A high specific activity alginate lyase mutant and its application

Abstract

The present invention relates to the technical fields of genetic engineering and protein engineering modification, and particularly relates to a high-specific-activity alginate lyase mutant and its application. The alginate lyase mutant provided by the present invention has a significantly higher specific activity than the wild-type alginate lyase under the low-temperature condition of 40°C, achieving an unexpected technical effect. It can be widely used in the field of seaweed processing, effectively improving the enzymatic hydrolysis efficiency of seaweeds such as Sargassum and Ascophyllum nodosum, and having a broad market prospect.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering and protein engineering modification, and specifically relates to a high specific activity alginate lyase mutant and its application. Background Art

[0002] Brown algae mainly consist of alginate, laminarin, mannitol, fucoidan, etc. Among them, alginate is an anionic polysaccharide derived from the cell wall of brown algae, and is the main structural component in brown algae, also known as sodium alginate or alginic acid sodium. The first problem to be solved in the utilization of brown algae is the utilization of alginate.

[0003] The degradation methods of alginate mainly include: (1) Chemical degradation. Acid, hydrothermal or alkali pretreatment has been used for the hydrolysis of alginate. Acid hydrolysis is relatively commonly used in chemical degradation, but alginate is relatively acid-resistant and it is difficult to control the production of uronic acid. In addition, high concentrations of acid are required to obtain a high yield of uronic acid. (2) Hydrothermal pretreatment. Alginate can produce alginate monomers (mannuronate and guluronate) through hydrothermal treatment (180 - 240 °C), and at the same time produce substances such as lactic acid and glycolic acid. (3) Enzymatic degradation. Enzymatic degradation of alginate has mild conditions, a controllable process, a high yield, is green and safe, environmentally friendly, has a clear action mechanism, and the products are determined. Different enzyme preparations with substrate specificity can be selected singly or in combination according to the requirements of specific target products. Endo-type alginate lyase produces alginate oligosaccharides with different DPs, while exo-type enzymes degrade alginate or alginate oligosaccharides to produce monosaccharides.

[0004] The production of alginate lyase mostly relies on alginate-decomposing bacteria. Although wild-type alginate-decomposing bacteria can effectively obtain a quantitative amount of enzyme protein, the yield is very low and the cost is high, making it difficult to meet the requirements of practical applications. Therefore, using genetic engineering means to heterologously express the alginate lyase gene is the most effective way to increase the yield of alginate lyase. The research mainly focuses on the cloning of the alginate lyase gene from alginate-decomposing bacteria and its overexpression in Bacillus subtilis. At present, the alginate lyase genes of more than twenty alginate-decomposing bacteria have been cloned, and most of these genes have been successfully heterologously expressed. The expression levels of recombinant alginate lyases are all higher than those of wild strains. According to the classification of the CAZY database, alginate lyase belongs to polysaccharide-degrading enzymes (PL), and is specifically divided into seven families: PL5, PL6, PL7, PL14, PL15, PL17, and PL18.

[0005] In recent years, with the wide application of protein engineering modification technology in the field of enzyme preparations, the development of new alginate lyases with high enzyme activity levels and excellent properties has become a research hotspot in this field, which is of great significance for reducing the production cost of alginate lyase and promoting the industrialization of alginate lyase. Summary of the Invention

[0006] The present invention provides an alginate lyase mutant and its application to solve the problems of the prior art. The specific activity of the mutant is significantly improved compared with that of the wild type, which is beneficial to its wide application in industrial fields such as seaweed processing.

[0007] On the one hand, the present invention relates to an alginate lyase mutant, wherein the 15th amino acid of the alginate lyase with the amino acid sequence of SEQ ID NO: 1 is mutated from Pro to Cys.

[0008] The present invention also relates to a DNA molecule encoding the above-mentioned alginate lyase mutant.

[0009] The present invention also relates to a recombinant expression plasmid containing the above DNA molecule.

[0010] The present invention also relates to a host cell containing the above recombinant expression plasmid.

[0011] When the above plasmid is transferred into a host cell, the specific activity of the recombinantly expressed alginate lyase mutant is significantly improved.

[0012] In some embodiments of the present invention, the host cell is Bacillus subtilis ( Bacillus subtilis ).

[0013] Compared with the wild-type alginate lyase AH1, the P15C single-point mutant provided by the present invention has a 63.6% increase in specific activity at a low temperature of 40 °C, up to 228.2 U / mg, achieving an unexpected technical effect.

[0014] The alginate lyase mutant developed by the present invention has a significantly improved specific activity under low temperature conditions and can be widely used in the field of seaweed processing, effectively improving the enzymatic hydrolysis efficiency of seaweeds such as Sargassum and Ascophyllum nodosum, and having broad market prospects. Detailed Embodiments

[0015] The following further illustrates the method of the present invention with reference to examples. For experimental methods where specific conditions are not indicated in the examples, they can generally be carried out under conventional conditions, such as the conditions described in "Molecular Cloning: A Laboratory Manual" written by J. Sambrook et al., or according to the conditions recommended by the manufacturer. Those skilled in the relevant art can better understand and master the present invention with the help of the examples. However, the methods for implementing the present invention should not be limited to the specific method steps described in the embodiments of the present invention.

[0016] The present invention will be described in detail below in conjunction with the specific embodiments.

[0017] Example 1 Screening of Alginate Lyase Mutants

[0018] The amino acid sequence of the wild-type alginate lyase AH1 is SEQ ID NO:1, and the coding nucleotide sequence is SEQ ID NO:2.

[0019] To improve the specific activity of alginate lyase AH1, the applicant analyzed its protein structure. This protein is an alginate lyase of the PL7 family, and its structure is a β-jelly roll structure. Both the protein surface and the active center of the protein are exposed to the external environment. Therefore, it is considered that changes in the external environment can directly affect the stability of the enzyme's active center. Without destroying the protein secondary structure and the active center, the applicant further mutated this gene.

[0020] Primer AH1-ss-F: CGG GGTACC ATGGATCCGAATCTGGAGATTT (SEQ ID NO:3);

[0021] Primer AH1-ss-R: CG ACGCGT TTAATCATGTGTATGTTCCAGGC (SEQ ID NO:4).

[0022] Using the AH1 gene as a template, PCR amplification was performed with the above primers using the GeneMorph II Random Mutagenesis PCR Kit (Bioline). The PCR products were recovered by gel electrophoresis, digested with KpnI and MluI, and ligated to the expression plasmid pSZX101 digested with the same enzymes. The ligation products were transformed into Escherichia coli DH5α, and the cells were spread on LB+Amp plates and cultured upside down at 37°C. After the transformants appeared, the plasmids were extracted and transformed into Bacillus subtilis. After the transformants grew out, they were picked one by one with toothpicks into 48-well plates, and 20 μg / ml kanamycin was added to each well. The cells were cultured at 37°C and 500 rpm for about 48 h. The supernatants were collected by centrifugation for high-throughput determination. The alginate lyase activity and protein content were measured at 37°C, and the specific activities of different mutants were calculated.

[0023] The experimental results showed that the specific activities of some mutants increased, while those of some mutants became lower; in addition, there were some mutations that, although they could increase the specific activity of alginate lyase, their enzymatic properties changed significantly after mutation, and these did not meet the requirements. Finally, the applicant screened a mutation site, P15C, that could significantly increase the specific activity of alginate lyase without significantly affecting its original enzymatic properties.

[0024] Based on alginate lyase AH1, the present invention provides a mutant containing a single mutation site of P15C. Referring to the amino acid sequence of the mutant, the coding nucleotide sequence of the alginate lyase mutant was obtained.

[0025] Example 2 Expression of Alginate Lyase Mutant in Bacillus subtilis

[0026] According to the codon preference of Bacillus, the gene sequences of alginate lyase AH1 and its mutants were optimized and synthesized respectively, and two restriction enzyme sites, KpnI and MluI, were added to the 5' and 3' ends of the synthesized sequences.

[0027] 2.1 Plasmid Construction

[0028] The synthesized alginate lyase gene fragment was obtained by PCR. The obtained gene fragment and the expression plasmid pSZX101 were digested with KpnI and MluI respectively, and the target fragments were recovered by gel electrophoresis. The ligation was carried out overnight with T4 ligase. The ligation product was transformed into competent Escherichia coli DH5α, spread on an LB + Amp plate, and single colonies grew after culturing overnight at 37°C. The transformants with correct ligation were verified by colony PCR, and the plasmids were extracted and sent to Beijing Genomics Institute for sequencing analysis.

[0029] The plasmid was purified from the Escherichia coli clone with correct sequencing results using a midiprep kit (Axygen).

[0030] 2.2 Preparation and Transformation of Competent Bacillus subtilis

[0031] The transformation solution was prepared as follows

[0032] 1× Minimal salt solution: K 2 HPO 4 7 g, KH 2 PO 4 3 g, (NH 4 ) 2 SO 4 1 g, trisodium citrate Na 2 C 6 H 5 O 7 ·2H 2 O 0.5 g, MgSO 4 ·7H 2 O 0.1 g, add water to 500 mL.

[0033] GMⅠ solution: 95.6 mL of 1× minimal salt solution, 2.5 mL of 20% glucose, 0.4 mL of 5% casein hydrolysate, 1 mL of 10% yeast extract.

[0034] GMⅡ solution: 96.98 mL of 1× minimal salt solution, 2.5 mL of 20% glucose, 0.08 mL of 5% casein hydrolysate, 0.04 mL of 10% yeast extract, 0.25 mL of 1 M MgCl 2 0.25 mL, 1 M CaCl 20.05 mL。

[0035] Transformation operation method: Inoculate the bacteria on an LB plate and culture overnight at 37°C. Pick up a loopful of bacterial lawn with an inoculation loop and inoculate it into 5 mL of GMⅠ solution, and culture it overnight with slow shaking (125 rpm) at 30°C. The next day, transfer 2 mL to 18 mL of GMⅠ and culture it with fast shaking (220 rpm) at 37°C for 3.5 h. Then transfer 5 mL of the culture solution from the previous step to 45 mL of GMⅡ and culture it with slow shaking (125 rpm) at 37°C for 90 min, and then centrifuge at 8000 g for 10 min to collect the bacterial cells. Gently suspend the bacterial cells with 5 mL of the original culture supernatant. The suspended bacterial cells are competent cells and can be used for transformation. Preservation of competent cells: Add sterilized glycerol at 30% to a final concentration of 10%, mix well, aliquot into centrifuge tubes, and immediately store at -70°C.

[0036] Mix 1 μg of the recombinant plasmid evenly with 200 μL of the above-mentioned competent cells, resuscitate by shaking (200 rpm) at 37°C for 30 min, and then spread it on the corresponding resistant medium and culture overnight at 37°C. The single colonies grown overnight are the engineered strains containing alginate lyase and its mutants.

[0037] Example 3 Fermentation verification

[0038] Inoculate the engineered strain into 5 mL of LB (0.5% yeast extract powder, 1% tryptone, 1% sodium chloride) medium and culture at 220 rpm for about 6 - 8 h at 37°C, then transfer it to 50 mL of liquid fermentation medium (0.5% yeast extract powder, 0.5% tryptone, 1% glucose, K 2 HPO 4 1.8%), and perform shake flask fermentation at 220 rpm at 37°C for 72 h. Then centrifuge at 5000 g for 10 min to collect the supernatant, and the fermentation supernatant containing alginate lyase and its mutants is obtained. Detect the enzyme activity and protein content of alginate lyase in the fermentation supernatant respectively, and calculate the specific activity.

[0039] 3.1 Determination of alginate lyase enzyme activity

[0040] Principle of alginate lyase enzyme activity determination: Alginate lyase can cleave the glycosidic bond in the alginate molecule through a β-elimination reaction, generating an unsaturated double bond at the non-reducing end, with the double bond located between C4 and C5 at the non-reducing end of the product, and producing the maximum ultraviolet absorption at 235 nm.

[0041] (1) Definition of enzyme activity unit:

[0042] Under the conditions of 40 °C and pH 7.0, in the reaction system specified by this method, the substrate sodium alginate is degraded per minute to produce unsaturated double bonds. At 235 nm, an increase in absorbance of 0.1 is defined as 1 enzyme activity unit U.

[0043] (2)Determination method

[0044] Dilute to an appropriate multiple with buffer solution, and control the absorbance OD 235 to be between 0.22 - 0.35, and the enzyme activity is approximately 0.5 U / mL.

[0045] Enzyme reaction: Take three 15 mm * 150 mm test tubes, add 1.8 mL of substrate, preheat in a water bath at 40 °C for 5 min, add 0.2 mL of the diluted enzyme solution, accurately time, vortex, incubate at 40 °C for 10 min, take the test tubes out of the water bath and immediately add 2 mL of phosphoric acid termination solution, vortex, and place the test tubes on the test tube rack outside the water bath.

[0046] Blank: Take a 15 mm * 150 mm test tube, add 1.8 mL of substrate, preheat in a water bath at 40 °C for 5 min, add 0.2 mL of buffer solution, accurately time, vortex, incubate at 40 °C for 10 min, take the test tubes out of the water bath and immediately add 2 mL of phosphoric acid termination solution, vortex, and place the test tubes on the test tube rack outside the water bath.

[0047] 3.2 Protein content determination

[0048] The Coomassie Brilliant Blue (Bradford) binding method for determining protein content is a composite method combining colorimetry and pigment method. Coomassie Brilliant Blue G - 250 is brown - red in acidic solution and turns blue when combined with proteins, and it conforms to Beer's law within a certain protein concentration range. It can be colorimetrically determined at 595 nm. A large amount of absorption occurs within 3 - 5 minutes and remains stable for at least 1 hour. Within the range of 10 - 1000 μg / mL, the absorbance is proportional to the protein concentration.

[0049] Mix according to the volume ratio of enzyme solution to Coomassie Brilliant Blue solution of 1:5, let stand for 10 min, and determine the protein content by the Coomassie Brilliant Blue (Bradford) binding method.

[0050] 3.3 Calculation of specific activity

[0051] "Specific Activity" refers to: the number of enzyme activity units per unit weight of protein, generally expressed as U / mg protein. Generally speaking, the higher the specific activity of an enzyme, the purer the enzyme.

[0052] Specific activity calculation formula: Specific activity (U / mg) = Enzyme activity (U / mL) / Protein content (mg / mL).

[0053] The specific activity of the fermentation supernatant of the engineered Bacillus subtilis strain expressing the recombinant alginate lyase AH1 and its mutants constructed in the present invention at 40 °C is shown in Table 1.

[0054] Table 1 Specific activities of alginate lyase and its mutants

[0055] Alginate lyase Specific activity (U / mg) Wild-type AH1 139.5 P15C single-point mutant 228.2

[0056] As can be seen from the data in Table 1, compared with the wild-type alginate lyase AH1, the specific activity of the P15C single-point mutant provided by the present invention at 40 °C has increased by 63.6%, up to 228.2 U / mg, achieving an unexpected technical effect. This indicates that the P15C mutation site provided by the present invention can significantly improve the specific activity of alginate lyase AH1 at 40 °C.

[0057] In summary, the specific activity of the alginate lyase mutants developed in the present invention has been significantly improved under low-temperature conditions, and can be widely used in the field of seaweed processing to effectively improve the enzymatic hydrolysis efficiency of seaweeds such as Sargassum and Ascophyllum nodosum, with broad market prospects.

Claims

1. An alginate lyase mutant, characterized in that: The mutant is an alginate lyase with an amino acid sequence of SEQ ID NO: 1, in which the 15th amino acid is mutated from Pro to Cys.

2. A DNA molecule encoding the alginate lyase mutant according to claim 1.

3. A recombinant expression plasmid comprising the DNA molecule of claim 2.

4. A host cell, characterized in that The host cell comprises the recombinant expression plasmid according to claim 3.

5. The host cell according to claim 4, characterized in that The host cell is Bacillus subtilis ( Bacillus subtilis ).