A transcription factor gene PagBZR1 that coordinately regulates poplar wood yield and wood fiber length and its application

By cloning and expressing the PagBZR1 gene in poplar, and constructing activation and repression expression vectors, we achieved synergistic regulation of poplar timber yield and wood fiber length, solving the regulatory challenges in existing technologies and significantly improving poplar growth and timber quality.

CN119614584BActive Publication Date: 2025-10-28ZHEJIANG UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411763831.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-03
Publication Date
2025-10-28
Estimated Expiration
2044-12-03

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively coordinate and regulate poplar timber yield and fiber length, which affects forest tree breeding improvement and timber quality enhancement.

Method used

By cloning the PagBZR1 gene and constructing the activation expression vector PagBZR1pro-PagmBZR1-VP16 and the repression expression vector PagBZR1pro-PagmBZR1-SRDX, the gene was transferred into poplar trees using Agrobacterium-mediated leaf disc transformation, achieving efficient expression of the PagmBZR1 gene in poplar trees and regulating vascular tissue development and wood formation.

Benefits of technology

It significantly increased poplar tree height, stem diameter, number of stem vascular tissue cells, length and width of wood fibers, and secondary cell wall deposition, accelerating the wood formation process and improving wood yield and quality.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119614584B_ABST
    Figure CN119614584B_ABST
Patent Text Reader

Abstract

This invention relates to PagBZR1, a transcription factor gene that synergistically regulates poplar timber yield and fiber length, and its applications, belonging to the field of plant genetic engineering technology. Its nucleotide sequence is shown in Sequence 3 of the sequence listing, and its amino acid sequence is shown in Sequence 4 of the sequence listing. In this invention, the PagmBZR1 gene was transferred into poplar trees. Compared with the wild type, transgenic poplar trees with activated PagmBZR1 expression showed significantly increased plant height, significantly thickened stems, significantly increased number of cell layers in the stem vascular tissue, and significantly increased fiber length and width, with significantly thickened secondary cell walls. The phenotype of transgenic poplar trees with inhibited PagmBZR1 expression was the opposite. This indicates that the PagmBZR1 gene is a key regulatory gene controlling poplar timber production and has important application value in the fields of forestry genetic engineering and clonal forestry.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to key transcription factor genes in the brassinolide signaling pathway that regulates the development of vascular tissue and wood formation in poplar trees and their applications, particularly to PagBZR1, a transcription factor gene that synergistically regulates poplar wood yield and wood fiber length and its applications, belonging to the field of bioengineering technology. Background Technology

[0002] Poplar is an economically important tree species widely distributed globally. It is characterized by rapid early growth, strong adaptability, wide distribution, numerous varieties, easy hybridization, easy genetic improvement, and easy propagation, making it widely used in intensive cultivation. Poplar has a wide range of uses, not only for processing industries but also as an important raw material for plywood, fiberboard, papermaking, disposable chopsticks, and packaging. It offers significant economic, ecological, and social benefits. Therefore, there is an urgent need to develop new high-yield, high-quality poplar varieties that increase timber production and improve timber quality. Utilizing molecular biology and genetic engineering techniques to improve poplar timber yield and quality has significant theoretical and practical value.

[0003] Timber yield and quality are jointly determined by the mitotic activity and xylem differentiation activity of vascular cambium cells. Previous studies have shown that the mitotic activity and xylem differentiation activity of poplar vascular cambium are regulated by brassinosteroid hormone signaling. Increased brassinosteroid content promotes secondary xylem differentiation and wood formation, significantly increasing wood tissue biomass. Brassinosteroids transmit signals to the downstream transcription factor BZR1 through a signaling cascade, thereby regulating the transcription of BR-responsive genes. Therefore, studying the role of BZR1 in plant development can further elucidate the molecular mechanism by which brassinosteroids regulate vascular tissue development and wood formation, which is beneficial for creating new poplar varieties with high-quality wood fiber.

[0004] Therefore, this study aims to provide a transcription factor gene, PagBZR1, that synergistically regulates poplar wood yield and fiber length, and its application. Based on molecular biology and genetic engineering techniques, and using poplar as the research object, this study offers new insights into the molecular mechanism by which brassinolide regulates poplar wood formation, and is of great significance for forest tree breeding and improvement. Summary of the Invention

[0005] To address the shortcomings of existing technologies, one objective of this invention is to provide a transcription factor gene, PagBZR1, that synergistically regulates poplar wood yield and wood fiber length.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] PagBZR1, a transcription factor gene that synergistically regulates poplar timber yield and wood fiber length, has its nucleotide sequence shown in Sequence 3 of Table 3.

[0008] Another objective of this invention is to provide the expression protein of the transcription factor gene PagBZR1, which synergistically regulates poplar timber yield and wood fiber length.

[0009] The above-mentioned objective of this invention is achieved through the following technical solution:

[0010] The amino acid sequence of PagBZR1, a transcription factor gene that synergistically regulates poplar timber yield and wood fiber length, is shown in Sequence 4 of Table 4.

[0011] Another objective of this invention is to provide a plant expression vector for the transcription factor gene PagBZR1, which synergistically regulates poplar timber yield and wood fiber length.

[0012] The above-mentioned objective of this invention is achieved through the following technical solution:

[0013] A plant expression vector for PagBZR1, a transcription factor gene that synergistically regulates poplar timber yield and wood fiber length, includes a plant activation expression vector PagBZR1pro-PagmBZR1-VP16, whose nucleotide sequence is shown in Sequence 8 of Table 8; and a plant repression expression vector PagBZR1pro-PagmBZR1-SRDX, whose nucleotide sequence is shown in Sequence 9 of Table 9.

[0014] Another objective of this invention is to provide a method for constructing a plant expression vector for the transcription factor gene PagBZR1, which synergistically regulates poplar wood yield and wood fiber length.

[0015] The above-mentioned objective of this invention is achieved through the following technical solution:

[0016] A method for constructing a plant expression vector for the transcription factor gene PagBZR1, which synergistically regulates poplar timber yield and wood fiber length, comprising the following steps:

[0017] (1) Cloning the PagmBZR1 gene

[0018] Using 84K (P. alba × P. glandulosa) *Populus alba* as material, total RNA was extracted from tissue culture seedlings using the RNeasy Plant Mini kit and the RNase-free DNase I kit (Qiagen, Hilden, Germany). 2.0 μg of RNA was taken from each sample, and the first strand of cDNA was synthesized using the SuperScript III first-strand synthesis system (Life Technologies, Carlsbad, CA, USA). Primers (containing start and stop codons) were designed using Primer3 software, referencing published *Populus alba* genome sequences, to amplify the gene. A mutation was obtained using the bzr1-D functional mutation method, which mutated the GSK-3 kinase phosphorylation site, and the gene was named PagmBZR1.

[0019] (2) Construction of PagmBZR1 gene expression vector in plants

[0020] Activation and repression expression vectors of the PagBZR1 gene were constructed using cloning technology. Vector-specific PCR primers were designed using Oligo7 software. PCR amplification was performed using the previously amplified PagmBZR1 as a template.

[0021] The CDS of the PagmBZR1 gene was constructed into the target vector, which was pCAMBIA3300 (SEQ introductory vector pCAMBIA3300: 10177bp).

[0022] (3) First, digest the target vector with HindIII enzyme;

[0023] (4) The target gene with vector-specific primers at both ends was constructed into the plant expression vector pCAMBIA3300 by homologous recombination reaction. The sequences of the final vectors are shown in Sequence 8 in Table 8 and Sequence 9 in Table 9, respectively.

[0024] (5) The final constructed vectors are PagBZR1pro-PagmBZR1-VP16 and PagBZR1pro-PagmBZR1-SRDX.

[0025] Preferably, in step (1), the PagmBZR1 CDS forward primer is shown as Sequence 1 in Table 1, and the PagmBZR1 CDS reverse primer is shown as Sequence 2 in Table 2; the high-fidelity PCR reaction system is as follows: TaKaRa high-fidelity amplification enzyme PrimeSTAR 7.5μL, PagmBZR1 CDS forward primer (10μM) 0.15μL, PagmBZR1 CDS reverse primer (10μM) 0.15μL, template (84K Yang cDNA) 0.8μL, sterile ddH2O to 15μL, reaction program: 98℃, 1min; (98℃, 10s; 56℃, 15s; 72℃, 2min: 35 cycles); 72℃, 3min.

[0026] Preferably, in step (2), the PagmBZR1 vector-specific forward primer is shown as sequence 5 in Table 5, and the PagmBZR1 vector-specific reverse primer is shown as sequence 6 in Table 6.

[0027] Preferably, in step (3), the enzyme digestion system is as follows: 5 ng of target vector pCAMBIA3300 (volume converted according to concentration); 3 μL of HindIII enzyme; 3 μL of 10× green buffer; ddH2O, to a final volume of 30 μL; reaction system: 37℃, 30 min.

[0028] Preferably, in step (4), the homologous recombination reaction system is as follows: 80 ng of pCAMBIA3300 digested with HindIII (the default amount of the target vector is 80 ng, and the volume is calculated according to the concentration); 3.75 μL of homologous recombination enzyme; ddH2O, to a final volume of 10 μL; reaction system: 45℃, 30 min; in step (5), the downstream of the PagBZR1 promoter and the 5' end of the PagmBZR1 gene have a 35S small promoter, which enables the PagmBZR1 gene to be expressed efficiently in poplar; a strong terminator NOS is assembled at the 3' end of the PagmBZR1 gene, which effectively terminates the transcription of the PagmBZR1 gene.

[0029] Another objective of this invention is to provide a genetic transformation of the transcription factor gene PagBZR1, which synergistically regulates poplar timber yield and wood fiber length.

[0030] The above-mentioned objective of this invention is achieved through the following technical solution:

[0031] The genetic transformation of PagBZR1, a transcription factor gene that synergistically regulates poplar timber yield and fiber length, involves the following steps: The constructed activation expression vector PagBZR1pro-PagmBZR1-VP16 and repression expression vector PagBZR1pro-PagmBZR1-SRDX were transferred into Agrobacterium EHA105 via cold shock. The PagmBZR1 gene was then transferred into 84K poplar trees via Agrobacterium-mediated leaf disc transformation.

[0032] Another objective of this invention is to provide an application of the transcription factor gene PagBZR1, which synergistically regulates poplar wood yield and wood fiber length.

[0033] The above-mentioned objective of this invention is achieved through the following technical solution:

[0034] The application of the transcription factor gene PagBZR1, which synergistically regulates poplar wood yield and wood fiber length, in regulating poplar growth and development, particularly in regulating poplar vascular tissue development and wood formation.

[0035] Advantages of this invention:

[0036] This invention uses 84K *Populus alba* as material to clone the PagmBZR1 gene. Simultaneously, it constructs the activation expression vector PagBZR1pro-PagmBZR1-VP16 and the repression expression vector PagBZR1pro-PagmBZR1-SRDX. Both PagBZR1 has a 35S promoter downstream of its own promoter and at the 5' end of the PagmBZR1 gene, enabling efficient expression of the PagmBZR1 gene in poplar trees, thereby regulating vascular tissue development and wood formation.

[0037] Compared with existing technologies, this invention, by transferring the PagmBZR1 gene into poplar trees, shows that compared to wild-type trees, transgenic poplar trees with activated PagmBZR1 expression exhibit significantly increased plant height, thicker stems, a significantly increased number of cell layers in the stem vascular tissue, and significantly increased wood fiber length and width, along with significantly thickened secondary cell walls. Conversely, transgenic poplar trees with inhibited PagmBZR1 expression show the opposite phenotype. This demonstrates that the PagBZR1 transcription factor gene, which synergistically regulates poplar wood yield and wood fiber length, is a crucial regulator controlling poplar vascular tissue development. The PagBZR1 gene can significantly enhance plant growth and promote vascular tissue development and wood formation, thus possessing significant application value in forestry genetic engineering and forestry engineering.

[0038] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but this does not imply any limitation on the scope of protection of the present invention. Attached Figure Description

[0039] Figure 1 This is a schematic diagram of the structure of the plant activation expression vector PagBZR1pro-PagmBZR1-VP16 in Example 1 of the present invention.

[0040] Figure 2 This is a schematic diagram of the structure of the plant-inhibited expression vector PagBZR1pro-PagmBZR1-SRDX in Example 1 of the present invention.

[0041] Figure 3 This is a comparison diagram of plant height and stem phenotype between transgenic poplar trees with activated and inhibited PagmBZR1 expression and non-transgenic poplar trees in Example 1 of this invention.

[0042] Figure 4 This is a quantitative real-time PCR (qPCR) image showing the transcriptional level of transgenic poplar trees with PagmBZR1 activation and inhibition in Example 1 of this invention.

[0043] Figure 5-1 This is a comparison image of semi-thin sections of vascular tissue from transgenic poplar trees with activated and inhibited PagmBZR1 expression and non-transgenic poplar trees in Example 1 of this invention.

[0044] Figure 5-2 This is a statistical diagram showing the thickness of the phloem, the number of cambium cell layers, and the number of xylem cell layers in the vascular tissue of transgenic poplar trees with activated and inhibited PagmBZR1 expression and non-transgenic poplar trees in Example 1 of this invention.

[0045] Figure 6 This is a comparison diagram of the wood fiber length and width between transgenic poplar trees with activated and inhibited PagmBZR1 expression and non-transgenic poplar trees in Example 1 of this invention.

[0046] Figure 7 This is a comparison diagram of the secondary cell wall thickness of wood fibers in transgenic poplar trees with activated and inhibited PagmBZR1 expression and non-transgenic poplar trees in Example 1 of this invention. Detailed Implementation

[0047] The present invention will be further described below with reference to specific embodiments. Operations not described in detail in the following embodiments can be performed with reference to molecular cloning and related kit instructions.

[0048] Example 1

[0049] Step (1) Cloning the PagmBZR1 gene

[0050] Using 84K (P. alba X P. glandulosa) *Populus alba* as material, total RNA was extracted from tissue culture seedlings using the RNeasy Plant Mini kit and the RNase-free DNase I kit (Qiagen, Hilden, Germany). 2.0 μg of RNA was taken from each sample, and cDNA first strand was synthesized using the SuperScript III first-strand synthesis system (Life Technologies, Carlsbad, CA, USA). Primers (with start and stop codons in the amplicon) were designed using Primer3 software, referencing the published *Populus alba* genome sequence, to amplify the gene. A gene mutation method using bzr1-D function was employed to obtain a mutant, which mutated the GSK-3 kinase phosphorylation site. The gene was named PagmBZR1.

[0051] The forward primers for PagmBZR1 CDS are shown in Sequence 1 of Table 1.

[0052] Table 1

[0053] name Sequence 1 PagmBZR1 CDS forward primer ATGACGTCAGATGGGGCAAC

[0054] The reverse primers for PagmBZR1 CDS are shown in Sequence 2 in Table 2.

[0055] Table 2

[0056] name Sequence 2 PagmBZR1 CDS reverse primer ACTCTGAGCCTTGCCACTTC

[0057] The high-fidelity PCR reaction system is as follows: TaKaRa high-fidelity amplification enzyme PrimeSTAR 7.5μL, forward primer (10μM) 0.15μL, reverse primer (10μM) 0.15μL, template (84K saturated cDNA) 0.8μL, sterile ddH2O to a final volume of 15μL. The reaction program is as follows: pre-denaturation 98℃, 1min; (denaturation 98℃, 10s; annealing 56℃, 15s; extension 72℃, 2min) for a total of 35 cycles; final extension 72℃, 3min.

[0058] The final obtained gene cDNA sequence is 915bp, as shown in Sequence 3 of Table 3 (SEQ PagmBZR1 gene cDNA: 915bp), see Table 3 below;

[0059] Table 3

[0060]

[0061] The protein sequence it compiles and expresses is shown in Sequence 4 of Table 4;

[0062] Table 4

[0063]

[0064] Step (2) Construction of the PagmBZR1 gene plant expression vector

[0065] Activation and repression expression vectors of the PagBZR1 gene were constructed using cloning technology. Vector-specific PCR primers were designed using Oligo7 software. PCR amplification was performed using the previously amplified PagmBZR1 as a template. The PagmBZR1 vector-specific forward primers are shown in Sequence 5 of Table 5.

[0066] Table 5

[0067] name Sequence 5 PagmBZR1 CDS specific forward primer ACAATTACAATTACCATGACGTCAGATGGGGCAACC

[0068] The specific reverse primers for the PagmBZR1 vector are shown in Sequence 6 of Table 6.

[0069] Table 6

[0070] name Sequence 6 PagmBZR1 CDS specific reverse primer GAATTCCTGCAGCCCACTCTGAGCCTTGCCACTTCC

[0071] The CDS of the PagmBZR1 gene was constructed into the target vector, which was pCAMBIA3300 (SEQ introductory vector pCAMBIA3300: 10177bp); the sequence of the target vector is shown in Sequence 7 of Table 7.

[0072] Table 7

[0073]

[0074]

[0075]

[0076]

[0077] The target vector needs to be digested with HindIII enzyme first: the digestion system is as follows: target vector pCAMBIA3300 5 ng (volume converted according to concentration); HindIII enzyme 3 μL; 10x digestion buffer 3 μL; ddH2O to 30 μL; reaction system: 37℃, 30 min; through homologous recombination reaction, the target gene with vector-specific primers at both ends is constructed into the plant expression vector pCAMBIA3300. The sequence of the final vector is shown in Sequence 8 in Table 8.

[0078] Homologous recombination reaction system: 80 ng of pCAMBIA3300 digested with HindIII (the default amount of the target vector is 80 ng, and the volume is calculated according to the concentration); (target fragment mass / number of bases in the target fragment) / (target vector amount 80 ng / number of bases in the target vector) = 3; obtain the target fragment mass, and calculate the target fragment volume according to the target fragment concentration; the amount of homologous recombination enzyme is 3.75 μL; ddH2O is added to 10 μL; reaction system: 37℃, 30 min; the VP16 coding sequence is linked after the PagmBZR1 gene coding sequence to construct the plant activation expression vector PagBZR1pro-PagmBZR1-VP16. The VP16 transcription activation domain consists of about 60 amino acid residues, which promotes the transcription of downstream target genes by fusing with transcription factors.

[0079] Table 8

[0080]

[0081]

[0082]

[0083]

[0084]

[0085] The target vector needs to be digested with HindIII enzyme first: the digestion system is as follows: target vector pCAMBIA3300 5 ng (volume converted according to concentration); HindIII enzyme 3 μL; 10x digestion buffer 3 μL; ddH2O to 30 μL; reaction system: 37℃, 30 min; through homologous recombination reaction, the target gene with vector-specific primers at both ends is constructed into the plant expression vector pCAMBIA3300. The sequence of the final vector is shown in Sequence 9 of Table 9.

[0086] Homologous recombination reaction system: 80 ng of pCAMBIA3300 digested with HindIII (the default amount of the target vector is 80 ng, and the volume is calculated according to the concentration); (target fragment mass / number of bases in the target fragment) / (target vector amount 80 ng / number of bases in the target vector) = 3; obtain the target fragment mass, and calculate the target fragment volume according to the target fragment concentration; 3.75 μL of homologous recombination enzyme; add ddH2O to 10 μL; reaction system: 37℃, 30 min; the plant-specific EAR-motif domain (SRDX) is linked to the coding sequence of the PagmBZR1 gene to construct the plant repressor expression vector PagBZR1pro-PagmBZR1-SRDX. The plant-specific EAR-motif domain (SRDX) consists of 12 amino acids. Fusion with the C-terminus of transcription factors can convert activators into repressors or increase the repressive ability of repressors, inhibiting the expression of downstream target genes of transcription factors.

[0087] Table 9

[0088]

[0089]

[0090]

[0091]

[0092]

[0093] The final constructed vectors are PagBZR1pro-PagmBZR1-VP16 and PagBZR1pro-PagmBZR1-SRDX. The PagBZR1 gene has a 35S promoter downstream of its own promoter and at the 5' end, enabling efficient expression of the PagmBZR1 gene in poplar. A strong terminator, NOS, is assembled at the 3' end of the PagmBZR1 gene, effectively terminating transcription. Figure 1 The diagram shown is a schematic representation of the structure of the plant activation expression vector PagBZR1pro-PagmBZR1-VP16 in Example 1 of this invention; Figure 2 The diagram shown is a schematic diagram of the structure of the plant repressive expression vector PagBZR1pro-PagmBZR1-SRDX in Example 1 of the present invention.

[0094] The final constructed vector was assembled with glufosinate acetyltransferase PAT, which serves as a selection marker for transgenic poplar. Transgenic poplar can be screened using glufosinate. PCR detection and sequencing verification confirmed the successful construction of the activation expression vector, named PagBZR1pro-PagmBZR1-VP16 (Sequence 8) (SEQ PagBZR1pro-PagmBZR1-VP16: 12042bp); the successful construction of the inhibition expression vector was named PagBZR1pro-PagmBZR1-SRDX (Sequence 9) (SEQ PagBZR1pro-PagmBZR1-SRDX: 11844bp).

[0095] Step (3) Genetic transformation of the PagmBZR1 gene

[0096] The constructed target vector carrying the PagmBZR1 gene was transferred into Agrobacterium EHA105 via cold shock. The PagmBZR1 gene was then transferred into 84K poplar trees using the Agrobacterium-mediated leaf disc method. The transformation steps were as follows: 84K tissue culture seedlings used for genetic transformation were cultured at a temperature of 22-25℃, a light intensity of 16 / 8h (day / night), and a light intensity of 50 μmol*m. -2* s -1 Under controlled conditions, the target vector carrying the PagmBZR1 gene was transformed into Agrobacterium EHA105. Agrobacterium infected 84K leaf discs when OD600 = 0.6–0.8. The infected leaf discs were co-cultured for 2 days in dark conditions at 22±2℃ on WPMS (Woody Plant Medium Screen) containing 100 μM acetylsylsyringone (AS). After co-culture, the leaf discs were transferred to selection medium (WPMS, supplemented with 1.0 mg / L 2,4-dichlorophenoxyacetic acid (2,4-D) and 0.1 mg / L kinetin) containing 5 mg / L glutamine ammonium and 200 mg / L timetin, and continued to be cultured in the dark for about one and a half months. Rice-grain-sized callus tissue was then transferred to a medium containing 5 mg / L glutamine ammonium. The plant was treated with differentiation medium containing 200 mg / L ammonium and 200 mg / L termetin (WPMD, with the addition of 0.05 mg / L naphthaleneacetic acid (NAA), 0.5 mg / L 6-benzylaminopurine (6-BA)) and 0.05 mg / L thiazuron (TDZ) until resistant adventitious shoots were induced. The resistant adventitious shoots were then transferred to rooting medium, and DNA was extracted from the leaves of the rooted plants for PCR verification.

[0097] Step (4) Application of the PagmBZR1 gene

[0098] Wild-type 84K and transgenic poplar trees were cultured under the same growth conditions for 60 days. The external growth status of the plants was observed, and the stems were cut into sections to observe the accumulation of wood biomass. The wood separation method was used to compare the length of wood fiber cells.

[0099] The experimental results are as follows Figures 3 to 7 As shown, Figure 3 The image shown is a comparison of plant height and stem phenotype between transgenic poplar trees with PagmBZR1 activation and PagmBZR1 inhibition expression and non-transgenic poplar trees in Example 1 of this invention (Nikon Z30, distance 1m, focal length 16-50mm). The upper image compares the plant height of transgenic poplar trees with PagmBZR1 activation and PagmBZR1 inhibition expression and non-transgenic poplar trees; the lower image compares the stem phenotype of transgenic poplar trees with PagmBZR1 activation and PagmBZR1 inhibition expression and non-transgenic poplar trees. The leftmost image shows a non-transgenic poplar tree; one tree was selected for plotting, and the statistical data were obtained with three replicates. mBZR1-VP16 is a transgenic plant transformed with the PagmBZR1 activation expression vector; mBZR1-SRDX is a transgenic plant transformed with the PagmBZR1 inhibition expression vector. Figure 4 The figure shows the results of transcriptional quantitative PCR experiments on transgenic poplar trees with PagmBZR1 activation and PagmBZR1 inhibition in Example 1 of this invention. The bar charts show the expression levels of the PagBZR1 gene in wild-type (84K) and transgenic poplar trees, respectively (mBZR1-VP16 is the PagmBZR1 activation expression vector, where 1, 2, and 3 are three lines; mBZR1-SRDX is the PagmBZR1 inhibition expression vector, where 1, 2, and 3 are three lines); As shown in Figure 5-1, it is a comparison of semi-thin sections of vascular tissue from transgenic poplar trees with PagmBZR1 activation and PagmBZR1 inhibition in Example 1 of this invention and non-transgenic poplar trees (ThermoFisher EVOS FLAuto2, photographed at 10x). Figure 5-1 In the middle, the leftmost tree is the wild type, and the rightmost tree is the genetically modified poplar; for example... Figure 5-2 The figure shown is a statistical diagram of the phloem thickness, cambium cell layer number, and xylem cell layer number of transgenic and non-transgenic poplar trees with PagmBZR1 activated and inhibited expression in Example 1 of this invention; Figure 6The image shown is a comparison of the size of wood fiber cells in transgenic poplar trees with activated and inhibited PagmBZR1 expression and non-transgenic poplar trees in Example 1 of this invention. In Example 1, A is a comparison of the size of wood fiber cells in transgenic poplar trees with activated and inhibited PagmBZR1 expression and non-transgenic poplar trees (ThermoFisher EVOS FLAuto2, photographed at 10x); B is a statistical graph of the length of wood fiber cells in wild-type (84k) and transgenic poplar trees; C is a statistical graph of the width of wood fiber cells in wild-type (84k) and transgenic poplar trees (ThermoFisher EVOS FLAuto2, photographed at 10x). Figure 7 The figures shown are a comparison of the secondary cell wall thickness of wood fibers in transgenic poplar trees with PagmBZR1 activation and PagmBZR1 inhibition expression and non-transgenic poplar trees in Example 1 of this invention. A is a comparison of the secondary cell wall thickness of wood fibers in transgenic poplar trees with PagmBZR1 activation expression and wild-type 84K poplar trees; B is a comparison of the secondary cell wall thickness of wood fibers in transgenic poplar trees with PagmBZR1 inhibition expression and wild-type 84K poplar trees (JEOL JEM-1230, JAPAN, photographed under 200000× conditions); where the left side is wild-type and the right side is transgenic poplar trees, and C is a bar chart showing the statistical diagram of the secondary cell wall thickness of wood fibers in wild-type (84k) and transgenic poplar trees.

[0100] The results show that, compared with the wild type, transgenic poplar trees with activated PagmBZR1 expression exhibited significantly increased plant height, thicker stems, a significantly increased number of cell layers in the stem vascular tissue, and significantly increased wood fiber length and width, along with significantly thickened secondary cell walls. Conversely, the phenotype of transgenic poplar trees with inhibited PagmBZR1 expression was the opposite. This indicates that the transcription factor gene PagBZR1, which synergistically regulates poplar timber yield and wood fiber length, is a crucial regulator controlling poplar vascular tissue development. The PagBZR1 gene can significantly enhance plant growth and promote vascular tissue development and wood formation, demonstrating significant application value in forestry genetic engineering and forestry engineering.

[0101] The above description is only a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any equivalent substitutions or modifications made by those skilled in the art within the scope of the technology disclosed in the present invention, based on the technical solution and inventive concept of the present invention, should be covered within the scope of protection of the present invention.

Claims

1. A transcription factor gene that synergistically regulates poplar timber yield and wood fiber length PagmBZR1 Its nucleotide sequence is shown in Sequence 3 of the sequence listing.

2. The transcription factor gene that synergistically regulates poplar timber yield and wood fiber length as described in claim 1 PagmBZR1 The expressed protein has an amino acid sequence as shown in Sequence 4 of the sequence listing.

3. A transcription factor gene that synergistically regulates poplar timber yield and fiber length PagmBZR1 Plant expression vectors, including plant activation expression vectors PagBZR1pro-PagmBZR1-VP16 Its nucleotide sequence is shown in Sequence 8 of the sequence listing; plant repressor expression vector PagBZR1pro-PagmBZR1-SRDX Its nucleotide sequence is shown in Sequence 9 of the sequence listing.

4. The transcription factor gene that synergistically regulates poplar timber yield and wood fiber length as described in claim 3. PagmBZR1 The method for constructing plant expression vectors is as follows: (1) Cloning PagmBZR1 Gene Using 84K *Populus simonii* as material, total RNA was extracted from tissue culture seedlings of 84K using the RNeasy Plant Mini kit and the RNase-free DNase I kit. The RNA was then used to synthesize the first strand of cDNA using the SuperScript III first-strand synthesis system. Primers were designed using Primer3 software based on the published *Populus hairy fruit* genome sequence for gene amplification. bzr1-D The gene mutation mode of the gain-of-function mutant involves mutating the phosphorylation site of GSK-3 kinase, and the gene is named... PagmBZR1 ; (2) PagmBZR1 Construction of plant gene expression vectors Using cloning technology to build PagBZR1 Gene activation and repression expression vectors were used, and vector-specific PCR primers were designed using Oligo7 software, based on previously amplified vectors. PagmBZR1 Using it as a template, PCR amplification was performed; Will PagmBZR1 The CDS of the gene was constructed into the target vector, which was pCAMBIA3300; (3) The target vector was digested with HindIII enzyme; (4) The target gene with vector-specific primers at both ends was constructed into the plant expression vector pCAMBIA3300 via homologous recombination. A transcriptional activation VP16 coding sequence and a transcriptional repression SRDX sequence were then ligated after the target gene. The final vector was constructed as follows: PagBZR1pro-PagmBZR1-VP16 and PagBZR1pro-PagmBZR1-SRDX .

5. The transcription factor gene that synergistically regulates poplar timber yield and wood fiber length as described in claim 4. PagmBZR1 The method for constructing plant expression vectors is characterized by: In step (1), PagmBZR1 The CDS forward primer is shown in Sequence 1 of the sequence listing. PagmBZR1 The CDS reverse primer is shown as sequence 2 in the sequence listing; the high-fidelity PCR reaction system is as follows: TaKaRa high-fidelity amplification enzyme PrimeSTAR 7.5 μL, 10 μM... PagmBZR1 CDS forward primer 0.15 μL, 10 μM PagmBZR1 CDS reverse primer 0.15 μL, 84K Yang cDNA template 0.8 μL, sterile ddH2O to 15 μL, reaction program: 98℃, 1 min; 72℃, 3 min.

6. The transcription factor gene that synergistically regulates poplar timber yield and wood fiber length as described in claim 5 PagmBZR1 The method for constructing plant expression vectors is characterized by: In step (2), PagmBZR1 The vector-specific forward primer is shown in sequence 5 of the sequence listing. PagmBZR1 The vector-specific reverse primer is shown in sequence 6 of the sequence listing.

7. The transcription factor gene for synergistic regulation of poplar timber yield and wood fiber length as described in claim 6. PagmBZR1 The method for constructing plant expression vectors is characterized by: In step (3), the enzyme digestion system is as follows: 5 ng of target vector pCAMBIA3300; 3 μL of HindIII enzyme; 3 μL of 10× green buffer; ddH2O, to a final volume of 30 μL; reaction system: 37℃, 30 min.

8. The transcription factor gene that synergistically regulates poplar timber yield and wood fiber length as described in claim 7. PagmBZR1 The method for constructing plant expression vectors is characterized by: In step (4), the homologous recombination reaction system consists of: 80 ng of pCAMBIA3300 digested with HindIII; the default amount of the target vector is 80 ng, and the volume is calculated based on the concentration; 3.75 μL of homologous recombination enzyme; and ddH2O, to a final volume of 10 μL. The reaction system is maintained at 37°C for 30 min. In step (5), PagBZR1 Self-starter downstream and PagmBZR1 The 5' end of the gene has a 35S small promoter, which enables... PagmBZR1 Genes are efficiently expressed in poplar trees; PagmBZR1 The 3' end of the gene is assembled with a strong terminator NOS, which effectively terminates the gene. PagmBZR1 Gene transcription.

9. The transcription factor gene that synergistically regulates poplar timber yield and wood fiber length as described in claim 1 PagmBZR1 The genetic transformation method involves the following steps: The constructed activation expression vector is transformed using a cold shock method. PagBZR1pro-PagmBZR1- VP16 and expression suppression vector PagBZR1pro-PagmBZR1-SRDX Transformed into Agrobacterium EHA105, and then transformed via Agrobacterium-mediated leaf disc transformation. PagmBZR1 Genes were transferred into 84K poplar trees.

10. The transcription factor gene that synergistically regulates poplar timber yield and wood fiber length as described in claim 1 PagmBZR1 The application in regulating the growth and development of poplar trees is as follows: improving poplar growth, promoting the development of poplar vascular tissue and wood formation.

Citation Information

Patent Citations

  • Plants having enhanced yield-related traits and method for making the same

    CN103789343A

  • Application of PpyBZR2 gene in promoting germination of dormant buds of pears

    CN116732088A