MiR-21-5p and application of small extracellular vesicles containing MiR-21-5p in preparation of age-related diabetes anti-aging drugs

Abstract

The invention discloses miR-21-5p and application of small extracellular vesicles containing the miR-21-5p in preparation of age-related diabetes mellitus anti-aging drugs, the small extracellular vesicles are small extracellular vesicles which are secreted by human amniotic mesenchymal stem cells and contain the miR-21-5p, and on the premise that the number of pancreas islet beta cells is not reduced, the small extracellular vesicles contain the miR-21-5p. In-vivo and in-vitro beta cell senescence phenotypes are remarkably reversed, and the beta cell insulin secretion capacity and the number of functional beta cells are recovered. The miR-21-5p rich in the small extracellular vesicles directly targets a 3 '-UTR region of IL-6RA mRNA in an aged beta cell and inhibits an IL-6RA / pSTAT3 pathway, so that the small extracellular vesicles are further applied to preparation of anti-aging drugs for treating age-related diabetes mellitus, and the problem that current anti-aging treatment methods for type 2 diabetes mellitus are deficient is solved.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to the use of human amniotic mesenchymal stem cell-derived small extracellular vesicles and their active ingredient miRNA in the preparation of an anti-aging drug for treating age-related diabetes. Background Art

[0002] Aging is characterized by a gradual slowing down of physiological and metabolic processes, accompanied by a decline in tissue and organ integrity, which shortens the lifespan of biological individuals. With the rapid advancement of population aging, age-related diseases (diabetes, cardiovascular disease, Alzheimer's disease, and cancer) have gradually become the main components of global morbidity, mortality, and medical expenses. The aging process is associated with genomic instability, telomere shortening, epigenetic changes, loss of protein homeostasis, autophagy dysfunction, nutrient sensing disorders, mitochondrial dysfunction, cellular senescence, stem cell exhaustion, altered intercellular communication, chronic inflammation, and dysbiosis. In response to these aging characteristics, scientists around the world are actively exploring various interventions to rejuvenate and extend lifespan, including metabolic regulation (calorie restriction), partial cell reprogramming, heterochronic parabiosis, senescent cell clearance, and stem cell-based therapies.

[0003] The accumulation of senescent cells is the root cause of age-related diseases. Type 2 diabetes mellitus (T2DM) is a typical age-related disease. It is a metabolic syndrome characterized by insulin resistance and β-cell dysfunction. It can cause a variety of complications including cardiovascular, renal, retinal and neuropathy, which seriously threatens human health life expectancy. Studies have found that elderly patients account for nearly half of diabetic patients, and the incidence of diabetes in the elderly is more than three times that of adults. my country has the largest number of diabetic patients in the world, reaching 141 million; the number of undiagnosed diabetes also ranks first in the world. Therefore, the base of elderly T2DM patients is huge, and at the same time, such patients also face more severe challenges, such as hidden onset, large individual heterogeneity, complex comorbidities, high risk of hypoglycemia and high mortality, which brings major health problems and economic burdens to the country and families.

[0004] Recent studies have found that aging and obesity-induced senescence of pancreatic β cells is the key cause and core feature of the high incidence of T2DM in the elderly. The main clinical feature of T2DM in the elderly is postprandial hyperglycemia. Healthy β cells adapt to systemic insulin resistance to maintain normal blood sugar levels; while the adaptive failure of aging β cells leads to the occurrence of diabetes. Pancreatic β cells are the only cells in the body that are dedicated to secreting insulin. They continue to work throughout life to maintain blood sugar homeostasis, so they are susceptible to and accumulate the effects of aging and metabolic stress. The characteristics of aging β cells are proliferation arrest, loss of β cell identity (dedifferentiation and transdifferentiation), and reduced ability to respond to glucose, which leads to insufficient insulin secretion and imbalance of glucose homeostasis. At the same time, aging β cells also have the common characteristics of other aging cells, that is, the formation of a complex, multi-component senescence-associated secretory phenotype (SASP), including a variety of soluble factors and extracellular vesicles (EVs). These components act through autocrine or paracrine mechanisms to affect the behavior of aging cells themselves, neighboring cells, and the surrounding tissue microenvironment. This positive feedback mechanism accelerates the accumulation and spread of β-cell senescence in the pancreatic islets. In addition, obesity and other risk factors leading to insulin resistance also indirectly aggravate the senescence of β-cells, ultimately leading to the occurrence of chronic hyperglycemia. Recent studies have found that in diabetic animal models, the use of senescent cell clearance drugs ABT263 or a combination of quercetin and dasatinib can directly clear senescent β-cells, improve the function of remaining β-cells, and restore blood glucose levels in diabetic mice. The SASP-specific targeted drug ABT199 can reduce the secretion of inflammatory factors in the pancreatic islets of diabetic mice, reduce the immune cells infiltrating the pancreatic islets, and improve the function of β-cells. However, senescent cell clearance drugs directly reduce the total number of functional β-cells; and like SASP inhibitory drugs, they all have inevitable toxic effects and off-target effects. Therefore, there is an urgent need to develop more effective and safer anti-aging strategies targeting senescent β-cells to treat age-related diabetes.

[0005] At present, the treatment of T2DM includes hypoglycemic drugs and metabolic surgery. Although bariatric surgery is effective, it is still the main treatment for T2DM because of its large trauma and is only performed in extremely obese patients. Although these drugs can partially improve the hyperglycemic state, they cannot curb the continuous decline of β-cell function caused by aging. Especially in the treatment of elderly patients with T2DM, traditional drug therapy often ignores the reality of multi-organ function decline in the elderly population and the risk of hypoglycemia in the combined use of multiple hypoglycemic drugs. Therefore, it is particularly important to explore new drugs and innovative therapies that can safely and effectively intervene in or even reverse β-cell aging to combat age-related diabetes. The latest studies have shown that small extracellular vesicles (sEVs) from the young circulatory system and extended heterochronic parabiosis can extend the lifespan of old mice and reverse the age-related functional decline of multiple tissues, indicating that secreted factors from young cells or pluripotent stem cells may have anti-aging properties.

[0006] Human amniotic membrane mesenchymal stem cells (hAMSCs) are pluripotent stem cells extracted from perinatal fetal tissues, and their tissues are usually discarded as medical waste. Compared with other stem cells, hAMSCs are abundant, easy to obtain, and have no ethical issues. Moreover, these stem cells have a strong paracrine effect. However, the risk of immune rejection and tumorigenesis limits the clinical application of hAMSCs. sEVs are nanoscale, membrane-encapsulated vesicles secreted by cells that can carry a wealth of functional molecules (including miRNA, DNA, lipids, and proteins) to recipient cells. Compared with stem cell therapy, sEVs effectively inherit the functions of their parent cells while also successfully avoiding immune rejection and tumorigenesis. MiRNA is a class of highly conserved single-stranded non-coding RNAs with a length of about 22-23 bases. It mainly binds to the 3'-untranslated region (3'-UTR) of the target gene mRNA, inhibits its translation or promotes its degradation. It is the main executive molecule of post-transcriptional negative regulation of genes and participates in processes such as cell proliferation, differentiation, and function maintenance. Recent studies have found that miRNA not only plays a role in the cytoplasm, but can also be carried by sEVs and secreted outside the cell to participate in intercellular signaling. The diversity of its target genes and modes of action determines the diversity of its functions.

[0007] Patent document CN104382827A discloses the use of human amniotic mesenchymal stem cell exosomes, proving that human amniotic mesenchymal stem cell exosomes have anti-photoaging effects. However, there is no research to obtain a small extracellular vesicle derived from hAMSCs that reverses the aging of pancreatic β cells, nor is there any research finding that its active ingredient miRNA can be used to prepare anti-aging drugs for age-related diabetes. Summary of the invention

[0008] Purpose of the invention: The technical problem to be solved by the present invention is to address the deficiencies in the prior art and provide the use of MiR-21-5p and small extracellular vesicles containing it in the preparation of anti-aging drugs for age-related diabetes.

[0009] The present invention utilizes hAMSCs as a source of young cells and assumes that hAMSC-sEVs, as anti-aging factors secreted by these young cells (a nanoscale anti-aging drug), can be used to reverse β-cell aging and thus treat age-related diabetes.

[0010] Specifically, the present application discloses the use of MiR-21-5p in the preparation of a drug for reversing age-related diabetic pancreatic β cell aging. The nucleotide sequence of the miR-21-5p is specifically: UAGCUUAUCAGACUGAUGUUGA, as shown in SEQ ID No.1.

[0011] The age-related diabetes is type 2 diabetes induced by natural aging and the presence or absence of metabolic stress.

[0012] The present invention further discloses an application of small extracellular vesicles of mesenchymal stem cells in the preparation of a drug for reversing age-related diabetic pancreatic β cell aging. The small extracellular vesicles are small extracellular vesicles secreted by human amniotic mesenchymal stem cells and contain the miR-21-5p.

[0013] Wherein, the small extracellular vesicles are prepared by the following steps: (1) After isolating and culturing human amniotic mesenchymal stem cells, the fifth generation human amniotic mesenchymal stem cells are cultured in MEM α complete medium containing 5-10 vol% human platelet lysate until the cell confluence reaches 70-80%, and then washed with PBS several times, preferably twice, to obtain hAMSCs; (2) continuing to culture the hAMSCs obtained in step (1) in MEM α medium containing 0.6-1.0 vol% mesenchymal stem cell serum-free supplement for 18-24 hours; (3) Collect the cell culture supernatant, remove the cell components and precipitated impurities by gradient centrifugation (300g, 10min→2000g, 20min→12000g, 30min), and collect the supernatant; (4) Use a 0.22 µm pore size filter to remove cell debris. The precipitate obtained by centrifugation is the small extracellular vesicles; resuspend the precipitate in PBS buffer and store at -80°C for later use.

[0014] The application is characterized in that the diameter of the small extracellular vesicles is 80-200nm.

[0015] Preferably, in step (4), the centrifugation conditions are: centrifugation twice at a speed of 100,000-120,000 g, 180 min, 4° C.

[0016] The age-related diabetes is type 2 diabetes induced by natural aging and the presence or absence of metabolic stress.

[0017] Specifically, the small extracellular vesicle preparation is derived from human amniotic mesenchymal stem cells and mainly contains miRNA-21-5p, which can deliver miRNAs to aged β cells via intercellular transmission, directly target and bind to the 3'-UTR region of IL-6RA mRNA in aged β cells, inhibit the IL-6RA / pSTAT3 pathway, reverse the aging of pancreatic β cells, and then be used in the preparation of anti-aging drugs for the treatment of age-related diabetes, so as to solve the current shortage of anti-aging drugs for type 2 diabetes and poor safety.

[0018] Preferably, the small extracellular vesicles have a diameter of 80-200 nm and are obtained by separating the supernatant secreted by fifth-generation human amniotic mesenchymal stem cells through ultracentrifugation.

[0019] The purpose of the present invention is to provide the use of small extracellular vesicles in the preparation of anti-aging drugs for the treatment of age-related diabetes, wherein, when studying the in vivo therapeutic effect of small extracellular vesicles, aged mice fed with high fat combined with low-dose STZ treatment are used as experimental subjects, and the aged mice refer to 18-24 month old wild-type C57BL / 6 mice. When studying the in vitro therapeutic effect of small extracellular vesicles and miRNA-21-5p, an in vitro β-cell aging model induced by various methods was constructed and used for verification.

[0020] The purpose of the present invention is to provide a drug for promoting the recovery of aging beta cell function (i.e., insulin secretion ability), the drug comprising small extracellular vesicles containing miRNA-21-5p; the dosage of small extracellular vesicles is 1 mg / kg body weight (1 mg / kg bw). The drug is injected into the tail vein of aged T2DM mice twice a week for a total of 8 weeks.

[0021] The present invention provides an application of small extracellular vesicles containing miRNA-21-5p derived from human amniotic mesenchymal stem cells in the preparation of a preparation for inhibiting β-cell aging.

[0022] Preferably, the inhibition of β-cell aging is to inhibit the expression of β-cell aging marker proteins, wherein the aging marker proteins include aging marker protein p16, DNA damage marker protein γH2A.X and β-cell aging characteristic protein IGF1R.

[0023] The present invention provides an application of small extracellular vesicles containing miRNA-21-5p derived from human amniotic mesenchymal stem cells in the preparation of a preparation for promoting functional maturation of aging β cells.

[0024] Preferably, the promoting functional maturation of aging β cells includes restoring the expression of β cell functional proteins PDX1 and MafA and inhibiting the expression of β cell dedifferentiation marker protein ALDH1A3.

[0025] The present invention provides a treatment plan for reversing age-related diabetic pancreatic β cell senescence without reducing the number of functional β cells, thereby avoiding the adverse effects of existing senescent cell clearance drugs. Beneficial Effects

[0026] The present invention discovers for the first time that MiR-21-5p can reverse the aging of pancreatic β cells in age-related diabetes, which has not been reported in the literature, and further provides the use of small extracellular vesicles containing MiR-21-5p in the preparation of anti-aging drugs for age-related diabetes. The small extracellular vesicles containing miR-21-5p described in the present invention can significantly inhibit the expression of β cell aging marker proteins p16, γH2A.X and IGF1R, reduce the expression of aging-associated secretory phenotype (SASP) factors, and restore the expression of β cell functional proteins PDX1 and MafA, thereby enhancing the GSIS function of β cells and increasing the serum insulin level of elderly diabetic mice, thereby achieving the therapeutic effect of reversing β cell aging in age-related diabetes. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] The present invention will be further described in detail below in conjunction with the accompanying drawings and specific embodiments, and the above and / or other advantages of the present invention will become more clear.

[0028] Figure 1 Shown are the characterization of hAMSCs and hAMSC-sEVs. Figure 1 A shows the flow cytometry identification of hAMSC's characteristic surface molecular markers. Figure 1 B shows the hAMSC morphology under an optical microscope and the staining after hAMSC differentiation into osteoblasts, adipocytes, and chondrocytes. Figure 1 C shows the preparation and identification process of hAMSC-sEVs by ultracentrifugation. Figure 1 D shows the expression of sEVs marker proteins (CD9, CD63, TSG101, Calnexin) analyzed by Western blot. Figure 1 E shows the transmission electron microscopy image of sEVs. Figure 1 F shows the results of sEVs nanoparticle tracking analysis.

[0029] Figure 2 Shown is that hAMSC-sEVs reversed the senescent phenotype of β cells. Figure 2 A shows the flow chart of hAMSC-sEVs intervention in H202-induced senescent β cells; Figure 2 B shows the confocal fluorescence microscopy imaging of hAMSC-sEVs labeled with PKH26 (red fluorescence) after being taken up by senescent β cells; Figure 2 CD shows representative images of SA-β-gal staining and quantitative analysis of SA-β-gal positive cells after senescent β cells were treated with hAMSC-sEVs; Figure 2 EF shows representative images of γ-H2AX immunofluorescence staining and quantitative analysis of γ-H2AX fluorescence intensity of senescent β cells after hAMSC-sEVs intervention; Figure 2 GH shows the representative Western blot images and quantitative analysis of senescence marker proteins (p53, p21, p16, and LaminB1) in senescent β cells after hAMSC-sEVs intervention; Figure 2 I shows the relative mRNA expression of senescence marker genes (Cdkn2a, Cdkn1a, Trp53, Lmnb1, and Igf1r) in senescent β cells after hAMSC-sEVs intervention; Figure 2 J shows the relative mRNA expression of SASP genes (IL1β, Il6, TNF-α, Ccl2, Cxcl10, Gdf15, Dusp3, and Hsp90aa1) after hAMSC-sEVs intervention.

[0030] Figure 3 Shown is that hAMSC-sEVs restore aged β-cell function. Figure 3 A shows the relative mRNA expression of β-cell functional genes (Ins1, MafA, Pdx1, Slc2a2) in aged β-cells after hAMSC-sEVs intervention; Figure 3 B shows the glucose-stimulated insulin secretion function test of β cells after hAMSC-sEVs intervention; Figure 3 CD shows the immunofluorescence staining and quantitative analysis of insulin (synthetic capacity) in β cells after hAMSC-sEVs intervention; Figure 3 EF shows the EDU (proliferation ability) fluorescence staining and quantitative analysis of β cells after hAMSC-sEVs intervention.

[0031] Figure 4 Shown are hAMSC-sEVs that rescue β-cell senescence in multiple aging models. Figure 4AB shows representative images of SA-β-gal staining and quantitative analysis of SA-β-gal positive cells in doxorubicin (DOX)-induced senescent β cells after hAMSC-sEVs intervention; Figure 4 CD shows representative images and quantitative analysis of γ-H2AX staining of DOX-induced senescent β cells after hAMSC-sEVs intervention; Figure 4 EF shows representative images and quantitative analysis of EdU staining of DOX-induced senescent β cells after hAMSC-sEVs intervention; Figure 4 G shows the representative Western blot images of senescence marker proteins (p53, p21, and p16) in DOX-induced senescent β cells after hAMSC-sEVs intervention; Figure 4 HI shows representative images of p16 (red) and insulin (green) immunofluorescence staining and quantitative analysis of p16-positive β cells in pancreatic islets from aged mice (18 months old) after hAMSC-sEVs intervention; Figure 4 JK shows representative images of γ-H2AX (red) and insulin (green) immunofluorescence staining and quantitative analysis of γ-H2AX-positive β cells in pancreatic islets from aged mice (18 months old) after hAMSC-sEVs intervention.

[0032] Figure 5 It was shown that hAMSC-sEVs improved pancreatic islet function and insulin sensitivity and lowered blood glucose in age-related diabetic mice. Figure 5 A shows the flow chart of the preparation of aged diabetic mouse model and hAMSC-sEVs administration. The mice were divided into three groups, NCD+PBS (control group), HFD+STZ+PBS (T2DM group) and HFD+STZ+hAMSC-sEVs (sEVs group), n=6 / group; Figure 5 B shows the fasting blood glucose monitoring of the three groups of mice; Figure 5 C shows the body weight monitoring of the three groups of mice; Figure 5 D shows the results of the intraperitoneal glucose tolerance test after the hAMSC-sEVs administration; Figure 5 E shows the results of the intraperitoneal insulin tolerance test after the hAMSC-sEVs administration; Figure 5 F shows the in vivo glucose-stimulated insulin secretion test after hAMSC-sEVs administration; Figure 5 GH shows the blood glucose and insulin tests after fasting and refeeding after hAMSC-sEVs administration; Figure 5 I shows the detection of β-cell function index in each group after hAMSC-sEVs administration.

[0033] Figure 6Shown is the reversal of the senescent phenotype of β cells in age-related diabetic mice by hAMSC-sEVs. Figure 6 AB shows the in vivo tracking of hAMSC-sEVs labeled with PKH26 and pancreatic islets in T2DM mice. (A) Representative IVIS images of living mice and organs (lung, liver, pancreas, spleen, kidney, fat). (B) Immunofluorescence staining of insulin (green) in pancreatic tissue of mice labeled with hAMSC-sEVs labeled with PKH26 (red). Figure 6 CD shows representative images of SA-β-gal galactosidase staining in pancreatic tissues of mice in the T2DM group, sEVs group, and control group, and quantitative analysis of the SA-β-galactosidase staining-positive areas in pancreatic islets; Figure 6 EF shows H&E staining of pancreatic tissues and quantitative analysis of islet areas in the three groups of mice; Figure 6 GH shows the immunofluorescence of insulin (green) and p16 (red) in pancreatic tissues of the three groups of mice and the quantitative analysis of p16 immunofluorescence intensity; Figure 6 IJ shows the immunofluorescence of insulin (green) and γ-H2AX (red) in pancreatic tissues of the three groups of mice and the quantitative analysis of the γ-H2AX immunofluorescence intensity; Figure 6 KL shows the immunofluorescence of insulin (green) and IGFIR (red) in pancreatic tissues of the three groups of mice and the quantitative analysis of the immunofluorescence intensity of IGF1R.

[0034] Figure 7 Shown is that hAMSC-sEVs promote the functional maturation of β cells in age-related diabetic mice. Figure 7 AB shows the immunofluorescence of insulin (green) and Pdx1 (red) in pancreatic tissue of mice in the T2DM group, sEVs group, and control group, as well as the quantitative analysis of Pdx1 immunofluorescence intensity; Figure 7 CD shows the immunofluorescence of insulin (green) and MafA (red) in pancreatic tissues of the three groups of mice and the quantitative analysis of MafA immunofluorescence intensity; Figure 7 EF shows the immunofluorescence of insulin (green) and ALDH1A3 (red) in pancreatic tissues of the three groups of mice and the quantitative analysis of ALDH1A3 immunofluorescence intensity; Figure 7 G shows the quantitative analysis of insulin content in immunofluorescence stained sections.

[0035] Figure 8 Shown are hAMSC-sEVs that improve systemic inflammatory status and metabolic indices in age-related diabetic mice. Figure 8AH show the inflammatory factors and metabolic parameters of the three groups of mice evaluated one month after the last hAMSC-sEVs administration, including (A) interleukin-1β (IL-1β), (B) interleukin-6 (IL-6), (C) tumor necrosis factor α (TNF-α), (D) CC chemokine ligand 2 (CCL2), (E) alanine aminotransferase (ALT), (F) aspartate aminotransferase (AST), (G) blood urea nitrogen (BUN), and (H) creatinine (CREA).

[0036] Fig. 9 Shown is that hAMSC-sEVs promote β-cell proliferation in age-related diabetic mice. Fig. 9 AB shows immunofluorescence of insulin (green) and PCNA (red) in pancreatic tissue of mice in the T2DM group, sEVs group, and control group, as well as quantitative analysis of PCNA-positive immune β cells.

[0037] Fig.10 The miRNA sequencing and anti-aging miRNA screening of hAMSC-sEVs are shown. Figure A shows the miRNA expression profiles of sEVs from three independent strains of hAMSCs (A10, A13, and A15), and a heat map of the top 20 expressed miRNAs is drawn; Figure B shows the KEGG enrichment analysis results of the target genes of the top 6 enriched miRNAs in hAMSC-sEVs; Figure C shows the qPCR quantitative analysis of TOP6 enriched miRNAs after β cells were treated with (sEV) or without (Ctrl) hAMSC-sEVs for 48 hours; Figure D shows SA-β-gal staining of senescent β cells overexpressing 4 candidate miRNAs or NC mimics. Figure E shows Western blot analysis of aging-related proteins after overexpression of 4 candidate miRNAs or NC mimics in senescent β cells.

[0038] Fig.11It shows that miR-21-5p is the main active ingredient of hAMSC-sEVs in reversing β-cell aging. Figure A shows the efficiency verification of silencing miR-21-5p in hAMSC-sEVs; Figure BC shows that 100ng / ul sEVs, negative control or normal sEVs were added to the aged β cells, and the SA-β-gal staining representative images and quantitative analysis after grouping treatment as shown in the figure were collected 48 hours later; Figure DE shows the representative images and quantitative analysis of γ-H2AX immunofluorescence staining of β cells after grouping treatment as shown in the figure; Figure FG shows the representative images and quantitative analysis of EDU staining of β cells after grouping treatment as shown in the figure; Figure H shows the GSIS detection of β cells after grouping treatment as shown in the figure; Figure I shows the detection of insulin synthesis ability of β cells after grouping treatment as shown in the figure; Figure J shows the detection of β cell aging marker genes after grouping treatment as shown in the figure; Figure I shows the representative images and quantitative analysis of β cell aging marker protein detection after grouping treatment as shown in the figure.

[0039] Fig.12 It shows the effect of miR-21-5p mimic mimic hAMSC-sEVs in reversing β-cell aging. Figure AB shows the representative pictures and quantitative analysis of SA-β-gal staining after aging β-cells were transfected with miR-21-5p mimic sequence (miR-21-5p mimic) or negative control sequence (NC mimic) for 48 hours; Figure CD shows the representative pictures and quantitative analysis of γ-H2AX immunofluorescence staining of β-cells after grouping and treatment as shown; Figure EF shows the representative pictures and quantitative analysis of EDU staining of β-cells after grouping and treatment as shown; Figure G shows the detection of insulin synthesis ability of β-cells after grouping and treatment as shown; Figure H shows the detection of GSIS of β-cells after grouping and treatment as shown; Figure I shows the detection of β-cell aging marker genes after grouping and treatment as shown; Figure JK shows the representative pictures and quantitative analysis of β-cell aging marker protein detection after grouping and treatment as shown.

[0040] Fig.13 The hAMSC-sEVs containing miR-21-5p target the IL-6RA-pSTAT3 axis to inhibit β-cell senescence. Figure A shows the intersection of potential target genes of miR-21-5p predicted by TargetScan and miRanda and target genes of KEGG enrichment analysis in cell senescence and cytokine-cytokine receptor signaling pathways; Figure B shows a schematic diagram of the luciferase reporter gene construct; Figure C shows the luciferase activity after grouping and treatment as shown; Figures DE show representative images and quantitative analysis of IL-6RA protein detection after grouping and treatment as shown. Figure F shows a representative image of the IL-6RA-pSTAT3 axis and aging marker protein detection of β cells after grouping and treatment as shown. DETAILED DESCRIPTION

[0041] Example 1 Isolation, purification and identification of small extracellular vesicles derived from human amniotic mesenchymal stem cells (hAMSC-sEVs).

[0042] (1) Isolation, culture and identification of hAMSCs: ① Isolation and culture: The human amniotic mesenchymal stem cells described in the present invention are obtained from amniotic tissue donated by healthy pregnant women. The amniotic tissue is removed under sterile conditions, and washed repeatedly with PBS containing double antibodies. The amniotic membrane is cut into pieces and the chorionic villus layer is removed; after filtering out the PBS, 0.05% trypsin / EDTA solution is added, and the mixture is bathed in 37°C water for 1 hour. The mixture is shaken on an oscillator for 30 seconds every 10 minutes to separate human amniotic epithelial cells (hAECs). The digestion solution and washing solution are collected, centrifuged at 4°C and 200g for 5 minutes, and the supernatant is discarded; the supernatant is discarded after washing once with PBS, and the precipitate is resuspended and centrifuged at 1×10^5 / cm 2 Inoculate cells into α-MEM complete medium containing 10% fetal bovine serum; change the medium every 3 days. After 3 days of culture, cells can be seen growing attached to the wall, showing polygonal or spindle shapes. After digestion with 0.05% trypsin / EDTA, fully washed and fully filtered HBSS, add an equal volume of 0.2% type I collagenase to the amniotic membrane cells for digestion, centrifuge at 200g for 5 minutes, wash again, discard the supernatant, resuspend the precipitate, count the cells, and calculate 1×10^5 / cm 2 Inoculate cells and culture with complete medium. Change the medium every 3 days. When the cell confluence reaches 80%, subculture at a ratio of 1:4. Continue to culture and expand under this condition to the 3rd or 4th generation to obtain pure hAMSCs. The cells are uniform in morphology and distributed in a spindle-shaped vortex. The morphology is visible under a light microscope. Figure 1 BⅠ. ② Identification: Mesodermal differentiation induction experiment was carried out using osteogenic, adipogenic and chondrogenic differentiation medium, and the three-lineage differentiation ability was observed by alizarin red staining, oil red staining and Alcian blue staining respectively. The results are shown in Figure 1 BⅡ (osteogenic differentiation), Ⅲ (adipogenic differentiation), Ⅳ (chondrogenic differentiation), indicating that the hAMSCs used in the present invention have the multipotent differentiation characteristics of mesenchymal stem cells. Secondly, flow cytometry was used to detect the expression of CD73, CD90, CD105 and cocktail (CD11b, CD19, CD34, CD45 and HLA-DR) indicators of hAMSCs for MSCs phenotypic molecular identification. The results are shown in Figure 1 A, indicating that the hAMSCs used in the present invention have the surface characteristics of mesenchymal stem cells.

[0043] (2) Preparation and identification of hAMSC-sEVs: The process flow chart is shown in Figure 1C. Specifically, ① Preparation: The fifth generation hAMSCs were cultured in MEM α complete medium containing 5% Ultragro-hPL (Cat#HPCPLCRL50, Helios Bioscience) until the cell fusion reached 70-80%, and then washed twice with PBS; hAMSCs were further cultured in MEM α medium without extracellular vesicles containing 0.6% MSC NutriStem XFsuppl.Mix (Cat#05-201-1U, Bioind) for 24 hours; the cell culture supernatant was collected, and the cell components and precipitated impurities were removed by gradient centrifugation, and the supernatant was collected; the cell debris was filtered out using a 0.22µm pore size filter, and the cells were centrifuged twice at a speed of 120,000g, 180min, and 4°C to obtain the precipitate, which was hAMSC-sEVs; the precipitate was resuspended in PBS buffer and stored at -80°C for later use. ② Identification: After BCA protein quantification, Western blot was used to detect the expression of marker positive proteins CD9, CD63, TSG101 and negative protein Calnexin. The results are shown in Figure 1 D. The results confirmed that the isolated hAMSC-sEVs can express the marker molecules CD9, CD63, TSG101, but not Calnexin. The morphology and size of hAMSC-sEVs were identified using transmission electron microscopy: 10 μL of the obtained hAMSCs-sEVs resuspension was added dropwise on a copper mesh to precipitate for 1 minute, and the floating liquid was removed by filter paper. Then 10 μL of uranyl acetate was added dropwise on a copper mesh to precipitate for 1 minute, and the floating liquid was removed by filter paper. Dry at room temperature for several minutes. Place the copper mesh in the sample chamber of a transmission electron microscope, and perform electron microscopy imaging at 100 kV. Transmission electron microscopy images of hAMSC-sEVs are shown in Figure 1 E, indicating that the small extracellular vesicles prepared by the present invention are cup-shaped with a diameter of about 80-200 nm. The particle size distribution of hAMSC-sEVs was identified by nanoparticle tracking analysis (NTA): hAMSC-sEVs were diluted with PBS to reach the optimal concentration for instrument detection (1.0×10 8 -2.5×10 9 The hAMSC-sEVs were injected into the sample analyzer sample chamber to detect the concentration and particle size of hAMSC-sEVs. Figure 1 F, indicating that the small extracellular vesicles prepared by the present invention are distributed more concentratedly, with an average diameter of about 120 nm.

[0044] Example 2 hAMSC-sEVs enter senescent β cells via intercellular delivery.

[0045] (1) Labeling of hAMSC-sEVs: In order to verify that hAMSC-sEVs can be taken up by aged β cells and exert their effects, sEVs were labeled with the red fluorescent membrane dye PKH26 (Cat#MINI26-1KT, Sigma-Aldrich). 200 µg of sEVs were mixed with 1 mL of PKH26 staining working solution and then incubated at room temperature in the dark for 5 minutes. Subsequently, FBS without sEVs was added to terminate the staining process, and the solution was ultracentrifuged at 120,000 g for 70 minutes at 4°C to remove excess dye. The resulting labeled sEVs were resuspended in PBS. The aged β cells were an in vitro aging model of β cells (MIN6 cells) induced by H202. The induction method is shown in Figure 2 A.

[0046] (2) Co-incubation and imaging: PKH26-labeled sEVs were incubated with senescent β cells at 37°C for 24 hours. After incubation, the cytoskeleton of MIN6 cells was stained with Phalloidin (Cat#ab176753, 1:1000, Abcam), while the nuclei were stained with Hoechst33342 (Cat#C1028, Beyotime). Finally, the internalization of hAMSC-sEVs was observed by fluorescence microscopy. The results are shown in Figure 2 B, hAMSC-sEVs enter senescent β cells via intercellular transmission.

[0047] Example 3 hAMSC-sEVs restore the function of aged β cells in vitro.

[0048] (1) hAMSC-sEVs restore oxidative stress-induced β-cell senescence: ①Senescence-associated β-galactosidase (SA-β-gal) staining: hAMSC-sEVs and H 2 O 2 After 48 h of co-incubation with induced senescent β cells, the percentage of SA-β-gal positive cells decreased significantly. Figure 2 CD.

[0049] ②γ-H2AX immunofluorescence staining: hAMSC-sEVs and H 2 O 2 After 48 h of co-incubation with induced senescent β cells, the extent of senescence-related DNA damage response decreased. Figure 2 EF.

[0050] ③ Western blot detection of aging marker protein expression: hAMSC-sEVs and H 2 O 2After 48 h of co-incubation with induced senescent β cells, the expression of β cell senescence marker proteins (p53, p21, p16, LaminB1) was reversed. Figure 2 GH.

[0051] ④qPCR detection of aging marker genes and SASP gene expression: hAMSC-sEVs and H 2 O 2 After 48 h of co-incubation with induced senescent β cells, the expression of β cell senescence marker genes (Cdkn2a, Cdkn1a, Trp53, Lmnb1, Igf1r) and some SASP genes (IL1β, Il6, Ccl2, Gdf15, Hsp90aa1) were reversed. Figure 2 IJ.

[0052] ⑤qPCR detection of gene expression related to β-cell secretory function: hAMSC-sEVs and H 2 O 2 After 48 h of co-incubation with induced senescent β cells, the expression of genes related to β cell secretory function was partially restored. Figure 3 A.

[0053] ⑥β-cell glucose-stimulated insulin secretion (GSIS) function detection: hAMSC-sEVs and H 2 O 2 After 48 hours of co-incubation, the induced senescent β cells partially recovered the ability to secrete insulin stimulated by high glucose. Figure 3 B.

[0054] ⑦Detection of insulin synthesis ability of β cells: hAMSC-sEVs and H 2 O 2 The insulin synthesis capacity of some β cells after 48 hours of co-incubation with induced senescent β cells is shown in Figure 3 CD.

[0055] ⑧EDU staining: hAMSC-sEVs and H 2 O 2 Co-incubation of induced senescent β cells for 48 h reversed the proliferation arrest of senescent β cells and increased the proportion of β cells that re-entered the cell cycle. Figure 3 EF. Above H 2 O 2 The specific method of inducing senescent β cells is: exposing β cells to H 2 O 2 (200 μM for 2 h), the cells were washed with PBS and replaced with fresh complete medium for a further 48 h.

[0056] (2) hAMSC-sEVs restore β-cell senescence induced by DNA damaging agents: ①Senescence-associated β-galactosidase (SA-β-gal) staining: After hAMSC-sEVs were co-incubated with doxorubicin (DOX)-induced senescent β cells for 48 h, the percentage of SA-β-gal positive cells was significantly reduced. Figure 4 AB.

[0057] ②γ-H2AX immunofluorescence staining: After hAMSC-sEVs were co-incubated with DOX-induced senescent β cells for 48 h, the degree of senescence-related DNA damage response decreased. The results are shown in Figure 4 CD.

[0058] ③EDU staining: hAMSC-sEVs reversed the proliferation arrest of senescent β cells after 48 h of co-incubation with DOX-induced senescent β cells and increased the proportion of β cells re-entering the cell cycle. Figure 3 EF.

[0059] ④ Western blot detection of senescence marker protein expression: After hAMSC-sEVs were co-incubated with DOX-induced senescent β cells for 48 h, the expression of β cell senescence marker proteins (p53, p21, p16) was reversed. The results are shown in Figure 4 G. The specific method of the above DOX-induced senescent β cells is as follows: after exposing the β cells to DOX (200 nM for 24 h), the cells are washed with PBS, replaced with fresh complete medium and cultured for a further 48 hours.

[0060] (3) hAMSC-sEVs restore senescence of naturally aged primary pancreatic β cells: Primary pancreatic islets were extracted from naturally aged C57BL / 6 mice (18 months old, n=6) and young C57BL / 6 mice (2 months old, n=6) and balanced overnight in exosome-free FBS medium. 200 islets from each group were incubated with hAMSC-sEVs for 48 hours, digested with 0.25% trypsin into single islet cells, and then re-plated on poly-lysine-coated cell slides for culture. Immunofluorescence staining was performed after adhesion.

[0061] ① Immunofluorescence staining of aging marker protein p16: After hAMSC-sEVs were co-incubated with pancreatic islets of naturally aged mice for 48 hours, the proportion of p16-positive β cells in the islets decreased significantly. The results are shown in Figure 4 HI.

[0062] ② Immunofluorescence staining of DNA damage marker protein γ-H2AX: After hAMSC-sEVs were co-incubated with pancreatic islets of naturally aged mice for 48 hours, the proportion of γ-H2AX-positive β cells in the islets decreased significantly. Figure 4 JK.

[0063] Example 4 hAMSC-sEVs treatment of age-related diabetic mice.

[0064] hAMSC-sEVs improve islet function and insulin sensitivity and reduce blood glucose in age-related diabetic mice: ① Construction of naturally aged T2DM mouse model: C57BL6 / J mice (male, age = 18 months) in this example were provided by the Animal Center of Nanjing Medical University. Aged mice were fed a standard normal diet (NCD) or a high-fat diet (HFD) (Cat#D12492, Research Diets) for 8 weeks. After 12 hours of fasting and free access to water, the HFD-fed mice were injected with 1% streptozotocin (STZ) (Cat#60256ES80, Yeasen) solution through the tail vein for 4 consecutive days at a dose of 45 mg / kg. Mice with random blood glucose exceeding 11.1 mmol / L were considered to have successfully modeled. The successfully modeled mice were randomly assigned to the hAMSC-sEVs group or the T2DM group, while the NCD mice served as the control group (n=6 in each group). Preparation and intervention flow chart, see Figure 5 A. In this example, mice were finally divided into three groups: NCD+PBS (control group), HFD+STZ+PBS (T2DM group), and HFD+STZ+hAMSC-sEVs (sEVs group). hAMSC-sEVs were administered via tail vein at a dose of 1 mg / kg bw, twice a week for 8 weeks, and the T2DM group and the control group were given an equal volume of PBS. Fasting blood glucose, body weight, food intake, etc. were measured weekly.

[0065] ② Intraperitoneal glucose tolerance test (IPGTT): The IPGTT detection method is to fast the mice for 14-16 hours, inject 1g / kg body weight glucose intraperitoneally, and measure blood glucose levels at 0, 30, 60, 90, and 120 minutes respectively. The test will be conducted at the end of the 8th week of intervention.

[0066] ③ Intraperitoneal insulin tolerance test (IPITT): The IPITT test method is to fast the mice for 4-6 hours, inject 1U insulin / kg body weight intraperitoneally, and measure blood glucose levels at 0, 30, 60, 90, and 120 minutes respectively. The test will be conducted at the end of the 9th week of intervention.

[0067] ④ GSIS function detection: The GSIS detection method is to measure serum insulin at 0, 30, 60, 90, and 120 minutes after mice fast for 14-16 hours and intraperitoneally inject 3g / kg body weight of glucose; fasting-refeeding and: blood glucose and serum insulin are measured after mice fast for 14-16 hours, and blood glucose and serum insulin are measured 2 hours after resuming diet to evaluate the glucose insulin secretion of mice. All tests were performed at the 9th week after the end of the intervention.

[0068] ⑤ Calculation of β-cell function index (HOMA-β): HOMA-β=(FINS[μIU / ml]×FPG[mmol / L]) / (PG2h[mmol / L]+PG1h[mmol / L]-2FPG[mmol / L]), where FINS is fasting insulin, FPG is fasting blood glucose, PG2h is blood glucose 2 hours after meal, PG1h is blood glucose 1 hour after meal, and 2FPG is twice fasting blood glucose.

[0069] Experimental results: Figure 5 As shown in the figure, at the beginning of treatment, the blood glucose and body weight of mice in the T2DM group and sEVs group were significantly higher than those in the NCD group. After multiple tail vein hAMSC-sEVs infusions, the fasting blood glucose of mice in the sEVs group continued to decrease, and after 2 months of treatment, it basically dropped to the same fasting blood glucose level as that of mice in the NCD group ( Figure 5 B). As the disease progressed, the body weight of mice in the T2DM group decreased significantly at week 5 and decreased by about 9% at week 10, while the body weight of mice in the sEVs group remained relatively stable before and after treatment ( Figure 5 C). IPGTT and IPITT results showed that the infusion of hAMSC-sEVs could improve glucose tolerance and insulin sensitivity in aged T2DM mice ( Figure 5 DE). In vivo GSIS and fasting-refeeding results confirmed that hAMSC-sEVs infusion could restore impaired islet function in aged T2DM mice and improve β-cell insulin secretion to lower blood glucose ( Figure 5 FH). The recovery of β-cell function index can also prove this conclusion ( Figure 5 I). The above experimental results show that after multiple hAMSC-sEVs tail vein infusions in elderly T2DM mice, the glucose tolerance, insulin sensitivity and β-cell GSIS function of the sEVs group mice under natural aging and metabolic stress were significantly improved compared with T2DM mice.

[0070] (2) hAMSC-sEVs reverse the senescent phenotype of β cells in age-related diabetic mice: ① In vivo tracing and pancreatic localization of hAMSC-sEVs: hAMSC-sEVs were labeled with the fluorescent dye PKH26 and then infused into mice via the tail vein. Live imaging and organ imaging were performed 24 hours later. At the same time, the pancreas of mice infused with PKH26-labeled hAMSC-sEVs was removed, paraffin sections were prepared, and pancreatic tissue insulin / Hochest immunofluorescence staining was performed.

[0071] ② SA-β-gal staining of pancreatic tissue sections: Frozen sections were prepared from half of the pancreatic tissues of the three groups of mice in this example, and pancreatic tissue SA-β-gal staining was performed according to the kit instructions.

[0072] ③ p16 staining of pancreatic tissue sections: The other half of the pancreatic tissues of the three groups of mice in this example were paraffin-embedded and prepared into sections for p16 / insulin / Hochest immunofluorescence staining.

[0073] ④γ-H2AX immunofluorescence staining of pancreatic tissue sections: γ-H2AX / insulin / Hochest immunofluorescence staining was performed on pancreatic tissue paraffin sections.

[0074] ⑤IGF1R immunofluorescence staining of pancreatic tissue sections: IGF1R / insulin / Hochest immunofluorescence staining was performed on pancreatic tissue paraffin sections.

[0075] Experimental results: Figure 6 As shown, PKH26-labeled hAMSC-sEVs can be detected in multiple organs (lung, liver, pancreas, spleen, kidney, and fat) 24 hours after intravenous injection. Immunofluorescence staining of pancreatic tissue further confirmed that sEVs can be detected in pancreatic β cells ( Figure 6 AB), which is the basis for the anti-aging effect of hAMSC-sEVs. Compared with normal aged mice, the pancreatic tissue of aged T2DM mice accumulated more aged β cells. After 16 infusions of hAMSC-sEVs, the percentage of aged β cells in the pancreatic tissue of aged T2DM mice decreased significantly ( Figure 6 CD), the expression of p16, γ-H2AX, and IGF1R, markers of β-cell senescence, was inhibited ( Figure 6 GH, Figure 6 IJ Figure 6 KL). The above experimental results show that hAMSC-sEVs can reverse the senescence of pancreatic β cells in aged T2DM mice.

[0076] (3) hAMSC-sEVs promote the functional maturation of β cells in age-related diabetic mice: ① Pdx1 staining of pancreatic tissue sections: The pancreatic paraffin sections of the three groups of mice in this example were subjected to Pdx1 / insulin / Hochest immunofluorescence staining.

[0077] ② MafA staining of pancreatic tissue sections: The pancreatic paraffin sections of the three groups of mice in this example were subjected to MafA / insulin / Hochest immunofluorescence staining.

[0078] ③ ALDH1A3 immunofluorescence staining of pancreatic tissue sections: The pancreatic paraffin sections of the three groups of mice in this example were subjected to ALDH1A3 / insulin / Hochest immunofluorescence staining.

[0079] Experimental results: Figure 7 As shown in the figure, compared with normal aged mice, the expression of β-cell function maturation-related proteins Pdx1 and MafA in the pancreatic tissue of aged T2DM mice was significantly decreased. After continuous infusion of hAMSC-sEVs, the expression of β-cell function maturation-related proteins Pdx1 and MafA in the pancreatic tissue of aged T2DM mice was reversed ( Figure 7 AB, Figure 7 CD), indicating improved secretory function of β cells; aldehyde dehydrogenase family 1 member A3 (ALDH1A3) is an important marker of β cell dedifferentiation and one of the characteristics of aging β cells. Its activity is closely related to the dynamic transformation of β cell function and identity. Compared with normal aging mice, the proportion of dedifferentiated β cells in the pancreatic tissue of elderly T2DM mice increased significantly, indicating the loss of β cell function. After continuous infusion of hAMSC-sEVs, the expression of ALDH1A3 in β cells in the pancreatic tissue of elderly T2DM mice was significantly inhibited, indicating that the proportion of dedifferentiated β cells decreased and the insulin secretion function of β cells was partially restored ( Figure 7 EF, Figure 7 G). The above experimental results show that hAMSC-sEVs can promote the functional maturation of senescent β cells in aged T2DM mice.

[0080] (4) hAMSC-sEVs improve systemic inflammatory status and metabolic indicators in age-related diabetic mice: ① Evaluation of inflammatory factors after hAMSC-sEVs intervention: All senescent cells secrete SASP factors, and IL-1β, IL-6, TNF-α, and CCL2 are all factors in SASP that are highly correlated with aging diseases. About one month after the last infusion of hAMSC-sEVs, the levels of IL-1β, IL-6, TNF-α, and CCL2 in the serum of the three groups of mice in this example were measured using the mouse inflammatory antibody array C1 kit (Cat#AAM-INF-1, RayBiotech). The three groups of mice were starved overnight, blood samples were collected from the inner canthus, and serum was separated for testing.

[0081] ② Safety evaluation of hAMSC-sEVs: The liver function indicators alanine aminotransferase (ALT) and aspartate aminotransferase (AST) and the renal function indicators blood urea nitrogen (BUN) and blood creatinine (CREA) levels of the three groups of mice in this example were evaluated about 1 month after the last infusion of hAMSC-sEVs. The serum separated by the above method was detected using an animal-specific biochemical analyzer (HITACHI, 7100).

[0082] Experimental results: Figure 8 As shown in the figure, compared with normal elderly mice, the levels of inflammatory factors (IL-1β, IL-6, CCL2) in the serum of elderly T2DM mice were significantly increased, and TNF-α showed an upward trend. After continuous infusion of hAMSC-sEVs, compared with the T2DM group mice, the levels of inflammatory factors IL-1β, IL-6, and CCL2 in the serum of the sEVs group mice were significantly decreased, and TNF-α showed a downward trend, but it did not reach a statistical difference ( Figure 8 AD). Compared with normal aged mice, the liver and kidney functions of aged T2DM mice were impaired to a certain extent, ALT and BUN were significantly increased, and AST and CREA showed an upward trend ( Figure 8 EF). After continuous infusion of hAMSC-sEVs, the ALT of mice in the sEVs group decreased significantly compared with that in the T2DM group, and AST, BUN and CREA showed an improvement trend, but it did not reach a statistical difference. The above experimental results show that hAMSC-sEVs can improve the systemic inflammatory state and inhibit the secretion of SASP without damaging the liver and kidney function of elderly T2DM mice.

[0083] hAMSC-sEVs promote β-cell proliferation in age-related diabetic mice ① H&E staining of pancreatic tissue sections: H&E staining was performed on the pancreatic paraffin sections of the three groups of mice in this example. ② PCNA staining of pancreatic tissue sections: PCNA / insulin / Hochest immunofluorescence staining was performed on the pancreatic paraffin sections of the three groups of mice in this example.

[0084] Experimental results: Figure 6 , 9 As shown in the figure, the pancreatic islet area of ​​aged T2DM mice was significantly decreased compared with that of normal aged mice. After continuous infusion of hAMSC-sEVs, the ratio of pancreatic islet area to pancreatic area of ​​mice in the sEVs group was significantly increased compared with that of mice in the T2DM group ( Figure 6 CD). PCNA (proliferating cell nuclear antigen) is a protein that plays an important role in DNA replication and cell proliferation. Compared with the T2DM group mice, the sEVs-treated mice had a higher proportion of PCNA-positive β cells in the pancreatic islets ( Fig. 9AB). The above experimental results show that hAMSC-sEVs can promote the proliferation of β cells in elderly T2DM mice, fully demonstrating the powerful effect of hAMSC-sEVs as nano-scale anti-aging drugs in reversing β cell aging and treating age-related diabetes without reducing the number of functional β cells.

[0085] Example 5 Sequencing of miRNA carried by hAMSC-sEVs and screening of anti-aging miRNA.

[0086] ① Sequencing of miRNAs carried by hAMSC-sEVs: A heat map of the top 20 most abundant miRNAs in hAMSC-sEVs was drawn based on the number of mapped reads per million. Fig.10 A.

[0087] ② KEGG enrichment analysis of miRNA target genes: KEGG analysis of the target genes of the top 6 highly expressed miRNAs showed that they were significantly enriched in pathways related to PI3K-AKT, cell senescence, cytokine-cytokine receptor interaction, and autophagy. The results are shown in Fig.10 B.

[0088] ③ hAMSC-sEVs treated target cells miRNA-qPCR detection: After treatment with hAMSC-sEVs, the expression levels of the top 6 highly expressed miRNAs were detected in aged β cells. Among them, miR-21-5p, miR-100-5p, miR-143-3p and let-7i-5p were significantly upregulated in β cells and were selected as 4 candidate miRNAs. The results are shown in Fig.10 C.

[0089] ④SA-β-gal staining: Four candidate miRNAs were overexpressed in aged β cells. The percentage of SA-β-gal positive cells in the miR-21-5p overexpression group was significantly reduced. Fig.10 D.

[0090] ⑤ Western blot detection of aging marker protein expression: Four candidate miRNAs were overexpressed in aging β cells. The expression of β cell aging marker proteins (p53, p21, p16, LaminB1) in the miR-21-5p overexpression group was reversed. The results are shown in Fig.10 E.

[0091] The above results indicate that hAMSC-sEVs may exert anti-β cell aging effects by providing the active ingredient miR-21-5p.

[0092] Example 6 miR-21-5p is the main active ingredient of hAMSC-sEVs in reversing β-cell senescence.

[0093] ① Verification of the efficiency of silencing miR-21-5p in hAMSC-sEVs: hAMSC-sEVs were transfected with miR-21-5p inhibitor (sEVs_21-5p inhibition group) or NC inhibitor (sEVs_inhibition control group). After 24 h, the expression level of miR-21-5p in sEVs of the sEVs_21-5p inhibition group was significantly reduced compared with that of the sEVs_inhibition control group. The results are shown in Fig.11 A.

[0094] ②SA-β-gal staining: 100ng / ul sEVs or normal sEVs that inhibited miR-21-5p expression were added to senescent β cells, and samples were collected for staining 48 hours later. Compared with the sEVs_inhibition control group, the percentage of SA-β-gal positive cells in the sEVs_21-5p inhibition group increased significantly, indicating that the anti-aging effect of sEVs was significantly weakened. The results are shown in Fig.11 BC.

[0095] ③γ-H2AX immunofluorescence staining: The samples were collected and stained in the same way as ②. Compared with the sEVs_inhibition control group, the relative expression of γ-H2AX in the sEVs_21-5p inhibition group increased significantly, indicating that the anti-aging effect of sEVs was significantly weakened. The results are shown in Fig.11 DE.

[0096] ④EDU staining: The samples were collected and stained in the same way as ②. Compared with the sEVs_inhibition control group, the percentage of EDU-positive cells in the sEVs_21-5p inhibition group decreased significantly, indicating that the effect of sEVs on improving proliferation inhibition was significantly weakened. The results are shown in Fig.11 FG.

[0097] ⑤β-cell glucose-stimulated insulin secretion (GSIS) function detection: GSIS function was detected after sampling in the same way as ②. Compared with the sEVs_inhibition control group, the high-glucose-stimulated insulin secretion in the sEVs_21-5p inhibition group was significantly reduced, indicating that the effect of sEVs on improving insulin secretion under high-glucose stimulation was significantly weakened. The results are shown in Fig.11 H.

[0098] ⑥β-cell insulin synthesis capacity detection: After collecting samples in the same way as ②, the total insulin content in β-cells was extracted. Compared with the sEVs_inhibition control group, there was no significant difference in the amount of insulin synthesis in the sEVs_21-5p inhibition group, indicating that silencing miR-21-5p in sEVs had no significant effect on insulin synthesis. The results are shown in Fig.11 I.

[0099] ⑦qPCR detection of aging marker gene expression: After sampling in the same way as ②, compared with the sEVs_inhibition control group, the β-cell aging marker genes ( Cdkn2a, Cdkn1a, Trp53 ) expression rebounded, indicating that the inhibitory effect of sEVs on β-cell senescence was significantly weakened. Fig.11 J.

[0100] ⑧Western blot detection of aging marker protein expression: After sampling in the same way as ②, compared with the sEVs_inhibition control group, the expression of β-cell aging marker proteins (p53, p21, p16) in the sEVs_21-5p inhibition group rebounded, indicating that the effect of sEVs in inhibiting β-cell aging was significantly weakened. The results are shown in Fig.11 KL.

[0101] The above results indicate that the anti-β-cell aging effect of hAMSC-sEVs is largely dependent on the active ingredient miR-21-5p.

[0102] Example 7 miR-21-5p mimic simulates hAMSC-sEVs to reverse β-cell aging.

[0103] ①SA-β-gal staining: Senescent β cells were transfected with miR-21-5p mimic sequence (miR-21-5p mimic) or negative control sequence (NC mimic) for 48 hours and then collected for staining. Compared with the S+NC mimic group (senescent + NC mimic group), the percentage of SA-β-gal positive cells in the S+21-5p mimic group (senescent + 21-5p mimic group) was significantly decreased. The results are shown in Fig.12 AB.

[0104] ②γ-H2AX immunofluorescence staining: The samples were collected and stained in the same way as ①. Compared with the S+NC mimic group, the relative expression of γ-H2AX in the S+21-5pmimic group was significantly decreased. The results are shown in Fig.12 CD.

[0105] ③EDU staining: The samples were collected and stained in the same way as ①. Compared with the S+NC mimic group, the percentage of EDU-positive cells in the S+21-5p mimic group decreased significantly. The results are shown in Fig.12 EF.

[0106] ④β-cell insulin synthesis capacity detection: After collecting samples in the same way as ①, the total insulin content in β-cells was extracted. Compared with the S+NC mimic group, the insulin synthesis in the S+21-5p mimic group increased significantly. The results are shown in Fig.12 G.

[0107] ⑤β-cell glucose-stimulated insulin secretion (GSIS) function test: GSIS function was tested after collecting samples in the same way as ①. Compared with the S+NC mimic group, the S+21-5p mimic group had a significant increase in high-glucose-stimulated insulin secretion. The results are shown in Fig.12 H.

[0108] ⑥qPCR detection of aging marker gene expression: After sampling in the same way as ①, compared with the S+NC mimic group, the β-cell aging marker genes in the S+21-5pmimic group ( Cdkn2a, Cdkn1a, Trp53, LaminB1 ) expression was reversed, and the results are shown in Fig.12 I.

[0109] ⑦ Western blot detection of aging marker protein expression: After sampling in the same way as ①, compared with the S+NC mimic group, the expression of β-cell aging marker proteins (p53, p21, p16) in the S+21-5p mimic group was inhibited. The results are shown in Fig.12 JK.

[0110] The above results indicate that miR-21-5 itself can serve as an active pharmaceutical ingredient for reversing β-cell aging.

[0111] Example 8 hAMSC-sEVs containing miR-21-5p target the IL-6RA-pSTAT3 axis to inhibit β-cell senescence.

[0112] ① Target gene prediction combined with bioinformatics analysis: TargetScan and miRanda target gene online prediction websites combined with KEGG enrichment analysis were used to predict target genes involved in cell aging and cytokine-receptor signaling pathways. Il6ra and Tgfbr2 is the target gene of miR-21-5p that meets the screening criteria, and the results are shown in Fig.13 A.

[0113] ② Schematic diagram of luciferase reporter gene construct: miR-21-5p sequence and wild-type 3'-UTR region sequence and mutant sequence constructed by Il6ra reporter gene plasmid, the results are shown in Fig.13 B.

[0114] ③ Dual luciferase reporter gene assay: 293T cells were grouped as shown in the figure, and the luciferase activity of each group was detected 48 hours after transfection. The results are shown in Fig.13 C, suggesting that miR-21-5p can target and bind to Il6ra The 3'-UTR region of mRNA inhibits its protein expression.

[0115] ④ Western blot verification of the negative regulatory relationship between miR-21-5p and IL-6RA: After β cells were transfected with NC mimics (overexpression control group) or miR-21-5p mimics (21-5p overexpression group), or NC inhibitor (knockdown control group) or miR-21-5p inhibitor (21-5p knockdown group), Western blot results confirmed that miR-21-5p can target and inhibit IL-6RA protein expression. The results are shown in Fig.13 DE.

[0116] ⑤ pSTAT3 / Hochest immunofluorescence staining of β cells: After sEVs (sEVs treatment group) or miR-21-5p mimic (21-5p overexpression group) were added to senescent β cells for 48 hours, samples were collected for pSTAT3 / Hochest immunofluorescence staining. Fig.13 F, indicating that both sEVs and miR-21-5p can inhibit the phosphorylation of STAT3, thereby affecting the nuclear translocation of STAT3.

[0117] ⑥ Western blot detection of IL-6RA-pSTAT3 axis and aging marker protein expression: After grouping as shown in the figure, sEVs or miR-21-5p mimic added to senescent β cells for 48 hours can significantly inhibit the IL-6RA-pSTAT3 axis, thereby inhibiting the expression of aging marker proteins (p53, p21, p16). The results are shown in Fig.13 G.

[0118] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention, rather than to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the essence and scope of the technical solution of the present invention.

Claims

1. The use of MiR-21-5p in the preparation of a drug for reversing the aging of pancreatic β cells in age-related diabetes, characterized in that: The nucleotide sequence of the miR-21-5p is: UAGCUUAUCAGACUGAUGUUGA.

2. Use of small extracellular vesicles of mesenchymal stem cells in the preparation of a drug for reversing aging of pancreatic β cells in age-related diabetes, characterized in that: The small extracellular vesicles are small extracellular vesicles secreted by human amniotic mesenchymal stem cells and contain the miR-21-5p according to claim 1.

3. The use according to claim 2, characterized in that: The small extracellular vesicles are prepared by the following steps: (1) After isolating and culturing human amniotic mesenchymal stem cells, the fifth generation human amniotic mesenchymal stem cells were cultured in MEM α complete medium containing 5-10 vol% human platelet lysate until the cell fusion reached 70-80%, and then washed with PBS several times to obtain hAMSCs; (2) hAMSCs were cultured in MEM α medium containing 0.6-1.0 vol% mesenchymal stem cell serum-free supplement for 18-24 hours; (3) Collecting the cell culture supernatant, removing cell components and precipitated impurities by gradient centrifugation, and collecting the supernatant; (4) Use a 0.22 µm pore size filter to remove cell debris, and the precipitate obtained by centrifugation is the small extracellular vesicles.

4. The use according to claim 3, characterized in that: The diameter of the small extracellular vesicles is 80-200 nm.

5. The use according to claim 3, characterized in that: In step (4), the centrifugation conditions are: centrifugation twice at a speed of 100,000-120,000 g, 180 min, 4° C.

6. The use according to claim 3, characterized in that: In step (4), the precipitate obtained by centrifugation is resuspended in PBS buffer and stored at -80°C for later use.

7. The use according to claim 1 or 2, characterized in that: The age-related diabetes is type 2 diabetes induced by natural aging and the presence or absence of metabolic stress.

8. The use according to claim 1 or 2, characterized in that: MiR-21-5p or mesenchymal stem cell small extracellular vesicles containing it inhibit the expression of β-cell aging marker proteins, wherein the aging marker proteins include p16, γ-H2A.X and IGF1R.

9. The use according to claim 1 or 2, characterized in that: MiR-21-5p or mesenchymal stem cell small extracellular vesicles containing the same promote the functional maturation of β cells, and the promotion of the functional maturation of β cells includes restoring the expression of β cell functional proteins PDX1 and MafA and inhibiting the expression of β cell dedifferentiation marker protein ALDH1A3.

10. The use according to claim 1 or 2, characterized in that: MiR-21-5p or mesenchymal stem cell-derived small extracellular vesicles containing it reverse age-related diabetic pancreatic β-cell senescence without reducing the number of functional β-cells.

Images