PHGDH gene and radiotherapy devices, or substances that reduce PHGDH protein content or activity and radiotherapy devices.

Images