Primer probe group for simultaneously detecting American strain and European strain of porcine reproductive and respiratory syndrome virus, detection method and application

Abstract

The invention provides a primer probe group for simultaneously detecting American strains and European strains of porcine reproductive and respiratory syndrome viruses, a detection method and application, and particularly belongs to the technical field of porcine pathogen detection products. The invention provides a primer probe group for simultaneously detecting American strains and European strains of porcine reproductive and respiratory syndrome viruses. The primer probe group comprises universal forward primers PRRSV1-F and PRRSV2-F for detection, reverse primers PRRSV1-R and PRRSV2-R for detection and a universal probe PRRSV-P. A target gene detected by the primer probe group is a 3'non-coding region gene (3 'UTR) of a porcine reproductive and respiratory syndrome virus genome, and the primer probe group can realize efficient detection of American strains and European strains of the porcine reproductive and respiratory syndrome virus, and is simple and convenient in detection, high in sensitivity, good in specificity, high in speed, low in false positive and capable of realizing high-throughput detection.

Description

Technical Field

[0001] The invention belongs to the technical field of pig pathogen detection products, and specifically relates to a primer probe set for simultaneously detecting American strains and European strains of porcine reproductive and respiratory syndrome virus, a detection method and an application thereof. Background Art

[0002] Porcine reproductive and respiratory syndrome virus (PRRSV) is the pathogen of porcine reproductive and respiratory syndrome (PRRS). The International Committee on Taxonomy of Viruses (ICTV) divides PRRSV into European type (PRRSV-1) and American type (PRRSV-2). Porcine reproductive and respiratory syndrome (PRRS) is a common infectious disease in pig farms, manifested as reproductive failure of sows and respiratory diseases in piglets and growing pigs.

[0003] Porcine reproductive and respiratory syndrome, since the disease was first reported in the United States in the 1980s, the epidemic characteristics of PRRSV have been changing. Accurate diagnosis is the prerequisite for effective prevention and control of PRRS. Because different genotypes of PRRSV have been spreading in various pig farms, and the nucleotide homology of PRRSV-1 and PRRSV-2 is very low (50-70%), coupled with the continuous emergence of new mutations, deletions, insertions and recombination of PRRSV, PRRSV has become one of the viruses with a higher mutation rate. The current detection methods cannot cover all types of PRRSV, and there is a risk of missed detection and misdiagnosis. In addition, after PRRSV infects pigs, it will invade the body's immune organs, reduce the immunity of infected pigs, and easily cause secondary infections with other viruses and bacteria, making the disease, which is already difficult to prevent and control, more complicated. Establishing a method that can quickly detect various types of PRRSV is particularly important for the prevention and control of the disease.

[0004] At present, many PRRSV detection methods have been reported at home and abroad. Virus isolation and identification is the gold standard method for detecting PRRS pathogens, but this method has high technical requirements and a long detection cycle; serological methods such as immunofluorescence assay (FA) and immunoperoxidase assay (IMPA) can also be used for PRRSV antigen detection, but the sensitivity is not high and it is not conducive to the detection of large-scale samples; conventional PCR methods have been widely used in diagnosis, but because of its relatively low sensitivity, the electrophoresis process is easy to pollute the environment, and the operation is relatively complicated, it has been mainly used in scientific research in recent years. At present, there is a lack of a more efficient method for detecting all types of PRRSV, including American and European strains, to provide support for the inspection, quarantine and prevention and control of PRRS. Summary of the invention

[0005] The purpose of the present invention is to provide a set of primer probe sets, detection methods and applications for simultaneously detecting the American strain and the European strain of porcine reproductive and respiratory syndrome virus. The primer probe set of the present invention can realize the efficient detection of the American strain and the European strain of porcine reproductive and respiratory syndrome virus, and the detection is simple, sensitive, specific, fast, low in false positives and can be detected in high throughput.

[0006] The present invention provides a primer probe set for simultaneously detecting the American strain and the European strain of porcine reproductive and respiratory syndrome virus, comprising universal forward primers PRRSV1-F and PRRSV2-F, reverse primers PRRSV1-R and PRRSV2-R, and a universal probe PRRSV-P;

[0007] The nucleotide sequence of the PRRSV1-F is shown in SEQ ID NO.1; the nucleotide sequence of the PRRSV2-F is shown in SEQ ID NO.2; the nucleotide sequence of the PRRSV1-R is shown in SEQ ID NO.3; the nucleotide sequence of the PRRSV2-R is shown in SEQ ID NO.4;

[0008] The nucleotide sequence of the PRRSV-P is shown in SEQ ID NO.5.

[0009] Preferably, the 5' end of the nucleotide sequence of the probe PRRSV-P is modified with a fluorescent reporter group, including FAM; and the 3' end is modified with a fluorescent quencher group, including BHQ1.

[0010] The present invention also provides the use of the primer probe set described in the above technical solution in preparing a product for simultaneously detecting the American strain and the European strain of porcine reproductive and respiratory syndrome virus.

[0011] Preferably, the product comprises a kit.

[0012] The present invention also provides a kit for simultaneously detecting the American strain and the European strain of porcine reproductive and respiratory syndrome virus, comprising the primer probe set and the reaction solution described in the above technical solution.

[0013] Preferably, the reaction solution comprises 2×One Step U+Mix and One Step U+Enzyme Mix.

[0014] The present invention also provides a method for simultaneously detecting the American strain and the European strain of porcine reproductive and respiratory syndrome virus for non-diagnostic purposes, comprising the following steps:

[0015] The sample to be tested is subjected to fluorescent PCR detection using the primer probe set described in the above technical solution or the kit described in the above technical solution. When the Ct value is less than 38, it is determined to be positive, and when the Ct value is greater than or equal to 38, it is determined to be negative.

[0016] Preferably, taking the RNA of the sample to be tested as a template, every 20 μL of the fluorescent PCR detection reaction system includes: 2×One Step U+Mix 10.0 μL, One Step U+Enzyme Mix 1.0 μL, 0.4 μL to 1.0 μL each of 10 μmol / L PRRSV1-F, 10 μmol / L PRRSV2-F, 10 μmol / L PRRSV1-R and 10 μmol / L PRRSV2-R, 0.3 μL to 0.5 μL of 10 μmol / L PRRSV-P, 3 μL RNA and the remainder of water.

[0017] Preferably, the reaction procedure of the fluorescent PCR detection is: reverse transcription at 55°C for 15 min, pre-denaturation at 95°C for 10 sec, cycle reaction at 95°C for 10 sec, 60°C for 30 sec, and 45 cycles.

[0018] The present invention provides a primer probe set for simultaneously detecting the American strain and the European strain of porcine reproductive and respiratory syndrome virus. The present invention designs a set of specific primers and probes according to the 3' non-coding region (3'UTR) sequence of the porcine reproductive and respiratory syndrome virus genome. The universal primer probe set provided by the present invention can specifically identify all genotypes of the American strain and the European strain of porcine reproductive and respiratory syndrome virus. The primer probe combination does not affect each other during the amplification process, and can accurately detect the target gene quantitatively and qualitatively, which is simple, rapid, efficient and highly sensitive. The test results show that the primer probe set of the present invention has a minimum detection limit of 3.27 copies / μL, with high sensitivity; there is no cross reaction with swine fever virus (CSFV C strain), porcine circovirus type 2 (PCV2), pseudorabies virus (PRVBartha-K61 strain), porcine parvovirus (PPV 7909 strain), porcine epidemic diarrhea virus (PEDV attenuated CV777 strain), porcine transmissible gastroenteritis virus (TGEV attenuated Chinese strain), porcine rotavirus (RV G5 type NA strain), and porcine deltacoronavirus (PDCoV), and the specificity is good; the standard curve amplification efficiency is high, and the quantitative detection of porcine reproductive and respiratory syndrome virus can be realized; when performing fluorescent PCR detection, the coefficient of variation (CV%) of intra-batch and inter-batch tests is between 0.21% and 1.74%, and the test has good stability.

[0019] The fluorescent quantitative PCR detection method for non-diagnostic purposes established by the present invention using the primer probe group is simple, rapid, efficient, highly specific and highly sensitive, and can be widely used in the detection of porcine reproductive and respiratory syndrome virus, etiological detection in the environment of diseased pig farms and related scientific research, and has high practical application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative labor.

[0021] Figure 1 A graph showing the amplification results of the American strain and European strain of porcine reproductive and respiratory syndrome virus standard products detected by the fluorescent quantitative PCR detection method provided by the present invention;

[0022] Figure 2 The standard curve diagram of detecting American strain and European strain of porcine reproductive and respiratory syndrome virus by using the fluorescence quantitative PCR detection method provided by the present invention;

[0023] Figure 3 A graph showing the specific test results of the fluorescent quantitative PCR detection method provided by the present invention;

[0024] Figure 4 A graph showing the results of a sensitivity test of the American strain and the European strain of porcine reproductive and respiratory syndrome virus using the fluorescent quantitative PCR detection method provided by the present invention;

[0025] Figure 5 This is a diagram of the repeatability test results of detecting the American strain and European strain standard products of porcine reproductive and respiratory syndrome virus using the fluorescent quantitative PCR detection method provided by the present invention. DETAILED DESCRIPTION

[0026] The present invention provides a primer probe set for simultaneously detecting the American strain and the European strain of porcine reproductive and respiratory syndrome virus, comprising universal forward primers PRRSV1-F and PRRSV2-F, reverse primers PRRSV1-R and PRRSV2-R, and a universal probe PRRSV-P;

[0027] The nucleotide sequence of the PRRSV1-F is shown in SEQ ID NO.1; the nucleotide sequence of the PRRSV2-F is shown in SEQ ID NO.2; the nucleotide sequence of the PRRSV1-R is shown in SEQ ID NO.3; the nucleotide sequence of the PRRSV2-R is shown in SEQ ID NO.4;

[0028] The nucleotide sequence of the PRRSV-P is shown in SEQ ID NO.5.

[0029] In the present invention, the target gene detected by the primer probe set is the 3' uncoded region gene (3'UTR) of the porcine reproductive and respiratory syndrome virus genome. In a specific embodiment, the target gene detected by the primer probe set of the present invention is specifically shown as SEQ ID NO.6. In a specific embodiment, the nucleotide sequence of the PRRSV1-F is as shown in SEQ ID NO.1: 5'-GGTGAATGGCCRCGATTG-3', wherein R is a degenerate base, specifically A or G; the nucleotide sequence of the PRRSV2-F is as shown in SEQ ID NO.2: 5'-GGTKAAYGGCACTGATTG-3', wherein K is a degenerate base, specifically G or T, and Y is a degenerate base, specifically T or C; the nucleotide sequence of the PRRSV1-R is as shown in SEQ ID NO.3: 5'-ATTTCGGTCACATGGTTC-3'; the nucleotide sequence of the PRRSV2-R is as shown in SEQ ID NO.4: 5'-CCGCATGGTTCTCGCCA-3'; the nucleotide sequence of the PRRSV-P is as shown in SEQ ID NO.5: 5'-AGTCACCTATTCAATTAGGGCGA-3'. In a specific embodiment, the 5' end of the nucleotide sequence of the probe PRRSV-P is modified with a fluorescent reporter group, including FAM, and the 3' end is modified with a fluorescent quencher group, including BHQ1.

[0030] According to the conservative gene sequences (U87392.3; EU807840.1; EF112445.1; JN654459.1; MF326985.1; M96262.2) of the porcine reproductive and respiratory syndrome virus American strain and European strain registered in GenBank, the invention selects the conservative 3'UTR nucleotide sequence as the amplification region and designs specific primers and probes while taking into account the differences between the porcine reproductive and respiratory syndrome virus strains separated from different lineages and other porcine original virus strains. The specific primers and probes of the invention can specifically identify the porcine reproductive and respiratory syndrome virus, and can simply, quickly and efficiently detect the porcine reproductive and respiratory syndrome virus American strain and European strain. The sensitivity test results of the fluorescence quantitative PCR detection method of the porcine reproductive and respiratory syndrome virus American strain and the European strain show that the universal primer probe combination of the invention is applied to the fluorescence quantitative PCR detection of the porcine reproductive and respiratory syndrome virus American strain and the European strain, and its minimum detection limit is 3.27 copies / μL, with high sensitivity.

[0031] The present invention also provides the use of the primer probe set described in the above technical solution in preparing a product for simultaneously detecting the American strain and the European strain of porcine reproductive and respiratory syndrome virus. In a specific embodiment, the product includes a kit.

[0032] The present invention also provides a kit for simultaneously detecting the American strain and the European strain of porcine reproductive and respiratory syndrome virus, comprising the primer probe set and the reaction solution described in the above technical solution. The present invention has no special requirements for the components of the reaction solution, and any reagent that can achieve pathogen detection can be used, such as an enzyme mixture. In a specific embodiment, the reaction solution includes 2×One Step U+Mix and One Step U+Enzyme Mix.

[0033] The present invention also provides a method for simultaneously detecting the American strain and the European strain of porcine reproductive and respiratory syndrome virus for non-diagnostic purposes, comprising the following steps:

[0034] The sample to be tested is subjected to fluorescent PCR detection using the primer probe set described in the above technical solution or the kit described in the above technical solution. When the Ct value is less than 38, it is determined to be positive, and when the Ct value is greater than or equal to 38, it is determined to be negative.

[0035] The present invention extracts total RNA from the sample to be tested before the fluorescent PCR detection. In the present invention, the source of the sample to be tested can be the organs, blood, saliva swabs of the test object, or environmental swabs. The present invention does not specifically limit the method for extracting the total RNA, and a kit can be used for extraction. The present invention does not make strict requirements on the specific source of the nucleic acid extraction kit, which can be purchased conventionally, such as the RNA / DNA nucleic acid extraction kit of Jinrui Hongjie (Xiamen) Biotechnology Co., Ltd. In a specific embodiment, the RNA of the sample to be tested is used as a template, and the reaction system of the fluorescent PCR detection for each 20 μL includes: 2×One Step U+Mix 10.0 μL, One Step U+Enzyme Mix 1.0 μL, 0.4 μL to 1.0 μL of 10 μmol / L PRRSV1-F, 10 μmol / L PRRSV2-F, 10 μmol / L PRRSV1-R and 10 μmol / L PRRSV2-R, 0.3 μL to 0.5 μL of 10 μmol / L PRRSV-P, 3 μL RNA and the remainder of water. In a specific embodiment, the volumes of PRRSV1-F, PRRSV1-R, PRRSV2-F, and PRRSV2-R are 0.4 μL respectively; the volume of the PRRSV-P is 0.4 μL. In a specific embodiment, the reaction procedure of the fluorescent PCR detection is: reverse transcription at 55°C for 15 min, pre-denaturation at 95°C for 10 sec, cycle reaction at 95°C for 10 sec, 60°C for 30 sec, and 45 cycles.

[0036] In a specific embodiment, when preparing the reaction system, 2×One Step U+Mix, One Step U+Enzyme Mix, PRRSV1-F, PRRSV2-F, PRRSV1-R, PRRSV2-R, PRRSV-P and water can be mixed to obtain a premixed solution, which is then mixed with RNA to obtain the PCR reaction system. The present invention does not impose strict requirements on the source of the reagents used in the reaction system, and conventional purchases are sufficient. During the specific implementation of the present invention, the reagents used were purchased from Nanjing Novozymes Biotech Co., Ltd. During the specific implementation of the present invention, the volume of the reaction system is adjusted as needed, and it is only necessary to ensure that the volume ratio of the premixed solution and RNA is 17:3.

[0037] The present invention has no strict requirements on the concentration of the RNA, as long as the total RNA amount is between 1pg and 1μg. In a specific embodiment, according to the above concentration and volume, 2×One Step U+Mix, One Step U+Enzyme Mix, PRRSV1-F, PRRSV2-F, PRRSV1-R, PRRSV2-R, PRRSV-P and water are mixed and then mixed with RNA, and after centrifugation at 500r / min~1000r / min for 30s, a fluorescent PCR reaction is performed. In a specific embodiment, the fluorescent PCR reaction is carried out in a Bio-Rad CFX Opus 96 Real-Time PCR System (Bio-Rad Laboratories (Shanghai) Co., Ltd). After the fluorescent PCR reaction is completed, the present invention collects the extension phase fluorescent signal and Ct value, and determines whether porcine reproductive and respiratory syndrome virus is contained according to the size of the Ct value. When the Ct value is less than 38, it is judged as positive, that is, it contains porcine reproductive and respiratory syndrome virus; when the Ct value is greater than or equal to 38, it is judged as negative, that is, it does not contain porcine reproductive and respiratory syndrome virus. As long as the sample to be detected contains any one of the American strains or European strains of porcine reproductive and respiratory syndrome virus, the method for simultaneously detecting the American strain and the European strain of porcine reproductive and respiratory syndrome virus provided by the present invention can be used for detection, and it cannot be understood that only samples containing various viruses of porcine reproductive and respiratory syndrome virus can be detected. The method of the present invention improves the sensitivity of detection while reducing the workload of conventional PCR, thereby improving work efficiency. It provides effective technical means for porcine reproductive and respiratory syndrome virus detection, etiological detection in the environment of diseased pig farms and related scientific research, as well as clinical prevention and control. The method of the present invention is simple, rapid, efficient, and highly sensitive, and has a very high practical application value.

[0038] To further illustrate the present invention, a set of primer probe sets, detection methods and applications for simultaneously detecting American and European strains of porcine reproductive and respiratory syndrome virus provided by the present invention are described in detail below in conjunction with the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0039] Example 1

[0040] Establishment of fluorescence PCR detection method

[0041] 1. Primer and probe design

[0042] The PRRSV genome sequence was downloaded from NCBI and analyzed by MEGA7 (version 7.0.21). Primers and probes were designed in the conserved 3'UTR region of the PRRSV genome using the primer design software NDASTAR Lasergene's PrimerSelect (version 7.1.0 (44)). The primers and probes were then synthesized by Suzhou Genewise Biotechnology Co., Ltd. The nucleotide sequences of the primers and probes are shown in Table 1.

[0043] Table 1 Nucleotide sequences of primers and probes

[0044]

[0045] 2. Preparation of Plasmid Standards

[0046] According to the sequence information of the universal primers and probes for the American and European strains of porcine reproductive and respiratory syndrome virus (Table 1), the sequence information of the target gene to be amplified by the primers was provided (TAGGTGAATGGCCGCGATTGACGTGTGGCCTCTAAGTCACCTATTCAATT AGGGCGATCACATGGGGGTCAAACTTAATTAGGCAGGAACCATGTGACCGAAATTAGAGTGGTGAATGGCACTGATTGATATTGTGCCTCTAAGTCACCTATTCAATTAGGGCGACCGTATGGGGGTAACATTTAATTGGCGAGAACCATGCGGCCGAAA, SEQ ID NO.6, obtained by combining a 3' non-coding region gene of each of the European and American strains), and Suzhou Jinweizhi Biotechnology Co., Ltd. was commissioned to synthesize the plasmid pPRRSV-T (i.e., containing the target gene fragment to be amplified). The copy number was calculated, and the plasmid standard was gradiently diluted with ddH2O to obtain seven concentrations (3.27×10 5 copies / μL to 3.27×10 -1 The recombinant plasmid standard of 1000 copies / μL was stored at -20℃ for future use.

[0047] 3. Experiment on reaction annealing temperature of fluorescent PCR detection method

[0048] The prepared plasmid was used as a template for fluorescence quantitative PCR experiment to explore the reaction annealing temperature. The plasmid concentration used was 3.27×10 4 copies / μL.

[0049] The 2×One Step U+Mix and One Step U+Enzyme Mix used in this reaction system are produced by Nanjing Novozymes Biotech Co., Ltd.

[0050] The fluorescence PCR method is used, and the reaction solution is prepared in the reaction mixture preparation area.

[0051] It is recommended to prepare the reaction system according to n+1 reactions, and the sample detection reaction system is 20.0μL.

[0052] The fluorescent PCR reaction solution was 17.0 μL: 2×One Step U+Mix 10.0 μL, One Step U+Enzyme Mix 1.0 μL, PRRSV1-F (10 μmol / L), PRRSV2-F (10 μmol / L), PRRSV1-R (10 μmol / L) and PRRSV2-R (10 μmol / L) were 0.4 μL, PRRSV-P (10 μmol / L) was 0.4 μL, and the balance was H2O;

[0053] Mix the fluorescent PCR reaction solution prepared above thoroughly, dispense into transparent fluorescent PCR tubes at a rate of 17.0 μL per tube, mark them according to the order of sample addition, and transfer them to the nucleic acid extraction area for sample addition.

[0054] Add 3.0 μL of plasmid to each fluorescent PCR reaction tube and centrifuge at 500-1000 r / min for 30 seconds. Transfer to the detection area and set the gradient temperature to 54.0°C, 55.8°C, 58.0°C, 60.5°C and 62.0°C according to the characteristics of the instrument. The specific reaction procedure is described below using 60°C as an example.

[0055] The reaction procedure for sample detection was as follows: reverse transcription at 55°C for 15 min, pre-denaturation at 95°C for 10 sec, cycle reaction at 95°C for 10 sec, 60°C for 30 sec, 45 cycles, and collection of fluorescence signals during the extension phase. The fluorescence channel of the PCR instrument was set to: FAM. The reaction was performed in the Bio-Rad CFX Opus 96 Real-Time PCR System (Bio-Rad Laboratories (Shanghai) Co., Ltd). The detection results corresponding to different annealing temperatures are shown in Table 2.

[0056] Table 2 Detection results corresponding to different annealing temperatures

[0057]

[0058] According to Table 2, as the annealing temperature gradually increases, the Ct value does not change significantly, but has an overall trend of decreasing. Considering the comparison of universal primer probe combinations and the test results of porcine reproductive and respiratory syndrome virus American strain and European strain, 60°C is determined to be the optimal annealing temperature.

[0059] 4. Experiment on determination of reaction system of fluorescence quantitative PCR detection method

[0060] The prepared plasmid was used as a template to explore the optimal reaction system.

[0061] The 2×One Step U+Mix used in this reaction system is produced by Nanjing Novozymes Biotech Co., Ltd.

[0062] Fluorescence quantitative PCR was used to detect the standard plasmid pPRRSV-T (concentration 3.27×10 4 copies / μL) for amplification.

[0063] The reaction solution is prepared in the reaction mixture preparation area.

[0064] It is recommended to prepare the reaction system according to n+1 reactions, and the sample detection reaction system is 20.0μL.

[0065] The fluorescent PCR reaction solution was 17.0 μL: 2×One Step U+Mix 10.0 μL, One Step U+Enzyme Mix 1.0 μL, the volume ranges of PRRSV1-F (10 μmol / L), PRRSV2-F (10 μmol / L), PRRSV1-R (10 μmol / L) and PRRSV2-R (10 μmol / L) were 0.4-1.0 μL, and the volume range of PRRSV-P (10 μmol / L) was 0.3-0.5 μL; ddH2O was added to 17.0 μL (the specific use of primers and probes is shown in Table 3);

[0066] Mix the fluorescent PCR reaction solution prepared above thoroughly, dispense into transparent fluorescent PCR tubes at a rate of 17.0 μL per tube, mark them according to the order of sample addition, and transfer them to the nucleic acid extraction area for sample addition.

[0067] Add 3.0 μL of plasmid to each fluorescent PCR reaction tube, centrifuge at 500-1000 r / min for 30 seconds, and transfer to the detection area.

[0068] Reaction procedure: reverse transcription at 55°C for 15 min, pre-denaturation at 95°C for 10 sec, cycle reaction at 95°C for 10 sec, 60°C for 30 sec, 45 cycles, and collecting fluorescence signals during the extension phase. The fluorescence channel of the PCR instrument was set to: FAM. The reaction was carried out in the Bio-Rad CFXOpus 96 Real-Time PCR System (Bio-Rad Laboratories (Shanghai) Co., Ltd). Three replicates were designed for each group. The average detection results corresponding to different reaction systems are shown in Table 3.

[0069] Table 3 Detection results corresponding to different reaction systems

[0070]

[0071]

[0072] Comprehensive analysis of the Ct values ​​in Table 3 showed that there was no significant difference in the Ct values ​​(average values) among all universal primer-probe combinations. The combination with a primer addition amount of 0.4 μL and a probe addition amount of 0.4 μL had the smallest Ct value for amplifying the same sample under the same conditions, so it was determined to be the best combination: that is, 2×One Step U+Mix 10.0 μL, One Step U+Enzyme Mix 1.0 μL, the volumes of PRRSV1-F (10 μmol / L), PRRSV2-F (10 μmol / L), PRRSV1-R (10 μmol / L) and PRRSV2-R (10 μmol / L) were 0.4 μL, and the volume of PRRSV-P (10 μmol / L) was 0.4 μL; the reaction result was best when ddH2O was supplemented to 17.0 μL.

[0073] 5. Establishment of standard curve

[0074] Fluorescence quantitative PCR was used to detect the standard plasmid pPRRSV-T (concentration 3.27×10 5 copies / μL to 3.27×10 0 copies / μL) for amplification.

[0075] The reaction solution is prepared in the reaction mixture preparation area.

[0076] It is recommended to prepare the reaction system according to n+1 reactions, and the sample detection reaction system is 20.0μL.

[0077] The fluorescent PCR reaction solution was 17.0 μL: 2×One Step U+Mix 10.0 μL, One Step U+Enzyme Mix 1.0 μL, the volumes of PRRSV1-F (10 μmol / L), PRRSV2-F (10 μmol / L), PRRSV1-R (10 μmol / L) and PRRSV2-R (10 μmol / L) were 0.4 μL, and the volume of PRRSV-P (10 μmol / L) was 0.4 μL; ddH2O was added to 17.0 μL;

[0078] Mix the fluorescent PCR reaction solution prepared above thoroughly, dispense into transparent fluorescent PCR tubes at a rate of 17.0 μL per tube, mark them according to the order of sample addition, and transfer them to the nucleic acid extraction area for sample addition.

[0079] Add 3.0 μL of plasmid to each fluorescent PCR reaction tube, centrifuge at 500-1000 r / min for 30 seconds, and transfer to the detection area.

[0080] Reaction procedure: reverse transcription at 55°C for 15 min, pre-denaturation at 95°C for 10 sec, cycle reaction at 95°C for 10 sec, 60°C for 30 sec, 45 cycles, collecting fluorescence signals during the extension phase. The PCR instrument fluorescence channel was set to: FAM. The reaction was performed in the Bio-Rad CFXOpus 96 Real-Time PCR System (Bio-Rad Laboratories (Shanghai) Co., Ltd), with three replicates for each concentration. The test results are shown in Figure 1-2 And as shown in Table 4.

[0081] Table 4 Statistics of standard curve amplification efficiency results

[0082] Detection of target pathogens Fluorescence signal Slope Amplification efficiency <![CDATA[R 2 ]]> Y-intercept Porcine reproductive and respiratory syndrome virus FAM -3.391 97.2％ 0.995 37.378

[0083] according to Figure 1 , Figure 2 As shown in Table 4, the amplification efficiency is high and the correlation coefficient (R 2 ) was above 0.99, indicating that the standard curve had a good linear relationship and the fluorescence PCR method had been successfully established.

[0084] 6. Specificity test

[0085] The fluorescent quantitative PCR method of the present invention was used for specific tests, and the nucleic acids of positive samples such as PRRSV, CSFV, PCV2, PRV, PPV, PEDV, TGEV, RV, PDCoV, BVDV, etc. were used as templates for specific detection. The specific strains used are shown in Table 5.

[0086] Table 5 Types and sources of virus strains used for testing

[0087]

[0088] Note: The address of the laboratory of the livestock and poultry disease prevention and control team of the Institute of Animal Husbandry and Veterinary Medicine, Tianjin Academy of Agricultural Sciences is: Institute of Animal Husbandry and Veterinary Medicine, Tianjin Academy of Agricultural Sciences, 17 kilometers from Jinjing Road, Xiqing District, Tianjin.

[0089] Fluorescence quantitative PCR detection was performed using the reaction procedure and reaction system in step 5. The detection results are as follows: Figure 3 and as shown in Table 6.

[0090] Table 6 Specificity test results of universal fluorescent PCR detection method for porcine reproductive and respiratory syndrome virus

[0091]

[0092]

[0093] according to Figure 3 As can be seen from Table 6, when the fluorescent PCR detection method of the present invention is used to detect PRRSV, CSFV, PCV2, PRV, PPV, PEDV+TGEV+RV, and PDCoV, only the nucleic acid detection results of different genotype strains of PRRSV are positive, and the nucleic acid detection results of other pathogens are all negative, indicating that the specificity of this fluorescent quantitative PCR method is good.

[0094] 7. Sensitivity test

[0095] Seven concentrations of pPRRSV-T plasmid standard (3.27×10 5 copies / μL to 3.27×10 -1 Seven concentrations of standard plasmids were amplified by fluorescence quantitative PCR method, and three replicates were performed for each concentration. The fluorescence PCR method of the present invention was used for sensitivity test. The detection reaction system and procedure were the same as step 5. The experimental results are shown in FIG. Figure 4 shown.

[0096] according to Figure 4 It can be seen from the recorded content that the minimum detection limit of the fluorescent PCR method of the present invention for simultaneously detecting the American strain and the European strain of porcine reproductive and respiratory syndrome virus is 3.27 copies / μL, indicating that the universal detection primers and the detection method of the present invention have high sensitivity.

[0097] 8. Repeatability test

[0098] The plasmid pPRRSV-T (concentration of 3.27×10 5 copies / μL -1 to 3.27×10 0The fluorescent quantitative PCR method of the present invention was used to perform intra-batch (three replicates) and inter-batch tests (three replicates), and the test results were statistically analyzed. The repeatability of the method was analyzed based on the coefficient of variation (CV%). The test reaction system and procedure were the same as step 5. The experimental results are shown in FIG. Figure 5 And as shown in Table 7.

[0099] Table 7 Repeatability test results of universal fluorescence detection PCR method for porcine reproductive and respiratory syndrome virus

[0100]

[0101] Note: CV% = (standard deviation SD / mean value) × 100%.

[0102] according to Figure 5 It can be seen from the contents shown in Table 7 that the coefficient of variation (CV%) of intra-batch and inter-batch tests is between 0.21% and 1.74%, and the fluorescent PCR method of the present invention has good stability.

[0103] The universal primer-probe combination for simultaneously detecting the American strain and the European strain of porcine reproductive and respiratory syndrome virus provided by the present invention can specifically identify the American strain and the European strain of porcine reproductive and respiratory syndrome virus, and can detect these pathogens simply, quickly and efficiently; the fluorescent PCR detection method established using the universal primer-probe combination of the present invention has the characteristics of simplicity, rapidity, high efficiency and high sensitivity, can be widely used in epidemiological surveys of porcine reproductive and respiratory syndrome, laboratory tests and related scientific research, and has very high practical application value.

[0104] Example 2

[0105] Comparative test of different primer-probe combinations

[0106] The universal primers and probes in the fluorescent quantitative PCR method of the present invention were used in different combinations and the same reaction procedure to simultaneously detect PRRSV-1, PRRSV-2SR-1, PRRSV-2HuN4 and PRRSV-2NADC30-like strains. The results are shown in Table 8.

[0107] Template: PRRSV-2SR-1 strain virus titer: 6.521TCID50 / mL; PRRSV-2HuN4 strain virus titer: 7.465TCID50 / mL; PRRSV-2NADC30-like strain virus titer: 7.056TCID50 / mL; PRRSV-1 nucleic acid (positive sample nucleic acid, concentration not measured).

[0108] The 2×One Step U+Mix used in this reaction system is produced by Nanjing Novozymes Biotech Co., Ltd.

[0109] The reaction solution is prepared in the reaction mixture preparation area.

[0110] It is recommended to prepare the reaction system according to n+1 reactions, and the sample detection reaction system is 20.0μL.

[0111] Combination 1: The fluorescent PCR reaction solution is 17.0 μL (i.e., the optimized reaction system): 2×One Step U+Mix 10.0 μL, One Step U+Enzyme Mix 1.0 μL, the volumes of PRRSV1-F (10 μmol / L), PRRSV2-F (10 μmol / L), PRRSV1-R (10 μmol / L), and PRRSV2-R (10 μmol / L) are 0.4 μL, and the volume of PRRSV-P (10 μmol / L) is 0.4 μL; ddH2O is added to 17.0 μL;

[0112] Combination 2: The fluorescent PCR reaction solution is 17.0 μL: 2×One Step U+Mix 10.0 μL, One Step U+Enzyme Mix 1.0 μL, the volumes of PRRSV2-F (10 μmol / L) and PRRSV2-R (10 μmol / L) are 0.4 μL, and the volume of PRRSV-P (10 μmol / L) is 0.4 μL; ddH2O is added to 17.0 μL;

[0113] Mix the fluorescent PCR reaction solution prepared above thoroughly, dispense into transparent fluorescent PCR tubes at a rate of 17.0 μL per tube, mark them according to the order of sample addition, and transfer them to the nucleic acid extraction area for sample addition.

[0114] Add 3.0 μL of nucleic acid to each fluorescent PCR reaction tube, centrifuge at 500-1000 r / min for 30 seconds, and transfer to the detection area.

[0115] Reaction procedure: reverse transcription at 55°C for 15 min, pre-denaturation at 95°C for 10 sec, cycle reaction at 95°C for 10 sec, 60°C for 30 sec, 45 cycles, and collecting fluorescence signals during the extension phase. The fluorescence channel of the PCR instrument was set to: FAM. The reaction was carried out in a Bio-Rad CFXOpus 96 Real-Time PCR System (Bio-Rad Laboratories (Shanghai) Co., Ltd).

[0116] From the results in Table 8, it can be seen that the amount of probe added in these two combinations remains unchanged, and the results of the two sets of primer-probe combinations for detecting the same sample are basically the same, indicating that there is no influence between the primers, and adding or reducing primers does not affect the detection effect. The biggest difference is the detection result of PRRSV-1. PRRSVF-1 and PRRSVR-1 are reduced in combination 2, that is, PRRSV-1 cannot be detected. The two combinations are amplified simultaneously to determine whether the sample is PRRSV-1 or PRRSV-2.

[0117] The above results prove that this method has incomparable advantages. The same primer probes can be used to change the primer probe combination mode without changing the primer probe addition amount and reaction procedure, so as to meet the various detection needs of farms in the biosafety prevention and control of PRRS with the least number of tests.

[0118] Table 8 Comparison of detection results of different primer-probe combinations

[0119]

[0120] Comparative Example 1

[0121] The same sample was tested using different primer-probe sets for simultaneous detection of the American and European strains of porcine reproductive and respiratory syndrome virus.

[0122] The gene sequence of PRRSV was downloaded from NCBI, and the MEGA7 (version 7.0.21) software was used for sequence comparison analysis to find the conserved gene position. Two sets of primer-probe combinations for detecting PRRSV were designed using DNASTAR software (Table 9). By testing the same sample, according to the results, it can be seen that the first set of primer-probe combinations (primer-probe combinations of the present invention) is better than the second set of primer-probe combinations (Table 10).

[0123] Table 9 PRRSV universal primer and probe sequences

[0124]

[0125]

[0126] Table 10 PRRSV detection primer verification results statistics

[0127]

[0128] Comparative Example 2

[0129] Comparison of universal fluorescent PCR detection methods for PRRSV American and European strains

[0130] Comparison results between the method of the present invention and the national standard method

[0131] The method of the present invention is based on the reaction system and reaction procedure optimized in Example 1, and the national standard method (GD / T35912-2018) is operated according to the instructions, and PRRSV-2SR-1 strain, HuN4 strain, NADC30-like strain and PRRSV-1 are detected simultaneously. The results are shown in Table 11.

[0132] Template: PRRSV-2SR-1 strain virus titer: 6.521TCID50 / mL; PRRSV-2HuN4 strain virus titer: 7.465TCID50 / mL; PRRSV-2NADC30-like strain virus titer: 7.056TCID50 / mL; PRRSV-1 nucleic acid (positive sample nucleic acid, concentration not measured).

[0133] Table 11 Comparison results of two detection methods

[0134]

[0135]

[0136] From the results in Table 11, it can be seen that the sensitivity results of the method of the present invention and the national standard method to the three representative strains of PRRSV-2 are basically consistent, but the method of the present invention can detect PRRSV-1, while the national standard method cannot, indicating that the method of the present invention is significantly superior to the national standard method in detecting various genotypes of PRRSV.

[0137] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A set of primer probes for simultaneously detecting the American strain and the European strain of porcine reproductive and respiratory syndrome virus, characterized in that: Includes universal forward primers PRRSV1-F and PRRSV2-F, reverse primers PRRSV1-R and PRRSV2-R, universal probe PRRSV-P; The nucleotide sequence of the PRRSV1-F is shown in SEQ ID NO.1; the nucleotide sequence of the PRRSV2-F is shown in SEQ ID NO.2; the nucleotide sequence of the PRRSV1-R is shown in SEQ ID NO.3; the nucleotide sequence of the PRRSV2-R is shown in SEQ ID NO.4; The nucleotide sequence of the PRRSV-P is shown in SEQ ID NO.

5.

2. The primer probe set according to claim 1, characterized in that: The 5' end of the nucleotide sequence of the probe PRRSV-P is modified with a fluorescent reporter group, including FAM; and the 3' end is modified with a fluorescent quencher group, including BHQ1.

3. Use of the primer probe set according to claim 1 or 2 in the preparation of a product for simultaneously detecting the American strain and the European strain of porcine reproductive and respiratory syndrome virus.

4. The use according to claim 3, characterized in that: The products include kits.

5. A kit for simultaneously detecting the American strain and the European strain of porcine reproductive and respiratory syndrome virus, characterized in that: It comprises the primer probe set and reaction solution as described in claim 1 or 2.

6. The kit according to claim 5, characterized in that The reaction solution includes 2×One Step U+Mix and One Step U+Enzyme Mix.

7. A method for simultaneously detecting American and European strains of porcine reproductive and respiratory syndrome virus for non-diagnostic purposes, characterized in that: The following steps are involved: The sample to be tested is subjected to fluorescent PCR detection using the primer probe set described in claim 1 or 2 or the kit described in claim 5 or 6, and is determined to be positive when the Ct value is less than 38, and is determined to be negative when the Ct value is greater than or equal to 38.

8. The method according to claim 7, characterized in that Taking the RNA of the sample to be tested as a template, every 20 μL of the fluorescent PCR detection reaction system includes: 2×One Step U+Mix 10.0 μL, One Step U+Enzyme Mix 1.0 μL, 0.4 μL to 1.0 μL of 10 μmol / L PRRSV1-F, 10 μmol / L PRRSV2-F, 10 μmol / L PRRSV1-R and 10 μmol / L PRRSV2-R, 0.3 μL to 0.5 μL of 10 μmol / L PRRSV-P, 3 μL RNA and the remainder of water.

9. The method according to claim 7, characterized in that: The reaction procedure of the fluorescent PCR detection is: reverse transcription at 55°C for 15 min, pre-denaturation at 95°C for 10 sec, cycle reaction at 95°C for 10 sec, 60°C for 30 sec, and 45 cycles.

Images