Application of SV2B gene in the preparation of drugs for the treatment of TFE3 rearranged renal cell carcinoma

Abstract

The present invention provides the use of SV2B gene in the preparation of a drug for treating TFE3 rearranged renal cell carcinoma, and relates to the field of biomedicine technology. The use of SV2B gene as a therapeutic target for TFE3 rearranged renal cell carcinoma in the preparation of a drug for treating TFE3 rearranged renal cell carcinoma. The present invention confirms that inhibiting SV2B gene expression can inhibit the proliferation, metastasis, invasion and in vivo tumor formation of TFE3-RCC tumor cells, proving that SV2B is a potential new target for treating TFE3-RCC, which is conducive to further studying the occurrence and development mechanism of tumor-related diseases caused by abnormal activation of TFE3-RCC. The present invention designs shRNA sequences, siRNA sequences, and constructs corresponding shRNA lentiviral silencing vectors. It is confirmed by experimental results that the shRNA and siRNA of the present invention can significantly silence the expression of SV2B. In view of SV2B as a potential TFE3-RCC therapeutic target, the shRNA, siRNA and related biological reagents of SV2B provided by the present invention can be used to screen and prepare drugs for treating TFE3-RCC.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to an application of an SV2B gene in preparing a drug for treating TFE3 rearranged renal cell carcinoma. Background Art

[0002] TFE3-rearranged renal cell carcinoma (TFE3-RCC) is a renal malignancy caused by translocation of the short arm of chromosome X (Xp11), which causes the fusion of the TFE3 gene located on the short arm of chromosome X with its partner gene. There is currently a lack of effective non-invasive treatments for advanced TFE-RCC.

[0003] Patients with recurrent and advanced TFE3-RCC often have a poor prognosis due to the lack of effective therapeutic targets. Many studies have shown that TFE3-RCC is relatively insensitive to targeted therapy or immunotherapy. Therefore, further searching for targets that play an important role in the malignant progression of TFE3-RCC and developing new treatments have become scientific issues that need to be urgently addressed in the field of TFE3-RCC.

[0004] RNA interference (RNAi) is a conservative genetic defense mechanism, which refers to the highly conserved phenomenon of highly efficient and specific degradation of homologous mRNA induced by double-stranded RNA (dsRNA) during evolution, i.e., a sequence-specific post-transcriptional gene silencing (PTGS). In recent years, with the development of technology, RNAi technology has important applications in gene function research, disease treatment strategy development, and crop improvement, providing new ideas for the treatment of tumors and other diseases. Summary of the invention

[0005] In order to solve the technical problems existing in the prior art, the present invention provides an application of SV2B gene in preparing a drug for treating TFE3 rearranged renal cell carcinoma. The technical solution is as follows:

[0006] Application of SV2B gene as a therapeutic target for TFE3 rearrangement renal cell carcinoma in the preparation of drugs for the treatment of TFE3 rearrangement renal cell carcinoma.

[0007] Optionally, the drug inhibits the expression of SV2B gene, thereby inhibiting the proliferation, invasion, migration and in vivo tumorigenesis of TFE3-rearranged renal cell carcinoma cells.

[0008] Use of an SV2B gene expression inhibitor in the preparation of a drug for treating TFE3 rearranged renal cell carcinoma.

[0009] Optionally, the expression inhibitor comprises a nucleic acid molecule, a protein, or a compound;

[0010] Wherein, the nucleic acid molecules include siRNA and shRNA.

[0011] Optionally, the siRNA is siSV2B-1 or siSV2B-2; wherein the sense strand sequence of siSV2B-1 is shown as SEQ ID No. 1, and the antisense strand sequence is shown as SEQ ID No. 2; the sense strand sequence of siSV2B-2 is shown as SEQ ID No. 3, and the antisense strand sequence is shown as SEQ ID No. 4; and / or

[0012] The sequence of the shRNA is shown in SEQ ID No. 7.

[0013] A siRNA for targeted silencing of the SV2B gene, wherein the siRNA is siSV2B-1 or siSV2B-2; wherein the sense chain sequence of siSV2B-1 is shown as SEQ ID No. 1, and the antisense chain sequence is shown as SEQ ID No. 2; wherein the sense chain sequence of siSV2B-2 is shown as SEQ ID No. 3, and the antisense chain sequence is shown as SEQ ID No. 4.

[0014] A shRNA for targeted silencing of the SV2B gene, wherein the sequence of the shRNA is shown as SEQ ID No. 7.

[0015] A shRNA lentiviral vector, comprising the shRNA.

[0016] The method for constructing the shRNA lentiviral vector comprises the following steps:

[0017] 1) synthesizing the sense strand and antisense strand of the shRNA, and annealing the sense strand and antisense strand of the shRNA;

[0018] 2) Enzyme digestion of vector plasmid;

[0019] 3) The vector plasmid after enzyme digestion is ligated with the annealing product obtained in step 1) to obtain the target plasmid shSV2B;

[0020] 4) The target plasmid shSV2B, packaging plasmid VSVG and PAX2 obtained in step 3) are thoroughly mixed; and

[0021] 5) Add the transfection reagent and the mixed plasmid obtained in step 4) to HEK293T cells, culture them, and collect the supernatant to obtain the shRNA lentiviral vector.

[0022] A drug for treating TFE3-rearranged renal cell carcinoma comprising an inhibitor of SV2B gene expression.

[0023] Optionally, the expression inhibitor comprises a nucleic acid molecule, a protein, or a compound;

[0024] Wherein, the nucleic acid molecules include siRNA and shRNA.

[0025] Optionally, the siRNA is siSV2B-1 or siSV2B-2; wherein the sense strand sequence of siSV2B-1 is shown as SEQ ID No. 1, and the antisense strand sequence is shown as SEQ ID No. 2; the sense strand sequence of siSV2B-2 is shown as SEQ ID No. 3, and the antisense strand sequence is shown as SEQ ID No. 4; and / or

[0026] The sequence of the shRNA is shown in SEQ ID No. 7.

[0027] The beneficial effects brought about by the technical solution provided by the embodiment of the present invention include at least:

[0028] 1. The present invention confirms that inhibiting SV2B gene expression can inhibit the proliferation, metastasis, invasion and tumor formation of TFE3-RCC tumor cells in vivo, proving that SV2B is a potential new target for the treatment of TFE3-RCC, which is conducive to further studying the occurrence and development mechanism of tumor-related diseases caused by abnormal activation of TFE3-RCC.

[0029] 2. The present invention designs shRNA sequences and siRNA sequences for human SV2B, and constructs corresponding shRNA lentiviral silencing vectors. The experimental results confirm that the shRNA and siRNA of the present invention can significantly silence the expression of SV2B. In view of SV2B as a potential therapeutic target for TFE3-RCC, the shRNA, siRNA and related biological reagents of SV2B provided by the present invention can be used to screen and prepare drugs for treating TFE3-RCC. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0031] Figure 1A This is a diagram verifying the knockdown effect of siRNA of SV2B at the RNA level; Figure 1BThis is a diagram verifying the knockdown effect of siRNA of SV2B at the protein level;

[0032] Figure 2A is a graph showing the effect of siRNA knockdown of SV2B on cell proliferation rate compared with the control group; Figure 2B is a graph showing the effect of siRNA knockdown of SV2B on cell migration ability compared with the control group; Figure 2C is a graph showing the effect of siRNA knockdown of SV2B on cell invasion ability compared with the control group;

[0033] Figure 3A This is a diagram verifying the knockdown effect of shRNA of SV2B at the RNA level; Figure 3B This is a diagram verifying the knockdown effect of shRNA of SV2B at the protein level; Figure 3C This is a graph showing the effect of shRNA knockdown of SV2B on the tumorigenicity of cells in vivo compared with the control group;

[0034] Figure 4 Schematic diagram of the shSV2B lentiviral vector provided in an embodiment of the present invention. DETAILED DESCRIPTION

[0035] The technical solution of the present invention is described below in conjunction with the accompanying drawings.

[0036] The research data of the present invention show that SV2B (synaptic vesicle glycoprotein 2B1) can be used as a potential target for the treatment of TFE3-RCC, which is of great significance for the development of drugs for the treatment of TFE3-RCC. Because there is still a lack of inhibitors for SV2B, it is necessary to develop inhibitors for SV2B to improve its specificity and tissue specificity for SV2B. In view of the fact that there is no method for targeted silencing of SV2B in the prior art, the purpose of the present invention is to provide siRNA sequences, shRNA sequences, primers, and shRNA lentiviral packaging methods for targeted silencing of SV2B. It is intended to solve the problem of the current lack of SV2B inhibitors and the lack of SV2B targeted silencing methods.

[0037] Example 1

[0038] 1. Synthesis of siRNA targeting SV2B. Two siRNAs were designed, and their sequences are shown in Table 1 below:

[0039] Table 1

[0040]

[0041] The above sequence was synthesized by Suzhou Genema Co., Ltd.

[0042] 2. Design of SV2B qPCR related primers:

[0043] Upstream primer: 5′-GAGGAGAACACCTCAGTTGGC-3′ (SEQ ID No. 5);

[0044] Downstream primer: 5'-CAGAGCACAGACGATGACAAAC-3' (SEQ ID No. 6).

[0045] The above sequences were synthesized by Shenzhen BGI Co., Ltd.

[0046] 3. Verification of SV2B knockdown.

[0047] 3.1 Extract RNA from TFE301-1 cells (Source: Feng H, Cao S, Fu S, Liu J, Gao Y, Dong Z, et al. NMRK2 is an efficient diagnostic indicator for Xp11.2 translocation renal cell carcinoma. J Pathol 2024; 264(2):228-240.) The FastPure® Cell / Tissue Total RNA Isolation Kit V2 was used for extraction. The specific steps are as follows:

[0048] 1) Collect an appropriate amount of cell pellet, add 500 μL Buffer RL, mix well, add FastPure gDNA-Filter Columns III (FastPure gDNA-Filter Columns III has been placed in the collection tube), centrifuge at 12000 rpm for 30 seconds, and collect the filtrate.

[0049] 2) Add 0.5 times the volume of anhydrous ethanol to the filtrate and mix thoroughly.

[0050] 3) Transfer all the mixed solution from step 2) to FastPure RNA Columns III, centrifuge at 12000 rpm for 30 seconds, and discard the filtrate.

[0051] 4) Add 700 μL Buffer RW1 to FastPure RNA Columns III, centrifuge at 12,000 rpm for 30 seconds, and discard the filtrate.

[0052] 5) Add 700 μL Buffer RW2 to FastPure RNA Columns III, centrifuge at 12,000 rpm for 30 seconds, and discard the filtrate.

[0053] 6) Add 500 μL Buffer RW2 to FastPure RNA Columns III and centrifuge at 12,000 rpm for 2 minutes.

[0054] 7) Discard the filtrate, place FastPure RNA Columns III back into the collection tube, and centrifuge at 12,000 rpm for 1 min to remove as much ethanol as possible from the surface of the adsorption column.

[0055] 8) Carefully transfer the adsorption column to a new RNase-free Collection Tubes 1.5 mL centrifuge tube, add 100 μL of RNase-free deionized water to the center of the adsorption column, let it stand at room temperature for 5 minutes, and centrifuge at 12,000 rpm for 2 minutes to elute the RNA.

[0056] 9) Measure the concentration. The extracted RNA can be used directly in downstream experiments or stored at -80°C.

[0057] 3.2 Reverse transcription: Use HiScript III RT SuperMix for qPCR (+gDNA wiper) kit, the specific steps are as follows.

[0058] 1) Genomic DNA removal, the specific system configuration is shown in Table 2 below:

[0059] Table 2

[0060]

[0061] 2) Mix by gently pipetting. 42℃ , 2 min.

[0062] 3) Prepare the reverse transcription reaction system. The specific system configuration is shown in Table 3 below:

[0063] Table 3

[0064]

[0065] 4) Perform reverse transcription reaction. The specific procedure is shown in Table 4 below:

[0066] Table 4

[0067]

[0068] 5) The product can be used immediately for qPCR reaction, or stored at -20℃ and used within half a year; for long-term storage, it is recommended to store at -80℃ after aliquoting. Repeated freezing and thawing of cDNA should be avoided.

[0069] 3.3 qPCR

[0070] 1) Use Taq Pro Universal SYBR qPCR Master Mix Kit. The specific reaction system is shown in Table 5 below:

[0071] Table 5

[0072]

[0073] 2) The reaction procedure is shown in Table 6 below:

[0074] Table 6

[0075]

[0076] 3) Statistics and analysis.

[0077] The experimental results are as follows Figure 1A and Figure 3A As shown, from Figure 1A It can be seen that both siRNAs can effectively inhibit the expression of SV2B RNA (siSV2B-1 group: control group = 0.13 ± 0.03: 1.03 ± 0.09; siSV2B-2 group: control group = 0.06 ± 0.01: 1.03 ± 0.09), and the P values ​​are all less than 0.01, which is statistically significant. Figure 3A It can be seen that shRNA can effectively inhibit the expression of SV2B RNA (shSV2B group: control group = 0.57 ± 0.04: 1.00 ± 0.13), the P value is less than 0.01, which is statistically significant.

[0078] 3.4 TFE301-1 cell protein extraction: Add appropriate amount of RIPA lysis buffer containing protease inhibitors to the cells, lyse on ice for 20 min, add appropriate amount of 5×SDS-PAGE, and place in a 95℃ metal bath for 10 min.

[0079] 3.5 Immunoblotting

[0080] 1) Clean the glass plate. Use deionized water to thoroughly clean the glass plate for preparing PAGE gel and place it in a bellows to dry.

[0081] 2) Prepare the gel. Take out the precast gel from the 4°C refrigerator in advance (choose different concentrations of lower gel according to the size of the target molecule) and restore it to room temperature. Align the glass plates and put them into the gel holder clamp, then clamp them vertically on the gel holder to prepare for gel pouring. Mix the gel system according to the instructions of the One-Step PAGE Gel Fast Preparation Kit (E304-01, Novozymes). After adding the lower gel, press the line with anhydrous ethanol and keep it at room temperature for 25 minutes. Remove the anhydrous ethanol, wait for it to evaporate completely, add the upper gel, insert the comb, and keep it at room temperature for 20 minutes. At this point, the gel preparation is complete.

[0082] 3) Prepare electrophoresis fluid.

[0083] 4) Loading. Place the extracted target protein solution in an ice box, and add an appropriate amount of electrophoresis solution (specific ingredients are shown in Table 7 below) to the electrophoresis tank. Since the electrophoresis solution contains SDS, it has a lubricating effect. It will be easier to remove the comb when the gel is immersed in the electrophoresis solution. (Note: When removing the comb, keep it vertically upward to avoid squeezing and deforming the loading well). Use a special loading gun tip to absorb the sample, and be careful not to suck in bubbles. Insert the special loading gun tip into the loading well and slowly add the sample. The loading volume of each well should be roughly the same (1XSDS-PAGE can be used for balancing).

[0084] Table 7

[0085]

[0086] 5) Electrophoresis. Pay attention to the standard use of the instrument. If you use precast gel, you can directly keep the voltage at 120 V until the electrophoresis is completed.

[0087] 6) Prepare the transfer solution for the fast protein transfection system. The transfer solution is shown in Table 8:

[0088] Table 8

[0089]

[0090] 7) Use the standard procedure of the protein rapid wet transfer system (eBlot™ L1, GenScript) for membrane transfer. Before transfer, soak the PVDF membrane in methanol for 1 min to fully activate it.

[0091] 8) Blocking: Use QuickBlock™ Blocking Solution (TBSTw) (P0231, Biotech) for blocking at room temperature for 5 minutes.

[0092] 9) Incubate with primary antibody. Prepare primary antibody (SV2B antibody, 14624-1-AP, Proteintech; β-tubulin, BE0025, Bio-Edge) in antibody diluent and add to antibody incubation box at 4°C overnight. Wash the membrane 3 times with 1xTBST, 5 min each time.

[0093] 10) Incubate with secondary antibody. Prepare secondary antibody (Goat Anti-Mouse IgG (H&L)-HRPConjugated, BE0102, Bio-Edge; Goat Anti-Rabbit IgG (H&L)-HRP Conjugated, BE0101, Bio-Edge) in antibody diluent and add to antibody incubation box for 1 h at room temperature. Wash with 1xTBST for 5 min × 3 times.

[0094] 11) Develop and analyze the results.

[0095] The experimental results are as follows Figure 1B and Figure 3B As shown, from Figure 1B It can be seen that siRNA can effectively inhibit the expression of SV2B protein; Figure 3B It can be seen that shRNA can effectively inhibit the expression of SV2B protein.

[0096] 4. CCK8 Experiment

[0097] 1) TFE301-1 cell plating (96-well plate): divided into 3 groups: siNC (control group), siSV2B-1, and siSV2B-2, with 5 replicate wells in each group, and set 5 time points for transfection at 0, 24, 48, and 72 h. Approximately 5,000 cells were plated in each well. 100 μL of culture medium was added to each well.

[0098] 2) siRNA transfection. First prepare the total system of each group, then add it to the corresponding wells and shake well. The specific system is shown in Table 9 below:

[0099] Table 9

[0100]

[0101] After the culture system was incubated, it was mixed, allowed to stand for 15 min, and added to the 96-well plate.

[0102] 3) 2 hours before the time points of 0, 24, 48, and 72 h, add 20 μL of CCK8 reagent (CK001-3000T, Langbolide), incubate at 37°C for 2 h, measure the absorbance at a wavelength of 450 nm, record the OD value, and remove the maximum and minimum values ​​in the five replicate wells.

[0103] 4) Data analysis.

[0104] The experimental results are as follows Figure 2A As shown, from Figure 2A It can be seen that knocking down SV2B by siRNA can significantly inhibit the proliferation rate of TFE301-1 cells. After 72 hours of siRNA action, the absorbance ratio of the siSV2B-1 group: control group was 1.08±0.05:2.03±0.07, with a P value less than 0.001, which was statistically significant; the absorbance ratio of the siSV2B-2 group: control group was 0.98±0.02:2.03±0.07, with a P value less than 0.001, which was statistically significant.

[0105] 5. Scratch test

[0106] 1) TFE301-1 cells were plated (6-well plate) so that the density of cells attached to the plate was approximately 70% after 24 hours.

[0107] 2) siRNA transfection, divided into three groups: siNC (control group), siSV2B-1 and siSV2B-2.

[0108] 3) 24 hours after siRNA transfection, use a yellow pipette tip to draw a “X” in the 6-well plate that is almost full of cells, and try to ensure that the width of the scratch in each well is the same; change the medium.

[0109] 4) Take photos. Take photos at 36, 48, 60, and 72 hours after transfection.

[0110] 5) Analysis and statistics.

[0111] The experimental results are as follows Figure 2B As shown, from Figure 2B It can be seen that knocking down SV2B can significantly inhibit the migration of TFE301-1 cells. Within 36 hours, the migration distance of TFE301-1 cells decreased from 543.8±3.4μm (control group) to 284.0±5.0μm (siSV2B-1 group) or 307.0±9.8 (siSV2B-2 group), and the P values ​​were all less than 0.01, which was statistically significant.

[0112] 6. Transwell assay

[0113] 1) TFE301-1 cells were plated (6-well plates), divided into three groups: siNC (control group), siSV2B-1 and siSV2B-2, and transfected with siRNA.

[0114] 2) Matrigel plating. The migration assay does not require plating, but the invasion assay does. Take out the matrigel from -80℃ 12 h in advance and place it in a 4℃ refrigerator for later use. Add 50 μL of matrigel mixture (matrigel: culture medium = 6:4, where the matrigel comes from Corning, catalog number 354234, and the culture medium comes from Procell, catalog number PM150210) to the chamber where the plating is required, and place it in a cell culture incubator for 60 min. Do not generate bubbles during the plating process.

[0115] 3) Add 600 μL of serum-containing culture medium to the bottom of the chamber; digest the cells 24 hours after transfection to make a single-cell suspension (without serum).

[0116] 4) Add 200 μL of cell suspension to each chamber, count the cells to ensure that the number of cells in 200 μL suspension is about 30,000, and place in a cell culture incubator for culture.

[0117] 5) For the chamber without glue, proceed to the next step after 24 hours, and for the chamber with glue, proceed to the next step after 48 hours.

[0118] 6) Aspirate the culture medium inside and below the chamber, and gently soak the lower chamber with PBS to remove the culture medium and serum inside and outside the chamber as much as possible; soak the chamber in cell tissue fixative (P11102, Solebow) at room temperature for 20 min.

[0119] 7) Soak the chamber in PBS twice to remove the fixative inside and outside the chamber; soak the chamber in crystal violet working solution for 5 min, and soak it in running tap water to remove the crystal violet.

[0120] 8) Use a cotton swab to clean the adhered and fixed cells in the chamber, take pictures under a microscope, and count them.

[0121] The experimental results are as follows Figure 2C As shown, from Figure 2C It can be seen that within 24 hours, the number of TFE301-1 cells that penetrated the membrane of the transwell chamber decreased from 411.4±32.3 (control group) to 69.0±10.5 (siSV2B-1 group) or 64.0±8.9 (siSV2B-2 group), and the P values ​​were all less than 0.01, which was statistically significant. After knocking down SV2B, the invasion of TFE301-1 cells could be significantly inhibited. Within 36 hours, the number of TFE301-1 cells that penetrated the matrix gel and membrane in the transwell chamber decreased from 551.2±30.0 (control group) to 60.8±12.6 (siSV2B-1 group) or 69.0±10.8 (siSV2B-2 group), and the P values ​​were all less than 0.01, which was statistically significant.

[0122] 7. In vivo tumorigenesis experiment

[0123] 7.1 Construction of shRNA plasmid targeting SV2B.

[0124] The selected interference vector pCLenti-U6-shRNA-CMV-EGFP-F2A-BSR-WPRE vector map is as follows Figure 4 As shown, the shRNA sequence to be constructed is inserted to obtain the target plasmid shSV2B.

[0125] The specific steps are as follows:

[0126] 1) Interference target design and primer synthesis:

[0127] According to the general principles of shRNA design, the shRNA target was designed, and its corresponding target site sequence is: GATGAAGAATACAAGTCTAAA (SEQ ID No. 7)

[0128] 2) Primers anneal to form double-stranded fragments with sticky ends:

[0129] Dissolve the synthesized oligo into 20μM using oligo annealing buffer (D0251, Bio-Tech), and mix 30μl of each complementary single strand. Heat the oligo mixture in a water bath at 95℃ for 5min, then leave the water bath uncovered and cool naturally to room temperature to form double-stranded oligo fragments. Take 1μl for subsequent ligation reaction, and store the rest at -20℃.

[0130] 3) Preparation of linearized expression vector:

[0131] The expression vector was digested with restriction endonucleases AgeI (Thermo Fisher) and EcoRI (Thermo Fisher). The digestion reaction system was: 2 μg of plasmid, 5 μl of 10 x reaction buffer, 1 μl of each restriction endonuclease, and 50 μl of deionized water. The mixture was incubated in a 37°C water bath for more than 2 h. The digestion product was subjected to agarose gel electrophoresis to detect the digestion effect, and the target vector band was cut out from the gel after agarose gel electrophoresis and recovered with TaKaRa MiniBEST Agarose Gel DNA Extraction KitVer.3.0. For specific steps, refer to the kit manual.

[0132] 4) The interference fragment is connected into the expression vector.

[0133] The ligation reaction system is shown in Table 10 below:

[0134] Table 10

[0135]

[0136] Ligation was carried out at 16°C overnight.

[0137] 5) Transformation of competent cells.

[0138] 6) Identify positive transformants by colony PCR.

[0139] 7) Send positive clones for sequencing. The positive clones obtained by colony identification are sent to a sequencing company for sequencing verification.

[0140] 8) Plasmid mini-extraction: After sequencing, the correct positive clones are verified and then subjected to plasmid mini-extraction. For specific steps, refer to the instruction manual of FastPureEndoFree Plasmid Mini Kit (DC203-01, Novozymes).

[0141] 7.2 Packaging of shSV2B lentivirus.

[0142] 1) Plate HEK293T cells. Before virus packaging, ensure that HEK293T cells (National Laboratory Cell Resource Sharing Platform) are in good condition, free of bacteria and mycoplasma contamination, and the cell density in a 100 mm dish is about 50%. It is best to change the medium of HEK293T cells 2-4 hours before virus packaging.

[0143] 2) Prepare the jetPRIME® transfection reagent kit, target plasmid shSV2B, packaging plasmid VSVG and PAX2. Each 100 mm dish of cells requires 5 μg of target plasmid, 3 μg of PAX2 plasmid and 2 μg of VSVG4 plasmid. The following virus packaging is carried out according to 100 mm culture dishes.

[0144] 3) Add 500 μL of transfection buffer to a sterile 1.5 mL EP tube, and add the target plasmid and packaging plasmid in proportion. Mix thoroughly.

[0145] 4) Add 20 μL of transfection reagent to the mixture, mix thoroughly, and let stand at room temperature for 15 min.

[0146] 5) Add the mixture evenly into HEK293T cells, shake gently, place in a cell culture incubator, and change the medium after 6-8 hours.

[0147] 6) After 48 h, transfer the supernatant of the culture medium containing the virus to a 15 mL centrifuge tube, centrifuge at 1500 rpm, 4°C for 5 min, replace with fresh culture medium, and continue culturing in a cell culture incubator.

[0148] 7) Filter the supernatant in the 15 mL centrifuge tube through a 0.45 μm filter cartridge, add the corresponding volume of virus concentrate to the filtrate, mix by inverting, and store at 4°C overnight.

[0149] 8) After overnight at 4°C in step 7), place the virus mixture in a high-speed low-temperature centrifuge and centrifuge at 12,000 rpm at 4°C for 15 min. Discard the supernatant and fully dissolve and mix the precipitated virus particles with 500 μL of fresh culture medium and store at -80°C until use.

[0150] 9) Use the 72 h virus-containing culture medium supernatant to concentrate and preserve the virus according to the procedures in 7) and 8).

[0151] 7.3 Virus transfection and stable strain screening.

[0152] 1) Plate TFE301-1 cells in 6-well plates, with 6 wells and a cell density of approximately 50% in each well.

[0153] 2) Take out a tube of concentrated virus (about 800 μL), add 0 μL, 50 μL, 100 μL, 150 μL, 200 μL, and 250 μL of virus concentrate to 6 wells in sequence, and add appropriate volume of Polybrene (1000x) (H8761, Solebol). Shake well and place in cell culture incubator for further culture.

[0154] 3) Change the medium after 24 hours, add low concentration of blasticidin (5 μg / mL) and culture for 5 days, then add medium concentration of puromycin (10 μg / mL) and culture for 5 days, and finally add high concentration of puromycin (20 μg / mL) and culture for 5 days. Obtain a stable cell line with knockdown of SV2B.

[0155] 7.4 Verification of shSV2B knockdown effect qPCR and immunoblotting were used for verification, and the specific steps were the same as before.

[0156] 7.5 Subcutaneous tumor formation experiment in NSG mice.

[0157] 1) Preparation of NSG mice: Divide into two groups (shNC (control group) and shSV2B), 5 mice in each group, 4-6 weeks old.

[0158] 2) Preparation of TFE301-1 cells. Five million cells were injected subcutaneously into each mouse in a volume of approximately 100 μL (50 μL of cell suspension + 50 μL of Matrigel (354234, Corning).

[0159] 3) Use an insulin syringe to inject 100 μL of the cell mixture into the subcutaneous tissue of the left axilla of the NSG mouse. After the injection, do not pull out the needle in a hurry. Fix the syringe for 30 seconds before pulling it out.

[0160] 4) The mice were housed under SPF conditions for 12 weeks and then killed by carbon dioxide anesthesia. The subcutaneous tumors of mice in each group were removed and weighed.

[0161] The experimental results are as follows Figure 3C As shown, from Figure 3C It can be seen that knocking down SV2B can significantly inhibit the growth of subcutaneous tumors in NSG mice, and the tumor weights of the control group and the shSV2B group are statistically different, with a P value of less than 0.001. The maximum tumor weight in the control group was 629 mg, and the minimum was 130 mg, while the maximum tumor weight in the shSV2B group was 59 mg, and the minimum was 35 mg.

[0162] The above is only a specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Any person skilled in the art can easily think of changes or substitutions within the technical scope disclosed by the present invention, which should be included in the protection scope of the present invention. Therefore, the protection scope of the present invention should be based on the protection scope of the claims.

Claims

1. Use of an inhibitor of SV2B gene expression in the preparation of a drug for treating TFE3 rearranged renal cell carcinoma, characterized in that: The SV2B gene expression inhibitor includes siRNA and shRNA, wherein: The siRNA is siSV2B-1 or siSV2B-2; wherein the sense strand sequence of siSV2B-1 is shown in SEQ ID No. 1, and the antisense strand sequence is shown in SEQ ID No. 2; the sense strand sequence of siSV2B-2 is shown in SEQ ID No. 3, and the antisense strand sequence is shown in SEQ ID No. 4; and / or The sequence of the shRNA is shown in SEQ ID No.

7.

2. A siRNA for targeted silencing of the SV2B gene, characterized in that: The siRNA is siSV2B-1 or siSV2B-2; wherein the sense strand sequence of siSV2B-1 is shown as SEQ ID No. 1, and the antisense strand sequence is shown as SEQ ID No. 2; the sense strand sequence of siSV2B-2 is shown as SEQ ID No. 3, and the antisense strand sequence is shown as SEQ ID No.

4.

3. A shRNA for targeted silencing of the SV2B gene, characterized in that: The sequence of the shRNA is shown in SEQ ID No.

7.

4. A shRNA lentiviral vector, characterized in that: The shRNA lentiviral vector comprises the shRNA according to claim 3.

5. The method for constructing the shRNA lentiviral vector according to claim 4, characterized in that: The following steps are involved: 1) synthesizing the sense strand and antisense strand of the shRNA, and annealing the sense strand and antisense strand of the shRNA; 2) Enzyme digestion of vector plasmid; 3) The vector plasmid after enzyme digestion is ligated with the annealing product obtained in step 1) to obtain the target plasmid shSV2B; 4) The target plasmid shSV2B, packaging plasmid VSVG and PAX2 obtained in step 3) are thoroughly mixed; and 5) Add the transfection reagent and the mixed plasmid obtained in step 4) to HEK293T cells, culture them, and collect the supernatant to obtain the shRNA lentiviral vector.

6. A drug for treating TFE3 rearranged renal cell carcinoma, characterized in that: Including SV2B gene expression inhibitors, the SV2B gene expression inhibitors include siRNA, shRNA, wherein, The siRNA is siSV2B-1 or siSV2B-2; wherein the sense strand sequence of siSV2B-1 is shown in SEQ ID No. 1, and the antisense strand sequence is shown in SEQ ID No. 2; the sense strand sequence of siSV2B-2 is shown in SEQ ID No. 3, and the antisense strand sequence is shown in SEQ ID No. 4; and / or The sequence of the shRNA is shown in SEQ ID No. 7.

Images