A method to significantly improve the soluble expression of equine acylase in Pichia pastoris
By optimizing the N-terminal amino acid sequence of equine acylase and constructing a recombinant expression vector, the problem of insufficient soluble expression of equine acylase in Pichia pastoris was solved, and the enzyme activity was significantly improved.
Patent Information
- Application Number
- CN202510070314.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-16
- Publication Date
- 2025-10-31
- Estimated Expiration
- 2045-01-16
AI Technical Summary
The low soluble expression level of equine acylase in Pichia pastoris limits its industrial production.
By optimizing the nucleotide sequence of the N-terminus 1 to 10 amino acids of the equine acylase to ATGGCGTCTAAGGGGCGAGAGGATGAACAT, a recombinant expression vector was constructed and expressed in Pichia pastoris. The strain culture and induction conditions were optimized, and its soluble expression level was significantly improved.
It significantly improved the soluble expression level and enzyme activity of equine acylase, with the enzyme activity increasing by 4.41 times.
Smart Images

Figure FT_1
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to a method for improving the soluble expression of equine acylase in Pichia pastoris. Background Technology
[0002] Acylases are a class of enzymes that catalyze esterification reactions in living organisms. They catalyze the combination of acids and alcohols into esters. Acylases are often key enzymes in various organisms, participating in a variety of biochemical processes, such as fatty acid metabolism, biosynthesis, and degradation. Our team has demonstrated that equine-derived acylases possess the synthetic activity of lauroylglycine. To improve their protein synthesis efficiency in industrial production, a suitable protein expression system needs to be found.
[0003] The Pichia pastoris expression system offers significant advantages in expressing exogenous proteins, such as being free from endotoxin interference, highly efficient secretory expression, rapid growth rate, and effective post-translational protein modification. This yeast expression system contains a unique and potent promoter for alcohol oxidase genes, allowing for precise regulation of exogenous gene expression using methanol, resulting in high expression levels. Furthermore, the system is easy to operate, exhibits stable characteristics, produces minimal background proteins, and is easily scaled up. In recent years, many recombinant proteins have achieved high-efficiency expression in Pichia pastoris, reaching gram-level concentrations; however, several proteins still exhibit low expression levels, limiting their industrial applications.
[0004] Equine-derived acylases are expressed directly using Pichia pastoris, but their soluble expression levels are low, and they are mostly expressed in the form of inclusion bodies, which severely limits their industrial production. Summary of the Invention
[0005] To improve the soluble expression level of equine acylase in Pichia pastoris, the inventors attempted strategies such as optimizing strain culture and induction conditions, adding fusion tags, and optimizing expression strains, but none of these methods significantly increased the soluble expression of equine acylase. However, during their research, the inventors accidentally discovered that alterations to the N-terminal nucleic acid sequence of the equine acylase unexpectedly led to a significant increase in soluble protein expression and enzyme activity. It is against this backdrop that the present invention aims to provide a Pichia pastoris expression system that significantly improves the soluble expression of equine acylase.
[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution:
[0007] This invention provides a gene encoding equine acylase, wherein the nucleotide sequence of the N-terminus of the gene encoding equine acylase is replaced with ATGGCGTCTAAGGGGCGAGAGGATGAACAT.
[0008] Preferably, the amino acid sequence of the equine acylase is shown in SEQ ID NO.1. Preferably, the gene encoding the equine acylase is based on the nucleotide sequence shown in SEQ ID NO.2, with the N-terminal 1 to 10 amino acids of the encoding nucleotide sequence replaced by ATGGCGTCTAAGGGGCGAGAGGATGAACAT.
[0009] More preferably, its nucleotide sequence is shown in SEQ ID NO.3.
[0010] The present invention contains a recombinant expression vector encoding the equine acylase gene.
[0011] Preferably, its carrier frame is pPIC9K.
[0012] The present invention further provides a recombinant bacterium encoding the equine acylase gene or the recombinant expression vector.
[0013] Preferably, it is Pichia pastoris.
[0014] This invention provides a method for expressing or preparing equine acylase, which involves culturing the recombinant bacteria to produce equine acylase.
[0015] Optionally, the method also includes the step of isolating the resulting equine acylase.
[0016] Preferably, the method for isolating the generated equine acylase is to centrifuge the recombinant bacteria after induction and expression, and collect the supernatant to obtain the equine acylase.
[0017] The significant beneficial effect achieved by this invention lies in the successful construction of an optimized Pichia pastoris expression system, which can significantly enhance the soluble expression level of equine acylase and increase its enzyme activity by 4.41 times. Specifically, by optimizing the nucleotide sequence of the N-terminus 1 to 10 amino acids of the equine acylase, the soluble expression of equine acylase in Pichia pastoris was significantly improved. Attached Figure Description
[0018] Figure 1 Comparison of HAcy and HAcy-M protein expression. Detailed Implementation
[0019] The specific embodiments of the present invention will be described in detail below with reference to the accompanying drawings. It should be understood that the specific embodiments described herein are for illustration and explanation only, and are intended to facilitate understanding of the technical solutions of the present invention, and are not intended to limit the present invention.
[0020] Culture media used in the examples:
[0021] YPD liquid culture medium (1L): Dissolve 50g of YPD solid in 1L of distilled water, adjust the pH to 6.5, autoclave at 121℃ for 20min, and cool for later use.
[0022] 10×YNB(1L): 134g of yeast nitrogen source solids dissolved in 1L of distilled water and filtered through a 0.22μm filter for sterilization.
[0023] 500×Biotin (50mL): Dissolve 10mg of biotin solid in 50mL of distilled water, filter through a 0.22μm filter to remove bacteria, and store at 4℃.
[0024] BMGY liquid medium (1L): Add 10g of yeast extract and 20g of peptone to 879mL of distilled water, sterilize at 121℃ for 20min, and after cooling, add 100mL of 10×YNB, 1mL of 500×Biotin and 20mL of 50% glycerol in a clean bench.
[0025] BMMY liquid medium (1L): Add 10g of yeast extract and 20g of peptone to 894mL of distilled water, sterilize at 121℃ for 20 min, and after cooling, add 100mL of 10×YNB, 1mL of 500×Biotin and 5mL of methanol in a clean bench.
[0026] Example 1: Construction and expression of Pichia pastoris recombinant expression strain of equine acylase
[0027] Based on the equine acyltransferase gene HAcy (GenBank: XP_001492888.2, encoded by SEQ ID NO: 1 and its nucleotide sequence as shown in SEQ ID NO: 2) indexed by NCBI, the equine acyltransferase gene was artificially synthesized. Using this gene as a template, PCR amplification was performed, and EcoRI and NotI restriction sites were added to both ends to complete the construction of the gene expression cassette.
[0028] The equine-derived acylase gene fragment was amplified using specific primers: upstream primer F: 5'-GAATTCATGGCCAGCAAGGGTCGCG-3' and downstream primer R: 5'-GCGGCCGCTCAGCTGTCACTGGGCAGG-3'. Simultaneously, the pPIC9K vector was double-digested with EcoRI and Not I. After double digestion with EcoRI and Not I, the acylase gene fragment and pPIC9K plasmid were ligated to the double-digested pPIC9K vector using T4 DNA ligase to construct the recombinant plasmid pPIC9K-Acy. pPIC9K-Acy was transformed into E. coil DH5α, and the plasmid was extracted.
[0029] The plasmid was linearized using the restriction endonuclease SacI, electroporated into GS115, and preliminarily screened using 100 μg / ml YPD resistance plates, followed by secondary screening using 800 μg / ml YPD resistance plates.
[0030] Positive transformants were inoculated into BMGY liquid medium and cultured at 30°C until the OD600 value of the bacterial culture reached 2-6. The culture was centrifuged at 5000 rpm for 5 min at room temperature, the supernatant was removed, and the bacterial cells were collected. Subsequently, the bacterial cells were resuspended in BMGY liquid medium until the OD600 value was approximately 1.0, and cultured on a shaker at 30°C and 220 rpm. Pure methanol was added to the medium every 24 hours to adjust the final concentration to 0.5%-1.0%. After methanol induction for 96 hours, the culture was centrifuged at 8000 rpm for 10 min, and the supernatant was collected to obtain the equine acylated enzyme HAcy.
[0031] Example 2: Construction and expression of an optimized N-terminal expression strain for acylase
[0032] The inventors accidentally discovered that optimizing the codons for the first 10 amino acids at the N-terminus of equine acylase (the optimized nucleotide sequence is shown in SEQ ID NO: 3) yielded unexpected results. The specific construction method is as follows:
[0033] The recombinant plasmid pPIC9K-Acy constructed in Example 1 was used as a template for whole-plasmid PCR amplification. The PCR system components (total volume 50 μL) were added as follows: PrimerStar 25 μL, ddH2O 20 μL, primer F (5'-AATTCATGGCGTCTAAGGGGCGAGAGGATGAACATCCATCCGTGACGCTC-3') and primer R (5'-GAGCGTCACGGATGGATGTTCATCCTCTCGCCCCTTAGACGCCATGAATT-3') 1.5 μL each, and template 2 μL.
[0034] The PCR amplification program was as follows: 98℃ pre-denaturation for 2 min; followed by cycling (98℃ denaturation for 10 s; 56℃ annealing for 15 s; 72℃ extension for 70 s), for a total of 25 cycles, with a final extension at 72℃ for 5 min. After the PCR reaction, 1 μL of DpnI was added, and the mixture was digested at 37℃ for 30 min. The resulting plasmid was then transformed into E. coil DH5α, and plasmid was extracted. The N-terminally optimized recombinant plasmid pPIC9K-HAcy-M was obtained.
[0035] According to the method shown in Example 1, the N-terminally optimized equine acylase HAcy-M was obtained.
[0036] Example 3: Identification of expression results of equine acylases HAcy and HAcy-M proteins
[0037] The equine acylase solutions obtained in Examples 1 and 2 were concentrated 5-fold using an ultrafiltration tube. 20 μL of the supernatant and precipitate suspension were taken separately, incubated in a boiling water bath for 10 min, and after cooling, 20 μL of the sample was taken for electrophoresis. The electrophoresis results are as follows: Figure 1 As shown, the protein size is 46 kDa.
[0038] from Figure 1 It can be seen that the soluble expression of HAcy-M is significantly increased compared to HAcy.
[0039] Through systematic analysis, this invention revealed that the free energy of the mRNA of the first 10 amino acids at the N-terminus of HAcy-M is -4.28, while that of HAcy-M is -6.59 (free energy prediction was performed using RNAFOLD software). It is hypothesized that the expression level of soluble protein is related to the free energy; the higher the predicted free energy value, the higher the expression of soluble protein.
[0040] Example 4: Comparison of equine acylase HAcy and HAcy-M enzyme activities
[0041] Bacterial OD was obtained using Examples 1 and 2. 600 The enzyme solution obtained at 25°C was used to determine the activity of lauroylglycine synthesis. The synthesis reaction system (10 mL) consisted of 360 mg lauric acid, 5 mL saturated glycine solution, and 5 mL enzyme solution. The reaction was carried out at 37°C for 14 h.
[0042] Analytical conditions: Column: C18, 4.6 mm × 250 mm, 5 μm; Detection wavelength: UV = 200 nm; Mobile phase: 85% acetonitrile and 15% 0.05% trifluoroacetic acid aqueous solution; Column temperature: 30°C; Flow rate: 1 mL / min; Detection time: 15 min.
[0043] After the reaction, the concentration of lauroylglycine in HAcy-M was 5.41 times that of HAcy. This indicates that the enzyme activity of HAcy-M was increased by 4.41 times relative to HAcy.
Claims
1. A gene encoding equine acylase, characterized in that, Its nucleotide sequence is shown in SEQ ID NO.
3.
2. A recombinant expression vector containing the equine acylase gene as described in claim 1.
3. The recombinant expression vector as described in claim 2, characterized in that, Its carrier framework is pPIC9K.
4. Recombinant bacteria containing the gene encoding equine acylase as described in claim 1, or the recombinant expression vector as described in claim 2 or 3.
5. The recombinant bacteria as described in claim 4, characterized in that, It is Pichia pastoris.
6. A method for expressing or preparing equine acylase, wherein the equine acylase is produced by culturing the recombinant bacteria as described in claim 4 or 5.
7. The method as described in claim 6, characterized in that, It also includes the step of isolating the equine acylase produced.
8. The method as described in claim 7, characterized in that, The step of separating the equine acylase is to centrifuge the recombinant bacteria after induction and expression, and collect the supernatant to obtain the equine acylase.
Citation Information
Patent Citations
Method of increasing yield of lignocellulose substrate hydrolase
CN106434735A