Primer probe group for detecting brucella and real-time fluorescent quantitative PCR (Polymerase Chain Reaction) detection kit
By designing and applying specific primer probe sets and combining real-time fluorescence quantitative PCR technology, the problem of low sensitivity of existing Brucella detection methods is solved, achieving higher sensitivity and rapid detection effects.
Patent Information
- Application Number
- CN202510109831.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-23
- Publication Date
- 2025-03-18
AI Technical Summary
The existing Brucella detection method based on TaqMan probe method has low detection sensitivity and is difficult to meet the needs of fast and accurate detection.
A primer probe set including upstream primers, downstream primers and probes was designed. The 5' end of the probe is modified with reporter groups and the 3' end is modified with quenching groups. The rapid and quantitative detection of Brucella is achieved through real-time fluorescence quantitative PCR technology.
It improves the detection sensitivity of Brucella, can accurately detect Brucella at a concentration of 500copies/mL, and has high specificity and rapid detection capabilities.
Smart Images
Figure CN119639933A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of molecular biology, and in particular relates to a primer probe set for detecting Brucella and a real-time fluorescence quantitative PCR detection kit. Background Art
[0002] Brucella is a Gram-negative, non-flagellated intracellular parasite belonging to the genus Brucella and is the pathogen of brucellosis. The bacterium is short rod-shaped, about 0.5 to 1.5 μm in size, and has strict aerobic metabolic characteristics. Brucella mainly infects livestock and wild animals, such as cattle, sheep, goats and pigs, and can also infect humans through direct contact, aerosol inhalation or consumption of contaminated animal products, causing zoonotic diseases. Its pathogenic mechanism relies on invading macrophages to avoid lysosomal degradation, using intracellular survival strategies to achieve persistent infection, and spreading to the host's liver, spleen and bone marrow through the blood or lymphatic system, causing chronic granulomatous inflammation. In animal husbandry, the disease can cause problems such as abortion and infertility in animals, resulting in huge economic losses. Although vaccines and quarantine measures play an important role in animal control, the prevention of human infection relies on a comprehensive strategy of occupational protection, food safety and antibiotic treatment.
[0003] The detection of Brucella is a key link in the prevention and control of brucellosis, involving a variety of methods to ensure rapid and accurate identification of pathogens. Traditional culture methods are regarded as the "gold standard" for detection, which can isolate live bacteria and identify species, but their operation is complicated, time-consuming, and has high requirements for laboratory biosafety, so they are subject to certain limitations in practical applications. Serological methods, such as red bengal plate agglutination test (RBPT), complement fixation test (CFT), and enzyme-linked immunosorbent assay (ELISA), are widely used for large-scale screening due to their simplicity and high sensitivity, but there is a risk of false positives or false negatives, especially in chronic or latent infections. The rise of molecular biological detection technology has significantly improved the detection efficiency of Brucella. The Taq Man probe method has strong detection specificity, high sensitivity, and convenient optimization of reaction conditions, and can be used for rapid detection of Brucella. However, the detection sensitivity of the existing Brucella detection method based on the TaqMan probe method needs to be improved. Summary of the invention
[0004] The purpose of the present invention is to provide a primer probe set and a real-time fluorescence quantitative PCR detection kit for detecting Brucella. The primer probe set of the present invention can realize a more sensitive TaqMan probe real-time fluorescence quantitative PCR detection of Brucella, solving the problem of low sensitivity in existing detection technologies.
[0005] The present invention provides a primer-probe group for detecting Brucella, comprising an upstream primer, a downstream primer and a probe; the nucleotide sequence of the upstream primer is shown in SEQ ID NO.1, the nucleotide sequence of the downstream primer is shown in SEQ ID NO.2, and the sequence of the probe is shown in SEQ ID NO.3.
[0006] Preferably, the 5' end of the probe is modified with a reporter group, and the 3' end is modified with a quencher group.
[0007] Preferably, the reporter group includes FAM, VIC, Cy5 or JOE; and the quencher group includes MGB or TAMRA.
[0008] Preferably, the reporter group is FAM; and the quencher group is MGB.
[0009] The present invention also provides the use of the primer probe group described in the above technical solution in preparing a kit for detecting Brucella.
[0010] The present invention also provides a kit for detecting Brucella, comprising the primer probe set and reaction reagents described in the above technical solution.
[0011] Preferably, the kit comprises a real-time fluorescence quantitative PCR kit.
[0012] Preferably, when the kit is a real-time fluorescence quantitative PCR kit, the reaction reagents include universal freeze-dried microspheres for qPCR amplification.
[0013] Preferably, every 25 μL of the reaction system of the kit includes 1 universal freeze-dried microsphere for qPCR amplification, 0.4 μL of upstream primer, 0.4 μL of downstream primer, 0.4 μL of probe and 23.8 μL of template.
[0014] Preferably, the reaction program of the kit includes 40 cycles of pre-denaturation at 95°C for 10 s, denaturation at 95°C for 5 s, annealing and extension at 60°C for 30 s.
[0015] The present invention provides a primer probe set for detecting Brucella. The primers and probes of the present invention can realize rapid and quantitative detection of target genes, and achieve the purpose of accurate, highly sensitive and highly specific quantitative detection of Brucella. The test results show that the Brucella-specific primer probe has no cross reaction with other recombinant plasmids; the primers and probes have good amplification efficiency for Brucella-specific genes; and the detection limit is not less than 500 copies / mL. BRIEF DESCRIPTION OF THE DRAWINGS
[0016] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative labor.
[0017] Figure 1 The present invention provides a probe specificity experimental result diagram; wherein, a represents the recombinant plasmid sample of Brucella specific gene + the mixed sample of recombinant plasmids of 4 pathogenic bacteria (Bacillus mallei (GenBank: JN581992.1), Rickettsia burnetii (GenBank: DQ882619.1), Francisella tularensis (GenBank: JPCAPHH3013), Yersinia pestis (GenBank: JC186715.1)), b represents the mixed sample of recombinant plasmids of 4 pathogenic bacteria (Bacillus mallei (GenBank: JN581992.1), Rickettsia burnetii (GenBank: DQ882619.1), Francisella tularensis (GenBank: JPCAPHH3013), Yersinia pestis (GenBank: JC186715.1)), and c represents the negative control.
[0018] Figure 2 This is a Brucella detection amplification curve provided by the present invention; wherein a represents the plasmid concentration of 1.00×10 9 copies / mL, b represents the plasmid concentration of 1.00×10 8 copies / mL, c represents the plasmid concentration of 1.00×10 7 copies / mL, d represents the plasmid concentration of 1.00×10 6 copies / mL, e represents the plasmid concentration of 1.00×10 5 copies / mL, f represents the plasmid concentration of 1.00×10 4 copies / mL and g represent negative controls.
[0019] Figure 3 Brucella standard curve provided by the present invention;
[0020] Figure 4 This is a graph of the Brucella detection limit results provided by the present invention; wherein a represents the negative control, and the other amplification curves all represent a plasmid concentration of 500 copies / mL. DETAILED DESCRIPTION
[0021]
[0022] The present invention also provides the use of the primer probe set described in the above technical solution in preparing a kit for detecting Brucella. The kit prepared by the primer probe set of the present invention has higher detection sensitivity.
[0023] The present invention also provides a kit for detecting Brucella, comprising the primer probe set and reaction reagents described in the above technical solution. In a specific embodiment, the kit comprises a real-time fluorescence quantitative PCR kit. In a specific embodiment, when the kit is a real-time fluorescence quantitative PCR kit, the reaction reagent comprises universal freeze-dried microspheres for qPCR amplification. The present invention does not specifically limit the source of the universal freeze-dried microspheres for qPCR amplification, and conventional commercially available products can be used, such as those purchased from Gene Egg Biotechnology Co., Ltd. In a specific embodiment, the reaction system of each 25 μL of the kit comprises 1 universal freeze-dried microsphere for qPCR amplification, 0.4 μL of upstream primer, 0.4 μL of downstream primer, 0.4 μL of probe, and 23.8 μL of template. In a specific embodiment, the reaction procedure of the kit comprises 95°C pre-denaturation for 10s, 95°C denaturation for 5s, 60°C annealing extension for 30s, and 40 cycles. Using the kit of the present invention to perform real-time fluorescence PCR detection on Brucella can achieve the purpose of quantitatively detecting the target gene, and the detection is fast, sensitive and specific.
[0024] The present invention provides a real-time fluorescence quantitative PCR method for detecting Brucella. The present invention uses the primer probe set or the kit described in the above technical scheme to perform the detection of the real-time fluorescence quantitative PCR method. In a specific embodiment, the reaction system of the real-time fluorescence quantitative PCR method includes 1 universal freeze-dried microsphere for qPCR amplification, 0.4 μL of upstream primer, 0.4 μL of downstream primer, 0.4 μL of probe and 23.8 μL of template. In a specific embodiment, the reaction procedure of the real-time fluorescence quantitative PCR method includes 95°C pre-denaturation for 10s, 95°C denaturation for 5s, 60°C annealing extension for 30s, and 40 cycles. In a specific embodiment, after determining the Brucella-specific gene and designing the primer probe group described in the above technical scheme, the present invention constructs a DNA standard (a plasmid constructed with a target gene, a target gene fragment GenBank: MN910308.1; the basic plasmid is pUC57), uses the gradient-diluted target gene-constructed plasmid as a template, carries out a reaction, prepares a standard curve, and performs Brucella detection; the detection includes specific detection or determination of the minimum detection limit or quantitative detection.
[0025] To further illustrate the present invention, a primer probe set and a real-time fluorescence quantitative PCR detection kit for detecting Brucella provided by the present invention are described in detail below in conjunction with the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.
[0026] Example 1
[0027] Real-time fluorescence quantitative PCR method for detecting Brucella using TaqMan probe
[0028] Search and verify the specific gene sequences of Brucella from the NCBI database. The target gene sequence of Brucella is: 1atggaccaca cgagtttcac cgaaatctgc ctccaccaac tgaaaatgtccggtgtgcgc61aacggcgaac gccttgtcgt gctcacgcag ggcaacgaac ggctggacta tgccaatgca121ttcctcgccg cgggccagcg tctgggcgct aacatgtacc atatgcgtct gccggcgcct181ttgccgacgg gcggctggaa cgtcggcgtc acgggtctgg ccgcaatgcc agatgcggtt241gaagctctga agaattgtga catgctggtt gactgcatct ttcttctgtt ctcgccagag301cagatggcga ttcaggcagc ggggacgcgt gttctgacgg ctgtcgagcc accagaattg361cttgcccgca tgctaccgta tcaggagctg cgcgaaaagg tcgagatcgg gggagatatc421ctttcgaagg ccaaagttat gcggatcact tcgccacacg gtactgacgt cacctacaaa481cttaacacct atccaacggt cacggaatac gcctgcaccg acgagccgggccgatgggat541cattggccgt ccggcttcgt ctttaccggc ggcgatgacg acggcgtcgatggccagatt 601gtcgtcgcgc cgggcgatat cctgctgccg cagaatattt atgtgcgtgagccgatcatc 661tacacgatcg agaagggctg gatcaccgac attcgcgggg gcctcgatgccgagatcgtg 721aagtcctaca tggagtcgtt taacgatcca aagggcatgg gcatgagccatgttggttgg 781ggcatgaacc caaatgccaa atggcacaat ttcgtgcctg gtgcattcccgggtggcatg841gggatggagc cacgttcgtt ctacggcaat gtgatgttct cgacgggccccaacaacgag 901cttggcggct cgaacgacac ccattgccat ctcgacattc caatgcggggttgctctctg 961ttccttgacg ataaggcgat cgtcatcgac ggcgacatcg tagtgccggacatgaaaatg1021gaacgataa(SEQ ID NO.4);
[0029] Primers and probes were designed based on the obtained target genes and the specificity was verified by BLAST, and the results showed good specificity.
[0030] Real-time fluorescence quantitative PCR upstream primer: 5'-GTCAGTACCGTGTGGCGAAGT-3' (SEQ ID NO.1), downstream primer: 5'-TATCAGGAGCTGCGCGAAA-3' (SEQ ID NO.2); probe sequence: 5'-AAGGCCAAAGTTATGCG-3 (SEQ ID NO.3)'; the fluorescent reporter group labeled at the 5' end of the probe is FAM, and the fluorescent quencher group labeled at the 3' end is MGB; the primers and probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd.
[0031] The target gene fragment of Brucella was inserted into the vector pUC57 to obtain a recombinant plasmid containing the specific gene fragment of Brucella, which was used as a standard. The construction, purification and linearization of the recombinant plasmid were provided by General Biotechnology (Anhui) Co., Ltd. Brucella gene standard, composed of 1.00×10 9 copies / mL, 1.00×10 8 copies / mL, 1.00×10 7 copies / mL, 1.00×10 6 copies / mL, 1.00×10 5 copies / mL, 1.00×10 4 copies / mL of the recombinant plasmid composition, and TE was used as a negative control;
[0032] Establish a real-time fluorescence quantitative PCR detection method.
[0033] Brucella specific gene amplification was performed using qPCR amplification universal freeze-dried microspheres from GeneDan Biotechnology Co., Ltd. The amplification system is shown in Table 1, where primers and probes were diluted to 10 μM with TE. Fluorescence quantitative PCR was performed on an ABI StepOnePlus fluorescence quantitative PCR, and the reaction program was: 95°C pre-denaturation for 10 s, 95°C denaturation for 5 s, 60°C annealing and extension for 30 s, and 40 cycles.
[0034] Table 1 Components of Fluorescence Quantitative PCR Amplification System
[0035] Element Volume / Number qPCR amplification universal lyophilized microspheres 1 Probe (10 μM) 0.4μL Upstream primer (10 μM) 0.4μL Downstream primer (10 μM) 0.4μL template 23.8μL
[0036] Verification of Brucella primer-probe specificity experiment
[0037] In order to verify the specificity of the Brucella primer probe, the recombinant plasmid templates used to detect the specific gene of Brucella and the mixed templates of the recombinant plasmids of the other four pathogens (Bacillus mallei (GenBank: JN581992.1), Rickettsia burnetii (GenBank: DQ882619.1), Francisella tularensis (GenBank: JPCAPHH3013), Yersinia pestis (GenBank: JC186715.1, the recombinant plasmids of the above four pathogens were prepared: each specific gene was constructed on the pUC57 plasmid vector plasmid), TE was used as a negative control, the amplification system is shown in Table 1, and the fluorescence quantitative PCR reaction program was: 95℃ pre-denaturation for 10s, 95℃ denaturation for 5s, 60℃ annealing and extension for 30s, and 40 cycles. The results are shown in Figure 1 , Brucella-specific primer probes had no cross-reaction with other recombinant plasmids.
[0038] Preparation of standard amplification curve of Brucella
[0039] 1. The purified linearized plasmid standard plasmid provided by General Biotechnology (Anhui) Co., Ltd. was calculated according to the formula copy number = plasmid concentration * Avogadro constant / molecular weight / molecular length. The copy number was calculated and then graded diluted with TE to obtain Brucella gene standards with a series of concentrations of 1.00 × 10 9 copies / mL, 1.00×10 8 copies / mL, 1.00×10 7 copies / mL, 1.00×10 6 copies / mL, 1.00×10 5 copies / mL, 1.00×10 4 copies / mL.
[0040] 2. Using the gradient-diluted DNA standard as a template (selecting 6 points), with TE as the negative control, add them to the 8-well strip tubes according to the system in Table 1, and perform the reaction on the ABI StepOnePlus real-time PCR instrument under the following reaction conditions: pre-denaturation at 95°C for 10 s, denaturation at 95°C for 5 s, annealing and extension at 60°C for 30 s, for 40 cycles. After the reaction, obtain the standard amplification curve (as shown in Figure 2 ), and plot the standard curve (as shown in Figure 3 ) to obtain the linear regression fitting equation y = -3.52logC + 44.25. This equation shows a good linear relationship (R 2 > 0.99), and the amplification efficiency E = 10 (-1 / k) -1 = 10 (-1 / -3.52) -1 = 1.923 - 1 = 92.3% is relatively high (80% < E < 120%). The constructed standard curve can be used to quantify the copy number of genes in the actual sample. The results show that the designed primers and probes have good amplification efficiency for the specific gene of Brucella.
[0041] Determination of the detection limit of Brucella
[0042] 1. For the purified linearized plasmid standard plasmid provided by General Biology (Anhui) Co., Ltd., calculate the copy number according to the formula: copy number = plasmid concentration * Avogadro's constant / molecular weight / molecular length, calculate the copy number, and first dilute it to 5.00×10 10 copies / mL with TE, and then perform a series of 10-fold gradient dilutions with TE to finally obtain a Brucella gene standard with a concentration of 500 copies / mL.
[0043] 2. Using the gradient-diluted DNA standard as a template, with TE as the negative control, add them to the 8-well strip tubes in sequence according to the system in Table 1, and perform the reaction on the ABI StepOnePlus real-time PCR instrument under the following reaction conditions: pre-denaturation at 95°C for 10 s, denaturation at 95°C for 5 s, annealing and extension at 60°C for 30 s, for 40 cycles. After the reaction, obtain the lowest detection limit amplification graph (as shown in Figure 4 ). The results show that under the condition of the Brucella gene standard of 500 copies / mL, the 500 copies / mL Brucella gene standard is detected as positive, and its negative control is negative, indicating that the detection limit of this method is not lower than 500 copies / mL.
[0044] Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, not all embodiments. People can also obtain other embodiments based on this embodiment without creative efforts, and these embodiments all belong to the protection scope of the present invention.
Claims
1. A primer probe set for detecting Brucella, characterized in that, It comprises an upstream primer, a downstream primer and a probe; the nucleotide sequence of the upstream primer is shown as SEQ ID NO.1, the nucleotide sequence of the downstream primer is shown as SEQ ID NO.2, and the sequence of the probe is shown as SEQ ID NO.
3.
2. The primer probe set according to claim 1, characterized in that: The 5' end of the probe is modified with a reporter group, and the 3' end is modified with a quencher group.
3. The primer probe set according to claim 2, characterized in that: The reporter group includes FAM, VIC, Cy5 or JOE; the quencher group includes MGB or TAMRA.
4. The primer probe set according to claim 2, characterized in that: The reporter group is FAM; the quencher group is MGB.
5. Use of the primer probe set according to any one of claims 1 to 4 in preparing a kit for detecting Brucella.
6. A kit for detecting Brucella, characterized in that, The method comprises the primer probe set and reaction reagents as described in any one of claims 1 to 3.
7. The kit according to claim 6, characterized in that The kit comprises a real-time fluorescence quantitative PCR kit.
8. The kit according to claim 7, characterized in that When the kit is a real-time fluorescence quantitative PCR kit, the reaction reagents include universal freeze-dried microspheres for qPCR amplification.
9. The kit according to claim 8, characterized in that Each 25 μL reaction system of the kit includes 1 universal freeze-dried microsphere for qPCR amplification, 0.4 μL of upstream primer, 0.4 μL of downstream primer, 0.4 μL of probe and 23.8 μL of template.
10. The kit according to claim 8, characterized in that The reaction program of the kit includes 95°C pre-denaturation for 10 s, 95°C denaturation for 5 s, 60°C annealing and extension for 30 s, and 40 cycles.