Porcine ZC3HAV1 gene and application of SNP (Single Nucleotide Polymorphism) marker of regulatory region of porcine ZC3HAV1 gene in resisting porcine circovirus

Abstract

The invention discloses an application of a porcine ZC3HAV1 gene and a regulatory region SNP (Single Nucleotide Polymorphism) marker of the porcine ZC3HAV1 gene in resisting porcine circovirus, and belongs to the technical field of molecular genetics. According to the present invention, the first research discovers that the overexpression of the ZC3HAV1 gene can inhibit the replication of PCV2 in the porcine macrophage line, such that the new path is provided for the prevention and treatment of the porcine circovirus disease; a further research discovers that T / C nucleotide polymorphism exists at the site 1859 of the 5'regulatory region of the ZC3HAV1 gene, and the transcriptional activity of the ZC3HAV1 gene can be enhanced by mutating the nucleotide at the site 1859 of the 5 'regulatory region of the ZC3HAV1 gene from T to C; due to the fact that stable expression of the ZC3HAV1 is consistent with that of porcine circovirus disease resistance, by detecting the molecular marker, pigs with high expression of the ZC3HAV1 are selected to establish a base group for breeding, and the molecular marker has important significance on improving the circovirus disease resistance of pig groups.

Description

Technical Field

[0001] The invention relates to the technical field of molecular genetics, and in particular to application of porcine ZC3HAV1 gene and SNP markers in its regulatory region in resistance to porcine circovirus. Background Art

[0002] Porcine circovirus (PCV) is a small single-stranded circular DNA virus belonging to the Circoviridae family and the Circovirus genus. It was first discovered by Tischer et al. in the porcine kidney cell line PK-15 and was officially named porcine circovirus in 1982 (Tischer et al., 1982). There are currently four main types of PCV known at home and abroad, which are named PCV1 to PCV4 in the order of their discovery. Among them, PCV2 has been widely studied at home and abroad due to its global distribution and high pathogenicity (Opriessnig T et al., 1982). According to epidemiological surveys, the PCV2 positivity rate in 127 large-scale pig farms in eight provinces in my country, including Shandong, Hebei, Hunan, and Fujian, was as high as 59% from 2017 to 2021 (Huang Ying et al., 2023). Porcine circovirus type 2 (PCV2) mainly infects piglets aged 5 to 10 weeks and is the main pathogen causing post-weaning multisystemic wasting syndrome (PMWS). The virus preferentially targets lymphoid tissue, causing lymphatic failure and immunosuppression in pigs, which in turn causes secondary infection and mixed infection with other pathogens. Clinical manifestations include progressive weight loss, systemic lymphadenopathy, coughing, and fever, causing huge economic losses to the pig industry and seriously restricting its development (Xia Deli et al., 2020).

[0003] CCCH-type zinc finger antiviral protein (ZC3HAV1), referred to as ZAP, is a host restriction factor that can inhibit viral gene expression and viral replication by promoting viral mRNA degradation, inhibiting viral mRNA translation, and interacting with viral proteins (Fang et al., 2012; Zhu et al., 2012). The human ZAP protein is encoded by the ZC3HAV1 gene, and there are four splice variants, among which the full-length ZAP (ZAPL) and truncated ZAP (ZAPS) have been studied more deeply. The N-terminus of ZAPL and ZAPS both contain four conserved CCCH zinc finger domains, and the downstream contains TPH and WWE domains, but the C-terminus of ZAPL contains one more poly ADP ribose polymerase (PARP) domain than ZAPS. The zinc finger domain at the N-terminus of ZAP can specifically bind to the ZAP-sensitive element (ZRE) in viral RNA, and promote the degradation of viral mRNA from multiple points by recruiting 5′ and 3′ mRNA degradation-related proteins, such as exosomes, DCP1 / DCP2, PARN, etc. (Chen G et al., 2008); it can also inhibit the translation of viral mRNA by directly binding to the UTR region of viral mRNA or interfering with the interaction between the translation initiation factor stem eIF4G and eIF4A (Zhu Y et al., 2012). ZAP can also bind to the non-structural protein NSP9 of porcine reproductive and respiratory syndrome virus (PRRSV), thereby hindering the synthesis of viral RNA (Zhao Y et al., 2019). ZAP was first shown to inhibit the replication of Monillo murine leukemia virus. With the deepening of research, it has been shown that it can also inhibit other RNA viruses and a few DNA viruses, including alpha virus, Sindbis virus, Ebola virus, hepatitis B virus, etc. (Fehr AR et al., 2020). Among them, constitutively expressed ZAPL is the main effector that directly inhibits viral replication, while the expression of ZAPS is induced by interferon, and it can target the 3′UTR of IFNL1-3 mRNA to weaken the inflammatory response downstream of IFN (Schwerk J et al., 2019). However, there are relatively few studies on the porcine ZC3HAV1 gene, and there are no reports on the porcine ZC3HAV1 gene in inhibiting PCV2. Summary of the invention

[0004] In view of the above-mentioned prior art, the purpose of the present invention is to provide an application of porcine ZC3HAV1 gene and SNP markers in its regulatory region in resistance to porcine circovirus.

[0005] To achieve the above object, the present invention adopts the following technical solutions:

[0006] In a first aspect, the present invention provides the use of porcine ZC3HAV1 gene in preparing a product for inhibiting porcine circovirus replication; the nucleotide sequence of the porcine ZC3HAV1 gene is shown in SEQ ID NO.1.

[0007] Preferably, the porcine circovirus is PCV2.

[0008] The present invention found that overexpression of porcine ZC3HAV1 gene can inhibit the replication of PCV2, providing a new path for the prevention and treatment of porcine circovirus disease.

[0009] In a second aspect of the present invention, a SNP marker in the 5′ regulatory region of the porcine ZC3HAV1 gene is provided, wherein the nucleotide sequence of the SNP marker is shown in SEQ ID NO.2; the sequence shown in SEQ ID NO.2 is a polymorphic site at position 1107 from the 5′ end, and the nucleotide thereof is T or C.

[0010] The polymorphic site of the SNP marker of the present invention is located at the -1859 site of the 5' regulatory region of the pig ZC3HAV1 gene, which is marked by the start codon (ATG, +1) and is 1859 bp upstream of the start codon.

[0011] The third aspect of the present invention provides the use of the above-mentioned SNP marker in regulating the transcriptional activity of the porcine ZC3HAV1 gene.

[0012] In the above application, the transcription activity of the ZC3HAV1 gene whose polymorphic site of the SNP marker is a C nucleotide is higher than the transcription activity of the ZC3HAV1 gene whose polymorphic site is a T nucleotide.

[0013] A fourth aspect of the present invention provides a method for increasing the transcriptional activity of the porcine ZC3HAV1 gene, comprising the following steps:

[0014] The nucleotide at position -1859 in the 5′ regulatory region of the porcine ZC3HAV1 gene was mutated from T to C.

[0015] In a fifth aspect of the present invention, there is provided a primer for detecting the above-mentioned SNP marker in the breeding of pigs resistant to porcine circovirus; the nucleotide sequences of the primers are shown in SEQ ID NO.3 and SEQ ID NO.4 respectively; specifically as follows:

[0016] ZC3HAV1F: 5′-CCGCTCGAGCGAATCCGACTAAGAACCA-3′; (SEQ ID NO.3)

[0017] ZC3HAV1R: 5′-CATGCCATGGCTCCCTGCGCTGGCC-3′. (SEQ ID NO.4)

[0018] Based on the research of the present invention, it is found that high expression of ZC3HAV1 gene is related to pig resistance to porcine circovirus disease. By screening pigs containing C nucleotide alleles through the above SNP markers for breeding, individuals with high expression of ZC3HAV1 gene can be obtained, which is of great significance for improving the resistance of pigs to porcine circovirus disease.

[0019] Beneficial effects of the present invention:

[0020] (1) The present invention is the first to discover that overexpression of the ZC3HAV1 gene can inhibit the replication of PCV2 in porcine macrophage cell lines, providing a new path for the prevention and treatment of porcine circovirus disease.

[0021] (2) The present invention further discovered that there is a T / C nucleotide polymorphism at the -1859 position in the 5′ regulatory region of the ZC3HAV1 gene. Mutating the nucleotide at the -1859 position in the 5′ regulatory region of the ZC3HAV1 gene from T to C can enhance the transcriptional activity of the ZC3HAV1 gene. Since the stable expression of ZC3HAV1 is consistent with the resistance of porcine to circovirus disease, by detecting this molecular marker, pigs with high expression of ZC3HAV1 are selected to form a basic group for breeding, which is of great significance for improving the resistance of the pig population to circovirus disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 : Expression of ZC3HAV1 gene in the lung of pigs. LW-u: Laiwu pig control group; LW-i: Laiwu pig challenge group; YL-u: Dachang hybrid pig control group; YL-i: Dachang hybrid pig challenge group; **P<0.01.

[0023] Figure 2 :Effect of overexpression of porcine ZC3HAV1 gene on PCV2 copy number in 3D4 / 21 cells. Control: control group; ZAP OE: overexpression group. *P<0.05; **P<0.01; ***P<0.001.

[0024] Figure 3 :The effect of interfering with porcine ZC3HAV1 gene on PCV2 copy number in 3D4 / 21 cells. Control: control group; ZAP-siRNA: interference group. *P<0.05; **P<0.01; ***P<0.001.

[0025] Figure 4 :PCR amplification results of 5′ regulatory region of porcine ZC3HAV1 gene. M:DL5000 Maker.

[0026] Figure 5:Luciferase activity of different lengths of 5′ regulatory region fragments of porcine ZC3HAV1 gene. Different letters indicate significant differences (P<0.05).

[0027] Figure 6 : Results of polymorphic site detection in the 5′ regulatory region (-2449 to -1463) of the porcine ZC3HAV1 gene. LW: Laiwu pig; BY: Yorkshire pig.

[0028] Figure 7 :Luciferase activity detection of the 5′ regulatory region mutation vector of porcine ZC3HAV1 gene. Different letters indicate significant differences (P<0.05). DETAILED DESCRIPTION

[0029] It should be noted that the following detailed descriptions are illustrative and are intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present application belongs.

[0030] As mentioned above, porcine circovirus causes huge economic losses to the pig industry and seriously restricts the development of the pig industry. Therefore, it is of great significance to breed porcine circovirus-resistant pigs.

[0031] In view of this, the present invention first screened and studied genes that can improve pig resistance to porcine circovirus. The present invention found through quantitative PCR detection that the mRNA level of the porcine ZC3HAV1 gene in the lung tissue of uninfected Laiwu pigs was significantly higher than that of long-tail hybrid pigs, and was significantly downregulated in the lung tissue of Laiwu pigs infected with PCV2, suggesting that the porcine ZC3HAV1 gene may be related to resistance to porcine circovirus.

[0032] The nucleotide sequence of the coding region of the porcine ZC3HAV1 gene is shown in SEQ ID NO.1. At present, there is relatively little research on the porcine ZC3HAV1 gene. In order to further study the function of the porcine ZC3HAV1 gene, the present invention conducted overexpression and siRNA interference experiments of the porcine ZC3HAV1 gene in porcine alveolar macrophage cell lines, and the results showed that overexpression of the porcine ZC3HAV1 gene can inhibit the replication of PCV2 in porcine alveolar macrophage cell lines.

[0033] The present invention further found differences in multiple nucleotide sequences by comparing the 5′ regulatory region series of the ZC3HAV1 gene of Laiwu pigs and Yorkshire pigs. The T / C nucleotide polymorphism present at the -1859 site was further studied. Our research shows that the T nucleotide at the -1859 site of the ZC3HAV1 gene mutated to a C nucleotide, and the activity of the luciferase reporter gene was significantly upregulated, suggesting that the C nucleotide at this site has the function of enhancing the transcription of the ZC3HAV1 gene. Thus, the present invention obtained a SNP marker in the 5′ regulatory region of the pig ZC3HAV1 gene, and the nucleotide sequence of the SNP marker is shown in SEQ ID NO.2; the sequence shown in SEQ ID NO.2 is a polymorphic site at the 1107th position from the 5′ end, and its nucleotide is T or C; specifically as follows:

[0034] cgaatccgac taagaaccat gaggttgagg gttcgatccc tggcttctat cagtgggtta

[0035] aggatctggc gttgccgtga gctgtggtgt aggtcacaga tgcggctcag atctggcatt

[0036] gctgtggctc tggctctggc ataggctggc aactgtaact ctgattagac ccctagcctg

[0037] ggaacctcca tatgccatgg gctctgccgt caaaaaagac aaaagacaaa aaaaagagtt

[0038] tattgagatg agagacgctg ttaacacagt gggccaaatt cctgataatc agggagagcc

[0039] gactcagaag agaggagctt cagatgagag atgctgtact tgcacccgac gatgtgctga

[0040] tgatctgaga gagccaaggc tgaaggcatg gccatgtcca tttttttttt ttttgtcttt

[0041] ttagggctgt atttgtggca tatggaggtt cccaggctag ggattgaacc ggagctgtag

[0042] ctgctggcct acacaggttg ctcaaggtgg gggaaggggc attacagtga gaccggtggg

[0043] gtgatgctaa gggtctggtc atcacttgaa ttcagtctcc tcgaagggga cttgaagtct

[0044] aacatactct agacgccagt ctcctgtata ccctttgcag catttaatca tggatgtccc

[0045] ttacattttc atgtcttccc aaacacaagt tccttgagag cagggattat ttcgtaaact

[0046] tctgtcattt attttatttt tgctttttag ggccacaccc gaggcatacg caagttccca

[0047] gcctaggagt tgaatcggag ctacagctgc tggcctacac tacagccaca gccacgccag

[0048] atctgagctg catctgcgac cccatggctc atggcaacgc tggatcctta acccactgag

[0049] cgaggccggg gatggaacac gcatcctcat gaatagtagt cggattcgtt tcccctggac

[0050] cacagcagga acttattttg tgaacttctg tatgcccaca gagaccgact aacttatgag

[0051] ccacacaaaa gatgttatga tgaatttaat tgatttgata ttgaaagccc agaccctggg

[0052] aatctgtcag attataaatc aggcca[t / c]gtg gattaaaggt aactataaat caggccatct

[0053] gttgctataa agtaataggt agagggatga tctggttgag ctcagtttag gctggttttc

[0054] ataacaaaat ggtctatacc tgagagacgt ggttcgccaa ccaagaactg ccaatctgag

[0055] gagaacaccc agtgatcatt ttacagattt tctagtttga caactggatt ctaccattaa

[0056] aaaaaaaaa ggtttattac ctatctgatc aatgacccat ttatttcact tgggaatgtt

[0057] ggaaggaaaa aggaaaaact ttttccctcc gccacatgag tccattgatt ggatcctgca

[0058] aattaactga caatagatta acaggagaaa aggcaaaatt tatttagcat tgggcggggg

[0059] ggacttctaa taatggaaac ctccagtgaa ggactaaagt aactttatat ctctcagttt

[0060] aacaaaaggg aggtttttag gactacagtg ggagagtagg gaaggttctg ctgggcttt

[0061] tgatgctaat ggcaatggtt gatctgtctt caccgcaact gaattagcag gaaactccct

[0062] tggaaggagg ttaagggcag ctgtacgtta ggtaggttct gctttattca gatttggagc

[0063] agttcagata agatttcttt cttcatcttc tgtagctgaa acgctttcac tttaaaataa

[0064] tcctaatacc aagcctgggg gtgcaagtgg gttcccaccg aaggaaaaga tcttgtccaa

[0065] acatccgaga agaggaacct aatctcaagt cttgggatgt gtctgagcat gcccgacggt

[0066] gactgactgc tatccgatat ttagccttgt gtgggtctca gcctctgaga cacctctgtt

[0067] cgcgattata gacaggcaag aatgtgtcaa gaagcagttc ttcaaaaagc tcccgagagg

[0068] aattcccctg tggcacagca gggtaatcaa ccagcattga cagagcagcc tctctggtcg

[0069] ctgcggtggc gtaggttcga ctccgggaac ttccacatgc ctccataata taaataaaca

[0070] catacaaaaa gttatgagaa ggcaaatag gggaaagcaa taatcactgg cctttaagaa

[0071] ggcagggtgg tgtggaagaa agtgcatagc agtcccggcc aatctggagc ctgggggcca

[0072] gatttgggga acatccggct tgagggacgg ctgttgtgtg ctcaggttac ttcctcaaat

[0073] agagcgaaga taacaatatc tagctagtgc aataactagc tagtactagt tgtgaagact

[0074] caccaataca ggaggcaggg cgccggctgg gagcaagtca agggctcact cgggtctgtg

[0075] cttggcgggg atgggggggg tggtggagaa tagaagactc ctcaagaggg ctcccaagac

[0076] tcgcgttatt cgccacttgg gctggcttta aaactccctc agagccccga gatgattttt

[0077] agtttctctt ctctccgaag cagcctcgcg gtgcccagct ggggaacctg accttcgcgg

[0078] agcagagaac cgagagggag ccgtccgact gtcgccggcg gattagtccc agcctgttcg

[0079] ctctctttcc agttgctcgc cgtcgcgatt gattttaagt tgacacaagg accgggtcgg

[0080] tgcgatctgg actctcgacc caagccttgg aggaaaccga aacctccggg ctcagctaac

[0081] agcggcggag agcgcacgct cgctcgctcg ccccgggcgc gcccagcccg cgcgccgccc

[0082] gctcccgccc ccgggattct agtaagtttc gattctcccc agagcggagt cccgcgccgc

[0083] cgcggccagg ccagcgcagg gagccatg。

[0084] Note: In the sequence, "[t / c]" is a polymorphic site, which is represented by "n" in the sequence listing.

[0085] Since the stable expression of the ZC3HAV1 gene is consistent with porcine resistance to circovirus disease, detecting this molecular marker and selecting pigs with high expression of ZC3HAV1 to form a basic group for breeding is of great significance for improving the anti-circovirus disease characteristics of the pig population.

[0086] In order to enable those skilled in the art to more clearly understand the technical solution of the present application, the technical solution of the present application will be described in detail below in conjunction with specific embodiments.

[0087] The test materials used in the examples of the present invention are all conventional test materials in the art and can be purchased through commercial channels. Experimental methods without detailed conditions are carried out according to conventional test methods or the operating instructions recommended by the supplier.

[0088] Example 1: Expression of porcine ZC3HAV1 gene in porcine lung tissue

[0089] 1. Test method:

[0090] Thirty weaned Laiwu (LW) and Long-legged (YL) piglets of uniform body weight were randomly selected. All piglets were negative for antigens and serum antibodies to PCV1, PCV2, PRRSV, and PPV as determined by ELISA (Shandong Center for Disease Control and Prevention, Jinan, China). They were randomly divided into four groups, namely LW-i (n = 10), LW-u (n = 5), YL-i (n = 10), and YL-u (n = 5). Each piglet was raised in isolation under the same environment with free access to feed and water. The PCV2b strain used in this experiment (named PCV2-SD) was isolated from pigs infected with PMWS in Shandong Province (Zhang P et al., 2018). Each piglet in the LW-i and YL-i groups was injected intramuscularly with 3 mL (10 3.8 TCID50 / mL) of PCV2-SD strain. Each piglet in the uninfected group (LW-u and YL-u) was intramuscularly injected with 3 mL of phosphate-buffered saline (PBS). The feeding, challenge, and daily management of the piglets were approved by the Institutional Animal Care and Use Ethics Committee of Shandong Agricultural University and were carried out in accordance with the Guiding Principles for Experimental Animals of the Ministry of Science and Technology (Beijing, China).

[0091] During the experiment, clinical signs were monitored daily and piglets were weighed until 35 dpi. Anticoagulated and untreated blood samples were collected by venipuncture at 0, 4, 7, 10, 14, 21, 28 and 35 dpi. Blood samples were collected for the measurement of PCV2 virus copy number and cytokines. At 35 dpi, all piglets were killed by electric stunning in accordance with the animal management standards of Shandong Agricultural University, and the heart was bled within 15 s and tissue samples of lungs, tonsils, thymus, ileum, kidneys, spleen, liver, etc. were collected and frozen in liquid nitrogen. The pathological lesions of the organs of each pig were recorded. The remaining parts of the above organs were preserved and fixed in 10% formalin buffer for subsequent histological examination.

[0092] 2. Test results:

[0093] The expression of ZC3HAV1 gene in pig lung tissue is as follows Figure 1 As shown, the results showed that the mRNA level of porcine ZC3HAV1 gene was significantly higher in the lung tissue of uninfected Laiwu pigs than in that of large-length hybrid pigs, and was significantly downregulated in the lung tissue of Laiwu pigs infected with PCV2.

[0094] Example 2: Effect of the porcine ZC3HAV1 gene on PCV2 replication

[0095] 1. Test method:

[0096] A pair of specific primers (F: 5'-CGGAATTCTATGGCTGACCCGGGGGTGTG-3' and R: 5'-CGGGATCCCTAAGCGTAGTCTGGGACGTCGTATGGGTAACTGATCACGCAGGGTT TGT-3') were designed based on the coding region sequence of the porcine ZC3HAV1 gene sequence (NCBI Reference Sequence: NC_010460.4). EcoRI and BamHI endonuclease sites and protective bases (italicized parts) were added to the primers, and the HA tag sequence (TACCCATACGACGTCCCAGACTACGCT) was designed in the downstream primer R for subsequent protein level verification. We used the high-fidelity TksGflex TMDNA polymerase (TaKaRa) was used to amplify the coding region of ZC3HAV1 by PCR according to the instructions. After electrophoresis and purification of the PCR product, the PCR fragment and the empty pEGFP-C1 plasmid (Invitrogen) were double-digested with EcoRI and BamHI, respectively, and then connected with T4 DNA ligase (Thermo). The ligation product was transformed into competent cells DH5α, plated (containing kanamycin; 50μg / mL), picked and shaken, and plasmids were extracted. The positive plasmids after double enzyme digestion verification were sent to Shanghai Biotech for sequencing verification, and the ZC3HAV1 gene overexpression plasmid was constructed.

[0097] ZC3HAV1 gene siRNA (5'-CCAUGUCUGUGAACACUU-3') and negative control siRNA were designed and synthesized by Guangzhou RiboBio Company.

[0098] Porcine alveolar macrophage cell line (3D4 / 21) cells were donated by the State Key Laboratory of Animal Biotechnology Breeding, China Agricultural University. They were cultured and passaged in RPMI-1640 medium (Pricella) containing 10% fetal bovine serum (FBS) at 37°C and 5% CO2. 3D4 / 21 cells were plated at 1.5×10 5 The cells were inoculated in a 24-well plate at a density of 10 cells. When the cells grew to 80% density, 500 ng of ZC3HAV1 overexpression plasmid and empty pEGFP-C1 (negative control) were transfected into the cells using Lipofectamine 3000 (Invitrogen) according to the instructions. The silencing experiment was transfected with 50 μM siRNA and negative control siRNA respectively. After 6 hours of transfection, the culture medium was discarded and the cells were infected with PCV2-SD (MOI=10). After 1 hour of infection, the supernatant of these wells was replaced with RPMI-1640 medium containing 2% FBS. At the selected time point, the PCV2 viral genomic DNA in the cells was extracted using a viral genome extraction kit (TIANGEN) for copy number detection (Liu G et al., 2019). Each of the above experiments was repeated at least 3 times.

[0099] 2. Test results:

[0100] The results are as follows Figure 2 and Figure 3 As shown, the results showed that overexpression of porcine ZC3HAV1 gene can inhibit the replication of PCV2.

[0101] Example 3: Cloning of the 5′ regulatory region sequence of the porcine ZC3HAV1 gene

[0102] Genome extraction: Ear tissues of Laiwu pigs and Yorkshire pigs were taken, and genomic DNA was extracted according to the instructions of TIANamp GenomicDNA Kit of TIANGEN Company.

[0103] Primers ZC3HAV1F and ZC3HAV1R shown in Table 1 were designed based on the gene sequence of ZC3HAV1 (NCBI Reference Sequence: NC_010460.4) to amplify the 5′ regulatory region sequence of the porcine ZC3HAV1 gene, which includes the range from the start codon (ATG, +1) to 2964 bp upstream (the sequence is shown in SEQ ID NO.2).

[0104] Table 1: Primer sequences for amplifying the 5′ regulatory region of the porcine ZC3HAV1 gene

[0105]

[0106] XhoⅠ and NcoⅠ endonuclease sites and protective bases (italic parts) were added to the primers. The ZC3HAV1F and ZC3HAV1R primers were used to amplify the ZC3HAV1 5′ regulatory region from -2964 bp to +1 bp fragment, and the amplification system was 2×Gflex PCRBuffer (Mg 2+ , dNTP plus) 25μL, primers (10μM) 1μL each, Tks Gflex DNA Polymerase (1.25U / μl) 1μL, genomic DNA 2μL, add ddH2O to a total volume of 25μL. The PCR reaction conditions are 94℃1min; 98℃10s, 61℃30s, 68℃1min35s, 30 cycles. The PCR product of 2983bp was obtained. The amplified product was mixed with 5× Loading Buffer, loaded on 1% TAE agarose gel, electrophoresed at 5V / cm for 20min and observed under ultraviolet light. The electrophoresis of the PCR amplified ZC3HAV1 gene 5′ regulatory region fragment is shown in the figure below. Figure 4 shown.

[0107] Example 4: Construction of porcine ZC3HAV1 gene 5′ regulatory region vector and deletion vector and luciferase activity detection

[0108] 1. Construction of the 5′ regulatory region vector of the porcine ZC3HAV1 gene:

[0109] 1) Construct the ZC3HAV1 gene 5′ regulatory region vector using pGL3-Enhance as the backbone vector. The pGL3-Enhance vector and the ZC3HAV1 gene 5′ regulatory region obtained in Example 3 were digested with XhoⅠ and NcoⅠ restriction endonucleases, respectively. The digestion system was: Green Buffer 3μL, XhoⅠ endonuclease 1μL, NcoⅠ endonuclease 1μL, pGL3-Enhance vector 2μL (ZC3HAV1 gene 5′ regulatory region target fragment 16μL), add ddH2O to a total volume of 30μL. Digest at 37℃ for 3h.

[0110] 2) DNA ligation and transformation. The ligation system is: 20μL system includes 10μL Ligation Solution A, 1.5μL vector, 8.5μL insert, and the ligation condition is 16℃60min. During transformation, take 20μL of ligation product and gently add it to 100μL competent cells, incubate on ice for 30min, then bathe in 42℃ water for 90s, bathe in ice for 3min after heat shock, add 900μL warm antibiotic-free LB liquid culture medium, incubate at 37℃220rpm for 1h, collect bacteria by centrifugation at 6000rpm, resuspend and evenly spread on LB solid culture medium containing ampicillin (100μg / mL).

[0111] 3) Preparation and sequencing of plasmid DNA. Use a sterile pipette tip to pick a single colony on the transformed plate, inoculate it into 3 ml LB culture medium containing 100 μg / ml ampicillin, and culture it at 37°C and 220 rpm for 12 to 14 hours. The plasmid extraction process is carried out according to the Tiangen Plasmid Extraction Kit, and enzyme digestion verification is performed after the plasmid extraction is completed. The enzyme digestion verification system is: GreenBuffer 1μL, XhoⅠ endonuclease 0.2μL, NcoⅠ endonuclease 0.2μL, plasmid DNA 2μL, add ddH2O to a total volume of 10μL. Digest at 37℃ for 1h. Send the positive clones detected by enzyme digestion to the sequencing department of Shanghai Biotechnology for sequencing. The pGL3-(ZC3HAV1)LW vector was obtained.

[0112] 2. Construction of the 5′ regulatory region deletion vector of porcine ZC3HAV1 gene:

[0113] The pGL3-(ZC3HAV1)LW vector was used as the backbone vector. According to the gene sequence of ZC3HAV1 (NCBI Reference Sequence: NC_010460.4), the primers shown in Table 2 below were designed for the construction of the 5′ regulatory region deletion vector.

[0114] Table 2: Primer sequences used to construct 5′ regulatory region deletion vectors

[0115]

[0116] XhoⅠ endonuclease site and protective base (italic part) were added to the primers. The five upstream primers in the above table and ZC3HAV1R primer were used to amplify the deletion fragment of ZC3HAV1 5' regulatory region. The amplification reaction system and procedure were the same as in Example 1.

[0117] The pGL3-Enhance vector and the ZC3HAV15′ regulatory region deletion fragment were digested with XhoⅠ and NcoⅠ restriction endonucleases, respectively. The digestion system and procedure were the same as 1). The deleted fragments after digestion were connected and transformed with the digested vectors, respectively. The system and procedure were the same as 2). A single colony was picked on the transformed plate with a sterile pipette tip, and plasmid DNA was prepared, double digestion was verified and sequenced. The system and procedure were the same as 3), and pGL3-(-2449 / +1), pGL3-(-2021 / +1), pGL3-(-1463 / +1), pGL3-(-991 / +1), and pGL3-(-429 / +1) vectors were obtained.

[0118] 3. Luciferase activity detection:

[0119] 3D4 / 21 cells were cultured in 25 cm 2 / 50ml cell culture flask. The culture medium used was (Gibco) RPMI 1640 culture medium (containing 10% fetal bovine serum). The cells were subcultured when they reached 70-80% confluence, and the cell culture medium was changed every 2 days.

[0120] The cells to be transfected were rinsed twice with 1×PBS (Gibco), and 0.25% trypsin (Gibco) preheated at 37°C was added for digestion for 2 min. The cells were resuspended in complete medium without antibiotics. After cell counting, 7×104 cells were inoculated into a 24-well plate per well. After 24 h, the cells were washed once with 1×PBS (Gibco), and 500 μL of fresh complete medium without antibiotics was added to each well. Transfection was performed 12 h later, at which time the cell confluence was 70% to 80%. The negative control vector pGL3-Enhance without 5′ regulatory region, experimental vector pGL3-(ZC3HAV1)LW, pGL3-(-2449 / +1), pGL3-(-2021 / +1), pGL3-(-1463 / +1), pGL3-(-991 / +1), and pGL3-(-429 / +1) were simultaneously transfected into 3D4 / 21 cell line. 800 ng of target plasmid and 20 ng of pGL4.74 internal reference plasmid were diluted into 25 μL of opti-MEM (Gibco) in each well, and 1 μL of P3000 was added. TM Reagent (Invitrogen) was gently mixed, and 25 μL (containing 1 μl Lipofectamine TM3000 reagent) in opti-MEM (Gibco) and gently mix, incubate at room temperature for 20 minutes, then gently add to each well, mix, and place the culture plate in 5% CO2, 37°C. After 6 hours, the control group was replaced with a maintenance medium containing 2% FBS; after 6 hours, the medium was discarded in the challenge group, and the PCV2 (MOI = 10) was infected and incubated for 2 hours before being replaced with a maintenance medium containing 2% FBS. Luciferase assay was performed according to the instructions of the dual luciferase assay kit 48 hours after transfection.

[0121] The results of the test are as follows Figure 5 As shown. Figure 4 It can be speculated that there are regulatory elements that enhance gene expression between pGL3-(-2449 / +1) and pGL3-(-1463 / +1).

[0122] Example 5: Searching for polymorphisms in the 5′ regulatory region of the ZC3HAV1 gene in different pig breeds

[0123] The ZC3HAV1F and ZC3HAV1R primers were used to amplify the -2964bp to +1bp fragment of the 5′ regulatory region of the ZC3HAV1 gene of Laiwu pigs (DNA mixed pool samples of 30 Laiwu pigs) and Dachang hybrid pigs (DNA mixed pool samples of 30 Dachang hybrid pigs). The primer sequence, amplification system, and reaction conditions were the same as those in Example 3. The amplified product was mixed with 5×Loading Buffer and loaded onto a 1% TAE agarose gel. After electrophoresis at 5V / cm for 20 minutes, the gel was cut and the 2983bp fragment was recovered. The purified product was obtained according to the purification instructions of the Axygen agarose gel purification kit. The purified product was connected to the pMDTM18-T vector (TaKaRa), cloned and transformed into DH5α competent cells, and 20 tubes of single colonies were picked from Laiwu pigs and Dachang hybrid pigs, respectively, and sent to the Shanghai Biotech Sequencing Department for sequencing, and the sequence was compared using DNAMAN 6.0.3.99 software.

[0124] The results are as follows Figure 6 As shown, multiple polymorphic sites were found, among which the polymorphisms of G nucleotide deletion / insertion at position -2362, -2184C / G, -1982A / G, -1977T / C, -1859T / C and -1754G / C were located between the key segments pGL3-(2449 / +1) and pGL3-(-1463 / +1) where enhanced gene expression exists, and there were certain differences in the allele frequencies between the two pig breeds.

[0125] Example 6: Luciferase reporter system to detect differences in activity of the 5′ regulatory region of different alleles of polymorphic sites

[0126] According to the analysis results of the polymorphism in Example 5, the site-directed mutagenesis primers shown in Table 3 were designed using the pGL3-(ZC3HAV1)LW recombinant vector as a template.

[0127] Table 3: Site-directed mutagenesis primer sequences

[0128]

[0129] Using PCR method, the -2362 site was mutated into a G nucleotide, the -2184 site C was mutated into a G nucleotide, the -1982 site A was mutated into a G nucleotide, the -1977 site T was mutated into a C nucleotide, the -1859 site T was mutated into a C nucleotide, and the -1754 site G was mutated into a C nucleotide, respectively, to obtain a single-site site-directed mutagenesis vector and detect the effects of different alleles on the activity of the 5′ regulatory region.

[0130] The pGL3-(ZC3HAV1)LW recombinant vector was used as a template, and primers ZC3HAV1M1F / R to ZC3HAV1M6F / R were used to amplify the circular plasmid by PCR. The amplification system was: 5× PrimeSTAR GXL Buffer (Mg2+Plus) 5μL, dNTPMixture (2.5mM) 2μL, primers (10μM) 0.5μL each, PrimeSTAR TM GXL DNA Polymerase (2.5U / μL) 0.25μL, template plasmid DNA 0.2μL, add ddH2O to a total volume of 25μL. The PCR reaction conditions are 94℃5min; 98℃10s, 67℃15s, 72℃8min30s, 18 cycles; 72℃10min. The PCR product obtained is an open-circular plasmid with a nick that can be directly transformed into DH5ct competent cells. In order to remove the template plasmid and increase the positive rate of the strain, the PCR product was treated with DpnI endonuclease, and the reaction system was: Green Buffer 0.8 μL, DpnI endonuclease 0.4 μL, PCR product DNA 20 μL, the mixed system was digested at 37°C for 1 hour, and the digested product was directly used for transformation. Monoclonal colony picking, plasmid DNA extraction, double enzyme digestion verification and sequencing comparison were the same as in Example 4.

[0131] Because the PCR product is large, in order to prevent the introduction of unnecessary mutations during the amplification process and affect the test results, the positive plasmid was digested with XhoⅠ and NcoⅠ restriction endonucleases. The obtained mutant target gene sequence was reconnected to the vector, and transformation, bacterial selection, plasmid DNA extraction, double enzyme digestion verification and sequencing were performed again, the method was the same as Example 4. Finally, 6 single-site mutation plasmid vectors were obtained.

[0132] The constructed pGL3-(ZC3HAV1)LW, 6 single-site mutation plasmid vectors and negative control pGL3-Enhance plasmid were transfected into 3D4 / 21 cells according to the method in Example 4, and then their dual luciferase activities were detected after 48 hours.

[0133] The results are as follows Figure 7 As shown in the figure, after the T nucleotide at position -1859 mutated to a C nucleotide, the activity of its 5′ regulatory region was significantly upregulated, indicating that this site is an important cis-regulatory element that enhances gene expression.

[0134] Therefore, the C nucleotide allele at the -1859 site is used as a disease-resistance-related gene marker, and pigs carrying this disease-resistance gene marker are bred. After the piglets are born, the marker is identified, and through comprehensive selection, pigs with strong resistance to porcine circovirus disease are screened out to cultivate excellent pig breeds resistant to porcine circovirus disease.

[0135] The above description is only the preferred embodiment of the present application and is not intended to limit the present application. For those skilled in the art, the present application may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. Application of porcine ZC3HAV1 gene in the preparation of products for inhibiting porcine circovirus replication; characterized in that, The nucleotide sequence of the porcine ZC3HAV1 gene is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: The porcine circovirus is PCV2.

3. A SNP marker in the 5′ regulatory region of the porcine ZC3HAV1 gene, the nucleotide sequence of the SNP marker is shown in SEQ ID NO.2; the sequence shown in SEQ ID NO.2 is a polymorphic site at position 1107 from the 5′ end, and its nucleotide is T or C.

4. Use of the SNP marker according to claim 3 in regulating the transcriptional activity of the porcine ZC3HAV1 gene.

5. The use according to claim 3, characterized in that: The transcriptional activity of ZC3HAV1 gene with SNP marker polymorphic site of C nucleotide was higher than that with SNP marker polymorphic site of T nucleotide.

6. A method for increasing the transcriptional activity of porcine ZC3HAV1 gene, characterized in that: The following steps are involved: The nucleotide at position -1859 in the 5′ regulatory region of the porcine ZC3HAV1 gene was mutated from T to C.

7. Use of the primer for detecting the SNP marker of claim 3 in the breeding of pigs resistant to porcine circovirus; characterized in that: The nucleotide sequences of the primers are shown in SEQ ID NO.3 and SEQ ID NO.4 respectively.

Images