Application of GB1107 in preparation of medicine for relieving cisplatin-induced acute kidney injury

Abstract

The invention discloses a novel application of GB1107, namely an application of GB1107 in preparation of a medicine for relieving cisplatin-induced acute kidney injury. The application discovers that GB1107 can be used for alleviating tubule inflammation and apoptosis and alleviating cisplatin-related acute kidney injury by inhibiting the activity of renal tubule galactose agglutination 3 (Gal3), and can be an effective clinical medicine for preventing and treating AKI.

Description

Technical Field

[0001] The present invention relates to a new drug application of GB1107, and in particular to an application of GB1107 in the preparation of a drug for alleviating acute kidney injury caused by a chemotherapy drug, cisplatin. Background Art

[0002] Acute kidney injury (AKI) is a rapid deterioration of renal function and extensive death of renal tubular epithelial cells. The causes of AKI are diverse, including drug nephrotoxicity, sepsis, and ischemia-reperfusion injury. Of note, drug-induced AKI accounts for 19-26% of all hospitalized cases. Cisplatin is a widely used chemotherapy drug for the treatment of a variety of malignancies, including lung cancer, ovarian cancer, and breast cancer, but it is nephrotoxic. Clinically, the incidence of nephrotoxicity in patients treated with cisplatin is 20% to 35% [Fang CY, Lou DY, Zhou LQ, Wang JC, Yang B, He QJ, Wang JJ, Weng QJ. Natural products: potential treatments for cisplatin-induced nephrotoxicity. Acta Pharmacol Sin. 2021 Dec; 42(12): 1951-1969.]. The pathogenic mechanisms associated with cisplatin-induced AKI include tubular cell apoptosis, necrosis, inflammatory response, oxidative stress, and mitochondrial dysfunction. Therefore, based on these pathophysiological mechanisms, proposing specific and effective treatment strategies to deal with cisplatin-induced AKI is a clinical priority.

[0003] GB1107 is a potent, selective, orally active inhibitor of galactose aggregate 3 (Gal3), with a Kd value of 37 nM for human Gal3. Its structural formula is:

[0004]

[0005] GB1107 can reduce the growth of human and mouse lung adenocarcinoma and inhibit metastasis. [Vuong L, et al. An orally active galectin-3 antagonist inhibits lung adenocarcinoma growth and augments response to PD-L1 blockade. Cancer Res. 2019 Jan 23. pii: canres. 2244. 2018]. CN114272382A discloses the use of GB1107 in antiplatelet aggregation drugs, but there is no public literature reporting that GB1107 can reduce cisplatin-induced acute kidney injury. Summary of the invention

[0006] Purpose of the invention: The present invention discloses a new pharmaceutical use of GB1107. Specifically, the present invention proposes the use of GB1107 in the preparation of a drug for alleviating cisplatin-induced acute kidney injury, providing a new medication option for AKI.

[0007] Specifically, the present study found that GB1107 can improve renal damage and renal function in cisplatin-induced acute kidney injury.

[0008] In the cisplatin-induced acute kidney injury model, GB1107 downregulated the level of KIM-1 protein in kidney tissue.

[0009] At the same time, the study in this application showed that GB1107 improved cisplatin-induced renal tubular cell apoptosis and immune inflammatory damage.

[0010] In an in vitro renal tubular epithelial cell model, GB1107 alleviated cisplatin-induced renal tubular epithelial cell apoptosis and lipopolysaccharide (LPS)-induced inflammatory factors IL6 and TNFα levels.

[0011] Beneficial effects: GB1107 proposed in this application solves the technical problem that there is no suitable drug in the prior art for treating renal structure and function damage caused by cisplatin. Intervention therapy with GB1107 in cisplatin mouse models and in vitro cells can improve renal structure and function, tubular cell inflammation and apoptosis in acute kidney injury; our discovery will most likely provide effective clinical drugs for the prevention and treatment of AKI. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 GB1107 was shown to improve renal injury and renal function in cisplatin-induced acute kidney injury and down-regulate KIM-1 protein levels in renal tissues;

[0013] Figure 2 GB1107 improved cisplatin-induced tubular cell apoptosis and macrophage infiltration;

[0014] Figure 3 It was shown that in an in vitro renal tubular epithelial cell model, GB1107 significantly reduced cisplatin-induced renal tubular epithelial cell apoptosis and lipopolysaccharide (LPS)-induced inflammatory factors IL6 and TNFα levels. DETAILED DESCRIPTION

[0015] The present invention is further described in detail below in conjunction with specific embodiments. The embodiments will help to understand the present invention, but the protection scope of the present invention is not limited to the following embodiments.

[0016] The materials and methods used in the following examples are as follows:

[0017] 1. Materials and reagents:

[0018] GB1107 was purchased from MCE, USA; cisplatin and lipopolysaccharide (LPS) from Escherichia coli 0111:B4 were purchased from Sigma, Gal3 and Kim1 antibodies were purchased from Abcam; Cleaved-caspase3 and Cleaved-PARP were purchased from CST; GAPDH and Tubulin antibodies were purchased from proteintech; creatinine kit was purchased from Elabscience; cell apoptosis detection kit and cell RNA extraction kit were purchased from Novazonics.

[0019] (II) Cell culture and treatment:

[0020] Human renal tubular epithelial cells (HK-2) were cultured in DMEM / F12 medium containing 10% fetal bovine serum, 1% penicillin and streptomycin at 37°C, 5% carbon dioxide and 95% air. To study the role of GB1107 in cisplatin-induced renal tubular epithelial cell injury, when HK-2 cells grew to 80% density, they were cultured in DMEM / F12 medium without fetal bovine serum, and GB1107 (dissolved in DMSO) was added for pretreatment for 0.5h or treated with DMSO in the same way, and cisplatin (25ug / ml) or LPS (10ng / ml) was added, and the cells were incubated in the incubator for 12h, and finally the cells were collected for Western Blot detection and qPCR analysis.

[0021] (III) Acute kidney injury mouse model and experimental groups:

[0022] Mice were randomly divided into two groups, 4 in each group, namely the cisplatin injection model group (Cisplatin+Vehicle) and the cisplatin+GB1107 group (Cisplatin+GB1107). GB1107 was dissolved in DMSO and administered by intraperitoneal injection at a dose of 5 mg / kg. Mice in the control group or GB1107 treatment group were intraperitoneally injected with GB1107 or 10% DMSO once 12 h before cisplatin injection. Cisplatin model mice were injected with 20 mg / kg of cisplatin intraperitoneally once, and blood samples were collected from the inner canthus of the mice 48 hours later; after 72 hours, mice in all groups were euthanized, and kidney and blood samples were collected. All animal experiments complied with the Regulations on the Management and Use of Laboratory Animals in China.

[0023] (IV) Renal function test:

[0024] The mouse blood samples were centrifuged at 3000 g for 15 min to collect serum components, and the serum creatinine index was detected using the Elabscience creatinine kit.

[0025] (V) Renal tubular injury score:

[0026] The degree of tubular damage was observed in the renal PAS pathological staining, and tubular damage was evaluated according to the semiquantitative injury scoring criteria, including necrotic tubules, loss of brush border, tubular dilatation, cast formation, tubular epithelial swelling and vacuolar degeneration: normal tubular tissue was scored as 0 points, slight damage (damaged tubules accounted for <5% of the total tubules) was scored as 1 point, mild damage (damaged tubules accounted for 5% to 25% of the total tubules) was scored as 2 points, moderate damage (damaged tubules accounted for 25% to 75% of the total tubules) was scored as 3 points; severe damage (damaged tubules accounted for >75% of the total tubules) was scored as 4 points.

[0027] (VI) Histological staining:

[0028] Kidney tissue was fixed with paraformaldehyde and wrapped in paraffin, and then histological staining was performed after tissue sectioning. The specific operation steps are as follows: paraffin-embedded sections, dewaxed to water, rinsed with distilled water, and rinsed with phosphate buffer saline (PBS) three times. Microwave repair was performed with Tris-EDTA alkaline antigen repair solution for 20 minutes, and then naturally cooled to room temperature. Rinse with PBS three times, block with 3% peroxidase blocking solution at room temperature for 15 minutes, and rinse with PBS three times. Block with 10% donkey serum at room temperature for 1 hour, decant, and add the corresponding primary antibody to incubate overnight at 4°C. The concentrations of the primary antibody were Kim1 (1:2000) and F4 / 80 (1:200). After rinsing with PBS three times, add the corresponding secondary antibody, incubate at room temperature for 1 hour, and rinse with PBS three times. Add DAB to color at room temperature to the appropriate depth, counterstain the nucleus with hematoxylin, rinse with running water to reverse blue, dehydrate and make it transparent, and finally seal the slide.

[0029] (VII) TUNEL staining

[0030] TUNEL staining was used to detect apoptosis of cisplatin-treated renal tissue or HK2 cells. 5 μm thick cryosections of renal tissue or HK2 cells were fixed with 4% paraformaldehyde for 15 minutes, then permeabilized with 0.2% Triton X-100 in 1× PBS at room temperature for 10 minutes, and then incubated with TUNEL reaction mixture at 37°C for 1 hour, and cell nuclei were labeled with DAPI. Under a fluorescent microscope, nuclear DNA fragments were positively stained, and apoptotic nuclei were green. Ten representative fields of view were randomly selected for each section, and the number of apoptotic cells per mm was counted. 2 The number of TUNEL-positive cells.

[0031] (VIII) Protein immunoblotting:

[0032] Total protein of kidney tissue was extracted by RIPA lysis buffer, and protein concentration was determined by BCA method. 20ug protein was loaded, 10% polyacrylamide gel electrophoresis (SDS.PAGE), and the protein was wet transferred to PVDF membrane by 400mA×40min fast transfer buffer, blocked at room temperature for 2h with 5% skim milk, eluted with TBST, and incubated overnight at 4℃. The membrane was washed 3 times with TBST, 10min each time, incubated with corresponding secondary antibody at room temperature for 1h, and then washed 3 times. Antigen-antibody complex was displayed by enhanced chemiluminescence (ECL), exposed and scanned by darkroom X-ray film, and protein quantification was performed by gray value analysis of the target band, and the relative expression of the target protein was expressed by the gray value of the target band / GAPDH or Tubulin gray value. The results of protein immunoblot (Western blot) were analyzed by grayscale using ImageJ software.

[0033] (IX) Flow cytometric detection of apoptosis:

[0034] Cultured human renal tubular epithelial cells were pretreated with GB1107 (5uM) for 0.5h, and then treated with cisplatin for 12h. The apoptosis level of cells was analyzed by flow cytometry. The cell experiment was repeated three times and the results were statistically analyzed.

[0035] 10. RT-qPCR:

[0036] use The Cell / Tissue Total RNA Isolation Kit V2 was used to extract total RNA from cultured HK2 cells. The purity and concentration of RNA were detected using a micro-spectrophotometer. When the OD260 / 280 ratio was in the range of 1.8-2.0, the purity of the extracted RNA was relatively ideal. III All-in-one RT SuperMix was used to reverse transcribe RNA into cDNA. The qPCR system was prepared using ChamQ SYBR qPCR Master Mix, and then the qPCR system was run on the QuantStudio 7 fast real-time fluorescence quantitative PCR instrument. The relative expression of the target gene was calculated using the CT value. The calculation formula was 2 -ΔΔCT The qPCR primer sequences involved are:

[0037] Human-GAPDH(Forward:GTCTCCTCTGACTTCAACAGCG,Reverse:ACCACCCTGTTGCTGTAGCCAA)

[0038] Human-IL6(Forward:AGACAGCCACTCACCTCTTCAG,Reverse:TTCTGCCAGTGCCTCTTTGCTG)

[0039] Human-TNFa(Forward:CTCTTCTGCCTGCTGCACTTTG,Reverse:ATGGGCTACAGGCTTGTCACTC)

[0040] 11. Statistical analysis:

[0041] Statistical data were expressed as mean ± standard deviation. GraphPad Prism software was used for statistical analysis. T-test was used for comparison between two groups, and one-way analysis of variance (ANOVA) was used for comparison between multiple groups. P < 0.05 was considered statistically significant.

[0042] Example 1 In the cisplatin-induced acute kidney injury model, GB1107 improved renal injury and renal function in cisplatin-induced acute kidney injury and downregulated the KIM-1 protein level in renal tissue.

[0043] In order to evaluate the role of GB1107 in protecting against cisplatin-induced acute kidney injury, we detected kidney-related biochemical indicators in mouse serum. After intraperitoneal injection of cisplatin for 48 and 72 hours, serum creatinine (Scr) index increased significantly ( Figure 1 A), PAS pathological staining of kidney ( Figure 1 B) showed that pathological damage such as tubular dilatation and necrosis was also more serious, and after GB1107 treatment, the corresponding renal damage and renal function indicators decreased. In addition, the renal tubular injury score also suggested that GB1107 treatment could improve the renal pathological damage caused by cisplatin ( Figure 1 C). Therefore, GB1107 can not only improve renal function, but also reduce renal pathological damage. These results show that GB1107 can protect against cisplatin-induced acute renal injury, and it has no significant toxic side effects.

[0044] To further demonstrate the role of GB1107 in protecting against cisplatin-induced acute kidney injury, we detected KIM-1, an early specific biomarker of acute kidney injury. Figure 2 Western blot Figure 1 D-1E), immunohistochemistry ( Figure 1 F) The test results showed that KIM-1 was highly expressed in the kidneys of mice with cisplatin-induced acute kidney injury. After treatment with GB1107, its expression level decreased significantly, indicating that GB1107 can improve cisplatin-induced acute kidney injury.

[0045] Example 2 In the cisplatin-induced acute kidney injury model, GB1107 improved cisplatin-induced renal tubular immune inflammatory injury and cell apoptosis;

[0046] We further explored the possible mechanism of action of GB1107. Previous studies have reported that Gal3 plays an important role in cell apoptosis and inflammation (Li HY, Yang S, Li JC, Feng JX. Galectin 3 inhibition attenuates renal injury progression in cisplatin-induced nephrotoxicity. Biosci Rep. 2018 Dec 18; 38(6): BSR 2018 1803. Bouffette S, Botez I, De Ceuninck F. Targeting galectin-3 in inflammatory and fibrotic diseases. Trends Pharmacol Sci. 2023 Aug; 44(8): 519-531.). As a Gal3 inhibitor, it may play a role by inhibiting cell apoptosis and infiltration of inflammatory cells. TUNEL staining results showed that the apoptosis of tubular cells in the kidney tissue of the GB1107-treated group was alleviated ( Figure 2 A-2B). Immunohistochemistry ( Figure 2 C-2D) The detection results showed that F4 / 80 was highly expressed in the kidneys of mice with cisplatin-induced acute kidney injury. After treatment with GB1107, its expression level decreased, indicating that GB1107 can reduce the infiltration of macrophages in cisplatin-induced acute kidney injury.

[0047] Example 3 In an in vitro renal tubular epithelial cell model, GB1107 reduced cisplatin-induced renal tubular epithelial cell apoptosis and lipopolysaccharide (LPS)-induced inflammatory factors IL6 and TNFα levels.

[0048] Furthermore, using renal tubular epithelial cells cultured in vitro, western blot results showed that apoptosis-related proteins Cleaved-caspase3 and Cleaved-PARP were downregulated after GB1107 treatment, and the downregulation was concentration-dependent ( Figure 3 A-3C). Subsequently, GB1107 (5uM) was pretreated for 0.5h, and then 25ug / ml cisplatin was added for further 12h. The cells were collected and the apoptosis level was detected by flow cytometry. The results showed that GB1107 could improve cisplatin-induced apoptosis ( Figure 3 D-3E). In addition, TUNEL staining results also showed that GB1107 treatment could alleviate cisplatin-induced HK2 cell apoptosis ( Figure 3 F-3G). To further explore whether GB1107 can inhibit the expression of inflammatory factors, we detected the mRNA levels of inflammatory factors IL6 and TNFα in HK2 cells treated with LPS by qPCR. The results showed that GB1107 could reduce the expression levels of inflammatory factors ( Figure 3 H-3I).

[0049] In summary, the present invention provides a use of a Gal3 inhibitor GB1107 in the preparation of a drug for alleviating cisplatin-induced acute kidney injury-related symptoms. The drug is administered by intraperitoneal injection, and the mouse dose is 5 mg / kg. It inhibits Gal3 activity in the renal tubules, reduces tubular inflammation and apoptosis, and thus slows down cisplatin-related acute kidney injury.

[0050] The present invention provides a new pharmaceutical use of GB1107. There are many methods and approaches to implement the technical solution. The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be considered as the protection scope of the present invention. All components not specified in this embodiment can be implemented by existing technologies.

Claims

1. Use of GB1107 in the preparation of a drug for alleviating cisplatin-induced acute kidney injury, wherein the structural formula of GB1107 is: 。 2. The use according to claim 1, characterized in that: GB1107 improved renal injury and renal function in cisplatin-induced acute kidney injury, and GB1107 downregulated KIM-1 protein levels in renal tissue.

3. The use according to claim 1, characterized in that: GB1107 improved cisplatin-induced renal tubular cell apoptosis and immune-inflammatory injury.

4. The use according to claim 1, characterized in that: GB1107 alleviated cisplatin-induced apoptosis of human proximal tubular epithelial cells and the expression levels of inflammatory factors IL-6 and TNFα induced by lipopolysaccharide.

Images