Application of SLC35E2B in the treatment of obesity

The SLC35E2B gene knockout mouse model was constructed using CRISPR/Cas9 technology, which solved the problem of unclear SLC35E2B function, provided a new tool for obesity research and treatment, and achieved the establishment of a stable obesity model and drug development.

CN119633122BActive Publication Date: 2025-09-05DERMATOLOGY HOSPITAL SOUTHERN MEDICAL UNIV (GUANGDONG PROVINCIAL DERMATOLOGY HOSPITAL GUANGDONG PROVINCIAL CENT FOR STI & SKIN DISEASES CONTROL & PREVENTION RES CENT FOR LEPROSY CONTROL & PREVENTION CHINA)
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411916862.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-24
Publication Date
2025-09-05
Estimated Expiration
2044-12-24

AI Technical Summary

Technical Problem

In the existing technology, little is known about the role of the SLC35E2B gene in obesity research, its function is unclear, and there is a lack of effective obesity models and treatments.

Method used

The SLC35E2B gene knockout mouse model was constructed using CRISPR/Cas9 gene knockout technology. By designing specific target gRNA and microinjecting it into mouse fertilized eggs, a stable genetic SLC35E2B gene knockout mouse animal model was established. This was used to construct an obesity model and study its application in obesity treatment.

Benefits of technology

The SLC35E2B gene knockout mouse model was successfully constructed, providing important animal experimental materials for the research and treatment of obesity. By changing the expression and protein levels of the SLC35E2B gene, a reliable obesity model was established for molecular biology research and drug development.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119633122B_ABST
    Figure CN119633122B_ABST
Patent Text Reader

Abstract

The present invention discloses the use of SLC35E2B in treating obesity, belonging to the field of biotechnology. The present invention constructs an SLC35E2B knockout mouse model, alters SLC35E2B gene expression in the animal, and / or modifies the level or activity of the SLC35E2B protein to create an animal model of obesity and / or obesity-related diseases. The invention then utilizes molecular biology, enzyme immunoassay techniques, immunohistochemical staining, Oil Red staining, and other methods to study the use of the SLC35E2B gene in constructing obesity models.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to application of SLC35E2B in treating obesity. Background Art

[0002] The solute carrier 35 (SLC35) family, the 35th member of the SLC family, was first discovered in mouse liver. It is divided into seven subtypes (AG) and is a hydrophobic protein composed of 300 to 400 amino acids. It belongs to the type III transmembrane transporter molecule. Most SLC35 members are located on the membrane of the Golgi complex, while a small number are located on the cell membrane. SLC35 is considered a key regulator of the glycosylation pathway. Its main function is to transport the corresponding monosaccharide nucleotides within the cell, participate in sugar metabolism, and ensure the smooth progress of the glycosylation process.

[0003] Obesity, a chronic metabolic disease caused by the interaction of multiple factors, including genetics and the environment, is increasingly prevalent worldwide and is considered a major environmental factor contributing to the development of inflammatory skin diseases. Current mouse models for studying obesity include β-less mice, high-fat diet-induced models, monogenic obese mice, polygenic obese mice, and genetically modified mouse models. Each model has its own specific uses and advantages, providing important tools for studying the pathogenesis, preventive measures, and potential treatments for obesity. Gene-edited mouse models, with their enhanced phenotypic stability, play a crucial role in the study of the mechanisms of obesity and other metabolic diseases, as well as in drug development and evaluation.

[0004] Human genetic data show that approximately 20% of the human genome is associated with disease, and more than 50% of SLC family members are implicated in human disease. Solute transporters are associated with a variety of metabolic diseases and are abundantly expressed in the liver. They participate in the transport of various nutrients and metabolites, regulating nutrient supply, metabolic conversion, energy balance, and oxidative stress, ultimately modulating liver physiological functions. Some SLC transporters have become novel targets for drug development. Currently, 13 subfamilies within the SLC family show strong evidence of involvement in metabolic diseases. Among them, SLC5, SLC6, SLC13, SLC25, and SLC30 are associated with the pathogenesis of obesity, while SLC35D, SLC25A24, and SLC43A3 contribute to obesity by acting on adipocytes. Within the SLC35 family, SLC35C1 knockout mice exhibit postnatally delayed growth and weight gain. Studies in SLC35C1 knockout mice have revealed that fucosylation regulated by this gene affects growth and development, leukocyte recruitment, lymphocyte homeostasis, and lung development. Mice harboring recessive mutations in the SLC35D3 gene exhibit multiple features of metabolic syndrome, including late-onset obesity, hyperlipidemia, hyperglycemia, and hyperinsulinemia. Currently, little research has been conducted on SLC35E2B, and its function remains unclear. Therefore, this study aimed to investigate the application of SLC35E2B in establishing obesity models and to provide new theoretical insights into the treatment of obesity-related diseases. Summary of the Invention

[0005] The first object of the present invention is to provide a method for constructing an SLC35E2B gene knockout mouse animal model.

[0006] The second object of the present invention is to provide use of SLC35E2B in treating obesity.

[0007] To achieve the above object, the present invention adopts the following technical solutions:

[0008] The method for constructing an SLC35E2B gene knockout mouse model provided by the present invention is constructed based on CRISPR / Cas9 gene knockout technology and comprises the following steps:

[0009] (1) Based on the SLC35E2B gene sequence, a pair of specific target gRNAs (gRNA1 and gRNA2) for the SLC35E2B mouse gene to be knocked out were determined and transcribed into mRNA in vitro with Cas9 nuclease;

[0010] (2) A pair of specific target gRNA1, gRNA2 and mRNA are microinjected into mouse fertilized eggs, and the microinjected fertilized eggs are transplanted into the oviduct of surrogate mother mice;

[0011] (3) After the mice are born, they are subcultured and genotyped to obtain a stable genetic SLC35E2B gene knockout mouse model;

[0012] The target sequence of the gRNA1 is shown in SEQ ID NO: 1, and the target sequence of the gRNA2 is shown in SEQ ID NO: 2.

[0013] Preferably, in step (3), the fertilized eggs after microinjection are transplanted into the oviduct of a surrogate mother mouse to produce mice, namely, F0 generation mice; DNA from the tails of the F0 generation mice is extracted, PCR amplified and the products are sequenced, the positive mice are mated with wild-type mice of the opposite sex to obtain F1 generation heterozygous mice, and the F1 generation heterozygous mice are hybridized to obtain F2 generation homozygous mice, until a stably inherited SLC35E2B gene knockout mouse animal model is obtained; wherein, if there is a 680 bp band, it is a positive homozygous; if there are two 931 bp and 680 bp bands, it is a positive heterozygous; if there is a 931 bp band, it is a wild-type control.

[0014] The present invention also provides an SLC35E2B gene knockout mouse animal model, which is obtained by the above-mentioned method for constructing the SLC35E2B gene knockout mouse animal model.

[0015] The present invention also provides an application of the SLC35E2B gene in constructing an obesity model, which is constructed based on CRISPR / Cas9 gene knockout technology and includes the following steps:

[0016] (1) Detected the SLC35E2B gene expression in liver and fat of 12-week-old OB and DIO obese mice;

[0017] (2) Observe the morphology and growth curve of SLC35E2B knockout mice, measure the liver and fat weights of 4-week-old, 8-week-old, and 12-week-old male mice and C57 male mice of the same age; observe liver cell size, adipocyte morphology, serum lipid metabolism indicators, and lipid metabolism gene expression;

[0018] (3) SLC35E2B knockout mice and C57 male mice of the same age were fed with ordinary feed or high-fat diet for 4 / 8 weeks, respectively. The morphology and growth curves of the mice were observed, and the liver and fat weights of the mice were recorded after 4 / 8 weeks of feeding.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] (1) Based on CRISPR / Cas9 gene knockout technology, the present invention designed specific target gRNA1 and gRNA2 for the SLC35E2B mouse gene to be knocked out, and successfully constructed an SLC35E2B gene knockout mouse animal model. It was identified that exon2-9 of the SLC35E2B gene was knocked out, providing the main animal experimental materials for constructing an obesity model.

[0021] (2) The present invention constructs an SLC35E2B gene knockout mouse model, alters the expression of the SLC35E2B gene in the animal body, and / or alters the level or activity of the SLC35E2B protein to construct an animal model with obesity and / or obesity-related diseases. The application and method of the SLC35E2B gene in constructing an obesity model are studied using molecular biology, enzyme immunoassay technology, immunohistochemistry staining, oil red staining, and other means.

[0022] The above and other features, aspects and advantages of the present invention will be more readily understood with reference to the following detailed description. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Other features, objects and advantages of the present invention will become more apparent upon reading the detailed description of non-limiting embodiments with reference to the following drawings:

[0024] Figure 1 Flowchart of the method for constructing an SLC35E2B gene knockout mouse animal model in the embodiment;

[0025] Figure 2 is a non-target gRNA analysis primer; wherein: (a) a non-target analysis sequence of gRNA1; (b) a non-target analysis sequence of gRNA2;

[0026] Figure 3 This is a flowchart for studying the role of the SLC35E2B gene in building obesity models;

[0027] Figure 4 Quantitative PCR of SLC35E2B mRNA in the liver and fat of DIO and OB obese mice, n = 8 mice per group, and C57BL / 6 wild-type mice were used as controls;

[0028] Figure 5 Figures 1 and 2 are the body shape (A), body weight (B), and growth curves (C) of mice from 4 to 12 weeks of age. ko represents SLC35E2B knockout mice, and wt represents C57BL / 6 wild-type mice. There are 8 mice in each group.

[0029] Figure 6HE staining of liver (A), subcutaneous fat (B), visceral fat (C), brown fat (D) and oil red staining of liver (E) of 4-week-old, 8-week-old, and 12-week-old mice. Ko represents SLC35E2B gene knockout mice, and wt represents C57BL / 6 wild-type mice. There are 8 mice in each group.

[0030] Figure 7 Figure 3. Liver cholesterol and triglyceride levels (A); serum cholesterol, triglyceride, low-density lipoprotein (LDL), and high-density lipoprotein (HDL) levels (B); and quantitative PCR analysis of lipid metabolism gene mRNA in the liver, subcutaneous fat, visceral fat, and brown fat of KO and WT mice at 4, 8, and 12 weeks of age. N = 8 mice in each group, and C57BL / 6 wild-type mice were used as controls.

[0031] Figure 8 Figure 3. Body shape (A), body weight (B), and growth curve (C) of mice fed a high-fat diet for 4 / 8 weeks. ko represents SLC35E2B knockout mice, and wt represents C57BL / 6 wild-type mice. There were 8 mice in each group. DETAILED DESCRIPTION

[0032] To make the purpose, technical solutions, and advantages of the embodiments of the present invention more clear, the technical solutions of the embodiments of the present invention will be clearly and completely described below in conjunction with the accompanying drawings of the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the described embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0033] The basic information of the SLC35E2B gene knockout in the following examples is as follows: knockout gene name (Ensembl): ENSMUSG00000042202, knockout gene GenBank code: NM_177186.4; number of exons of the knockout gene: 8, exons 2-9 targeted by the knockout; number of gRNAs constructed: 1 pair; microco-injection: Cas9 mRNA and gRNA generated by in vitro transcription were microco-injected into mouse fertilized eggs.

[0034] Example 1

[0035] like Figure 1 and 2 As shown, the SLC35E2B gene knockout mouse model was constructed based on CRISPR / Cas9 gene knockout technology. The steps are as follows:

[0036] (1) Based on the SLC35E2B gene sequence (GenBank code: NM_177186.4), a pair of specific target sites for the SLC35E2B mouse gene to be knocked out were identified:

[0037] Pair1: gRNA1: ggaccaactagctcacttag (SEQ ID NO: 1);

[0038] gRNA2:acagcaactcgggttgatcc (SEQ ID NO: 2);

[0039] The amplification primer sequences were designed based on a pair of specific targets as follows:

[0040] SLC35E2B-pair1-F: gagggtttctgtggaaggtatggag (SEQ ID NO: 3);

[0041] SLC35E2B-pair1-R: attagagatttgctggccaacttccc (SEQ ID NO: 4);

[0042] PCR amplification was performed according to the PCR reaction system and reaction conditions shown in Table 1, and mRNA was transcribed in vitro with Cas9 nuclease;

[0043] (2) A pair of specific target gRNA1, gRNA2 and mRNA are microinjected into mouse fertilized eggs, and the microinjected fertilized eggs are transplanted into the oviduct of surrogate mother mice;

[0044] (3) The fertilized eggs after microinjection are transplanted into the oviduct of a surrogate mother mouse to produce mice, namely F0 generation mice; DNA from the tails of the F0 generation mice is extracted, PCR amplified and the products are sequenced, the positive mice are mated with wild-type mice of the opposite sex to obtain F1 generation heterozygous mice, and the F1 generation heterozygous mice are hybridized to obtain F2 generation homozygous mice, until a stable inherited SLC35E2B gene knockout mouse animal model is obtained, wherein genotype identification is performed according to the following gene identification primers:

[0045] Mouse SLC352B-F: gagggtttctgtggaaggtatggag (SEQ ID NO: 5);

[0046] Mouse SLC352B-R: attagagatttgctgccaacttccc (SEQ ID NO: 6);

[0047] Mouse SLC352B-Wt / He-F: gctgagaccctggatggacaaca (SEQ ID NO: 7);

[0048] If there is a 680bp band, it is a positive homozygote; if there are two 931bp and 680bp bands, it is a positive heterozygote; if there is a 931bp band, it is a wild-type control. The statistical results are shown in Table 2.

[0049] Table 1

[0050]

[0051] Table 2

[0052] Ear tag serial number genotype gender Date of birth 1520 Homozygous ♂ 2018.3.20 1521 Homozygous ♀ 2018.3.17

[0053] Example 2

[0054] like Figure 3 As shown, based on the SLC35E2B gene knockout mouse model constructed in Example 1, the application of the SLC35E2B gene in constructing an obesity model was further studied, and the method steps were as follows:

[0055] (1) Eight 12-week-old DIO obese mice and eight OB obese mice were selected, and the liver and adipose tissues were collected to measure the relative expression of SLC35E2B mRNA. C57BL / 6 wild-type mice were used as controls. Figure 4 shown.

[0056] (2) Homozygous SLC35E2B knockout mice were selected after genetic identification and housed separately with C57BL / 6 wild-type male mice of the same age in SPF-grade laminar flow animal rooms. They were provided with high-temperature and high-pressure sterilized animal feed and sterile water, and were allowed to eat and drink freely. The room temperature was 20-26°C; the daily temperature difference was ≤4°C; the relative humidity was 40%-70%, and the lighting was half-cycled during the day and half-night. Eight mice were selected at the ages of 4, 8, and 12 weeks, and their weight and body shape were recorded. Figure 5 shown.

[0057] (3) The liver, subcutaneous fat, visceral fat, and brown fat of 4-week-old, 8-week-old, and 12-week-old SLC35E2B knockout male mice and C57BL / 6 wild-type male mice were selected and paraffin sections and frozen sections were made. The size of adipocytes and the content of liver lipid droplets were observed by HE staining and oil red staining. Figure 6 shown.

[0058] (4) Liver tissue, adipose tissue, and serum were collected from 4-week-old, 8-week-old, and 12-week-old SLC35E2B gene knockout male mice (KO) and C57BL / 6 wild-type male mice (WT). The liver cholesterol and triglyceride levels, serum cholesterol, triglyceride, low-density lipoprotein, and high-density lipoprotein levels were determined by ELISA. The relative mRNA expression levels of lipid metabolism genes in the liver, subcutaneous fat, visceral fat, and brown fat were determined by RT-PCR. Figure 7 shown.

[0059] (5) Select 6-week-old pure SLC35E2B gene knockout male mice and 16 C57BL / 6 wild-type male mice of the same age (according to weight monitoring, there was no difference in weight between the two groups of mice at 6 weeks of age, so the high-fat diet was started at 6 weeks of age, and they were all breastfed before 6 weeks of age). They were divided into a normal feed group and a high-fat diet group of 8 mice each, and were raised for 4 weeks and 8 weeks respectively. The weight and body shape were recorded. Figure 8 shown.

[0060] It can be seen from this that the effect of high-fat diet on body weight in SLC35E2B gene knockout male mice is significantly lower than that in wild-type male mice.

Claims

1. Use of an agent for knocking out the SLC35E2B gene in the preparation of a drug for preventing and / or treating obesity, wherein the agent for knocking out the SLC35E2B gene comprises target-specific gRNA 1 and gRNA 2 designed based on CRISPR / Cas9 gene knockout technology, wherein the nucleotide sequence of gRNA 1 is shown in SEQ ID NO: 1, and the nucleotide sequence of gRNA 2 is shown in SEQ ID NO: 2; The obesity is physiological obesity caused by a high-fat diet.

Citation Information

Patent Citations

  • Glass-working tank

    US1771864A

  • Construction method and application of SLC35E2B gene knockout mouse animal model

    CN113699152A