A strain of Lactococcus lactis M6 and its application

Abstract

The present invention discloses a strain of Lactococcus lactis M6 and its application, belonging to the technical field of microorganisms. Lactococcus lactis )M6 is obtained by separation and purification from kiwifruit samples picked in Sichuan, China. It has multiple functions such as high yield of γ-aminobutyric acid (GABA), high yield of butyric acid, antioxidant and antibacterial properties, and has great industrial application value.

Description

Technical Field

[0001] The invention relates to a strain of Lactococcus lactis M6 and application thereof, belonging to the technical field of microorganisms. Background Art

[0002] Lactococcus lactis ( Lactococcus lactis ) is a type of lactic acid bacteria, a Gram-positive bacterium widely distributed in the natural environment. They are usually round-ended straight rods, about 0.5 to 1.5 microns in size, and mostly exist alone, in pairs or in short chains. Lactococcus lactis is an anaerobic or facultative anaerobic organism that can survive and reproduce in a variety of environments. Lactococcus lactis can not only effectively ferment sugars to produce lactic acid, but also produce a series of bioactive substances, such as antimicrobial peptides and metabolites, which have a positive impact on host health.

[0003] Lactococcus lactis has important application value in the food industry, especially in the production of dairy products and fermented foods. Through the fermentation process, these strains can not only improve the flavor and texture of food, but also enhance the safety of food by producing antimicrobial substances, or enhance the probiotic properties of food by producing functional substances. In addition, Lactococcus lactis has also shown application potential in the fields of agriculture and medicine, such as as an animal feed additive to improve intestinal health, or for the manufacture of drugs, such as the production of active lactic acid. The probiotic function of Lactococcus lactis is one of its research hotspots, which includes maintaining intestinal microbial balance, enhancing immune function, lowering cholesterol levels and preventing intestinal infections. Its probiotic properties are mainly achieved through interactions with intestinal cells, which include adhesion to intestinal epithelial cells, fighting against competition from pathogenic microorganisms, and affecting host health through immune regulation.

[0004] Lactococcus lactis is widely used in the food industry and health sciences, and its genetic and functional diversity is extremely rich. However, research on the isolation, identification, probiotic properties and metabolic mechanisms of Lactococcus lactis is still insufficient. Although current research has made certain progress in the functions and applications of Lactococcus lactis, most of it focuses on antibacterial properties and fermentation applications. Research on its applicability from the perspective of probiotics is far from enough, especially focusing on its effects on intestinal flora metabolites (such as butyric acid). For example, patent CN103173372A discloses a strain of Lactococcus lactis. Although it has a good effect in antibacterial, it does not deeply explore other functional properties of the strain and has limited application areas; patent CN116410905A focuses on its application in milk fermented products, mainly its excellent ability to produce specific flavor substances, and does not pay attention to its probiotic properties. Therefore, it is urgent to further explore and study more Lactococcus lactis with significant probiotic properties, and to deeply study its functions according to the characteristics of its different sources so that it can play a better role.

[0005] γ-aminobutyric acid (γ-arninobutyric acid, GABA) GABA is an important inhibitory neurotransmitter that can help reduce anxiety and stress, improve sleep quality, and also has a positive effect on lowering blood pressure. In addition, GABA also shows potential benefits in regulating heart rate, reducing inflammatory responses, enhancing immune function, and promoting brain health, especially in anti-depression and neuroprotection. Butyric acid, also known as butyric acid, is an important short-chain fatty acid that can provide energy to intestinal cells and promote the integrity and function of the intestinal wall, thereby strengthening the intestinal barrier and reducing inflammation. In addition, butyric acid can also regulate local and systemic immune responses and help inhibit the development of inflammatory diseases such as enteritis and other autoimmune diseases. In terms of metabolic health, butyric acid has also been found to improve insulin sensitivity and regulate blood sugar levels, providing potential benefits for the prevention and management of diabetes. Butyric acid ingested from the outside is absorbed before it reaches the large intestine to take effect, so the microorganisms that produce butyric acid in the body are of research significance. In the prior art, a variety of lactococci with the function of producing γ-aminobutyric acid have been reported, such as the lactococci disclosed in patent CN110218674A, which have a γ-aminobutyric acid production of 0.39 g / L after fermentation for 40 hours, but the strain does not have the function of producing butyric acid. Screening a lactococcus lactis that can produce γ-aminobutyric acid and butyric acid at the same time under the premise of meeting the requirements of tolerance to the in vivo environment and colonization in the intestine can improve the probiotic function of lactococcus lactis, which has great industrial promotion value. Summary of the invention

[0006] In order to solve the above-mentioned defects and shortcomings in the prior art, the present invention separates and purifies a strain of Lactococcus lactis (Lactococcus lactis) from kiwifruit samples picked in Chengdu, Sichuan Lactococcus lactis ) M6 strain, which has multiple functions such as acid and bile resistance, resistance to in vitro digestion, strong adhesion ability, safety, production of GABA, production of short-chain fatty acids and antioxidant properties, and has potential application value.

[0007] To solve the above problems, the first object of the present invention is to provide a Lactococcus lactis ( Lactococcus lactis ) M6 strain, the Lactococcus lactis M6 has been deposited in the China General Microbiological Culture Collection Center (CGMCC) on October 30, 2024, with the deposit number CGMCC No. 32405, and the deposit address is No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing. Its 16S rDNA nucleotide sequence is shown in SEQ ID NO: 1.

[0008] The second object of the present invention is to provide a microbial preparation containing the Lactococcus lactis M6.

[0009] In one embodiment of the present invention, in the microbial preparation, the number of Lactococcus lactis M6 is not less than 1×10 8 CFU / mL or 1×10 8 CFU / g.

[0010] The third object of the present invention is to provide a product containing the Lactococcus lactis M6 or the microbial preparation.

[0011] In one embodiment of the present invention, the product comprises a food or a medicine.

[0012] In one embodiment of the present invention, the food comprises health food.

[0013] The fourth object of the present invention is to provide a method for producing GABA and / or butyric acid, which comprises fermenting the Lactococcus lactis M6.

[0014] The fifth object of the present invention is to provide the use of Lactococcus lactis M6 in producing GABA.

[0015] The sixth object of the present invention is to provide a Lactococcus lactis ( Lactococcus lactis ) Application of M6 strain in butyrate production.

[0016] The seventh object of the present invention is to provide the use of the Lactococcus lactis M6 in the preparation of antioxidants.

[0017] Lactococcus lactis M6 has strong antioxidant capacity and can provide many health benefits to the host. Antioxidant capacity can help neutralize free radicals and reduce oxidative stress, thereby reducing cell damage, slowing the aging process, and helping to prevent chronic diseases caused by free radicals, such as cardiovascular disease, certain types of cancer, and neurodegenerative diseases. In addition, strong antioxidant effects can improve skin health, enhance immune system function, and maintain overall cellular health, helping to maintain long-term health and vitality of the body.

[0018] The eighth objective of the present invention is to provide the use of the Lactococcus lactis M6 in the preparation of an antibacterial agent.

[0019] Lactococcus lactis M6 has a strong ability to inhibit pathogens, which can significantly enhance the host's healthy defenses. This ability helps maintain the balance of the intestinal microbiota, prevents excessive growth and invasion of harmful microorganisms, and thus reduces the risk of infection, especially in the intestines. By inhibiting pathogens, these probiotics can also reduce the occurrence of foodborne diseases and support the healthy functioning of the immune system, enhancing the body's resistance to a variety of diseases. In addition, through competitive exclusion and the production of antibacterial substances, these strains may also play a role in preventing antibiotic-related complications such as antibiotic-associated diarrhea, improving the efficacy and overall quality of recovery of patients.

[0020] In one embodiment of the present invention, the antibacterial agent is used to inhibit the growth of Staphylococcus aureus, Escherichia coli, and Listeria monocytogenes.

[0021] Beneficial effects:

[0022] The lactococcus lactis provided by the present invention ( Lactococcus lactis ) M6 has the function of high production of γ-aminobutyric acid (GABA) and butyric acid, with GABA production of 5.23±0.19g / L and butyric acid production of 214.77±8.28mg / L.

[0023] The lactococcus lactis provided by the present invention ( Lactococcus lactis ) M6 has antibacterial properties, and the inhibition zones against Staphylococcus aureus, Escherichia coli and Listeria monocytogenes are 14.73±0.058cm, 18.57±0.058cm and 20.67±0.058cm, respectively.

[0024] The lactococcus lactis provided by the present invention ( Lactococcus lactis ) M6 has good tolerance to bile salts and gastrointestinal environment. After 24 hours of culture in 0.3% bile salt, the survival rate was 86.44±4.03%; in a low acid environment of pH 2.0, the survival rate was 89.76±4.51%; after in vitro digestion, the survival rate was above 92%.

[0025] The lactococcus lactis provided by the present invention ( Lactococcus lactis ) M6 is sufficiently safe, the strain does not show hemolysis and has appropriate antibiotic tolerance.

[0026] Biomaterial Deposit

[0027] Lactococcus lactis ( Lactococcus lactis ) M6, taxonomic name Lactococcus lactis , was deposited in the General Microbiology Center of China Microorganism Culture Collection (CGMCC) on October 30, 2024, with the deposit number CGMCC No. 32405, and the deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 This is a colony picture of Lactococcus lactis M6;

[0029] Figure 2 is the phylogenetic tree of Lactococcus lactis M6;

[0030] Figure 3 It is a bar graph of the ability of Lactococcus lactis M6 to produce GABA;

[0031] Figure 4is a bar graph of the butyrate production capacity of Lactococcus lactis M6;

[0032] Figure 5 This is a bar graph of the antioxidant capacity of Lactococcus lactis M6;

[0033] Figure 6 This is a bar graph of the acid resistance of Lactococcus lactis M6;

[0034] Figure 7 is a bar graph of bile salt tolerance of Lactococcus lactis M6;

[0035] Figure 8 This is the in vitro digestion resistance curve of Lactococcus lactis M6;

[0036] Fig. 9 is the hydrophobicity bar graph of Lactococcus lactis M6;

[0037] Fig.10 It is a bar graph of the self-aggregation ability of Lactococcus lactis M6;

[0038] Fig.11 This is a hemolytic picture of Lactococcus lactis M6; the colony in the middle of the plate is Staphylococcus aureus, and the three colonies on the periphery are all Lactococcus lactis M6. DETAILED DESCRIPTION

[0039] The specific embodiments of the present invention are further described below. It should be noted that the description of these embodiments is used to help understand the present invention, but does not constitute a limitation of the present invention. In addition, the technical features involved in each embodiment of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0040] The experimental methods in the following examples are conventional methods unless otherwise specified, and the experimental materials used in the following examples are commercially available unless otherwise specified. The experimental materials involved in the following experiments are as follows:

[0041] Lactococcus lactis ( Lactococcus lactis ) M6 strain, isolated from kiwifruit samples picked in Sichuan, China, and stored in glycerol tubes at -80℃. Generally, colonies can be obtained by inoculating it on the surface of MRS solid culture medium plates and inverting it in a 37℃ constant temperature anaerobic incubator for 24 hours, and fermentation liquid can be obtained by picking a single colony and culturing it in MRS liquid culture medium.

[0042] MRS solid culture medium containing calcium carbonate: 5 g beef extract, 10 g peptone, 4 g yeast extract, 2 g triammonium citrate, 3 g anhydrous sodium acetate, 20 g glucose·H2O, 2 g dipotassium hydrogen phosphate, 801 mL Tween, 0.2 g MgSO4·7H2O, 0.037 g manganese sulfate, 5 g CaCO3, 15 g agar, add deionized water to make up to 1 L, adjust the pH to 6.5, autoclave at 121°C for 20 min, and prepare MRS plates.

[0043] MRS liquid culture medium: 5 g beef extract, 10 g peptone, 4 g yeast extract, 2 g triammonium citrate, 3 g anhydrous sodium acetate, 20 g glucose·H2O, 2 g dipotassium hydrogen phosphate, 801 mL Tween, 0.2 g magnesium sulfate·MgSO4·7H2O, 0.037 g manganese sulfate, add deionized water to make up to 1 L, adjust the pH to 6.5, and sterilize at 121°C under high pressure for 20 min to prepare MRS liquid culture medium.

[0044] Example 1: Lactococcus lactis ( Lactococcus lactis ) Isolation and identification of M6 strain

[0045] Lactococcus lactis ( Lactococcus lactis ) The M6 ​​strain was isolated from kiwifruit samples picked in Sichuan, China, as follows:

[0046] 1 kg of kiwifruit sample picked from Chengdu, Sichuan was naturally fermented in a sterile conical flask. 1 g of sample was suspended in 9 mL of sterile saline solution (0.85% (w / v)) every day and shaken to obtain a kiwifruit bacterial suspension. 1 mL of the kiwifruit bacterial suspension was taken and mixed thoroughly in 9 mL of sterile water to obtain 10 -2 Gradient, and so on dilute to get 10 -3 , 10 -4 and 10 -5 Use a sterile pipette to evenly apply 100uL of each gradient dilution onto the MRS plate medium in the culture dish and incubate at 37°C for 2 days. Select colonies with calcium-dissolving circles and milky white protrusions, then pick a single colony and streak culture on a fresh MRS plate medium, incubate at 37°C for 48 hours to obtain pure bacterial colonies. The results are as follows Figure 1 shown.

[0047] The above pure bacterial colonies were transferred to MRS slant medium, and the isolated strains were sequenced by 16S rDNA using 16S rDNA universal primers (F: AGAGTTTGATCCTGGCTCAG, R: TACGGCTACCTTGTTACGACTT) at Sangon Biotech Co., Ltd. to obtain the gene sequence shown in SEQ ID NO: 1. The obtained sequence was compared with the Genome database of NCBI by Blast. The results showed that the strain was different from the known Lactococcus lactis ( Lactococcus lactis ) 16S rDNA sequence homology > 99%, and evolutionary analysis was performed with homologous strains ( Figure 2 ), confirming that this strain is a different strain of Lactococcus lactis of the same species.

[0048] The lactococcus lactis M6 has been deposited in the China General Microbiological Culture Collection Center with a deposit number of CGMCC No. 32405 and a deposit date of October 30, 2024. It is classified and named as Lactococcus lactis Lactococcus lactis .

[0049] SEQ ID NO: 1:

[0050]

[0051] Example 2: Detection of GABA production ability of Lactococcus lactis M6

[0052] 100 μL of the Lactococcus lactis M6 suspension cultured in MRS liquid medium to the stable phase was inoculated into a new 8 mL MRS liquid medium. After culturing for 24 h, the suspension was collected (the number of viable bacteria was 1 × 10 8 CFU / mL), centrifuged at 10000r / min, 4℃ for 5min, collected the supernatant, and determined GABA by HPLC-MS: chromatographic column: PoroshellEC- C18 (3.0 mm×100 mm, 2.7 μm); mobile phase: phase A is 0.2% formic acid aqueous solution, phase B is acetonitrile + 0.2% formic acid. Elution gradient: 0.00~2.00 min, 95% A; 2.00~3.00 min, 30% A; 3.00~8.00 min, 30% A; 8.00~9.00min, 10% A; 9.00~10.00 min, 95% A; 10.00~12.00min, 95% A. Flow rate 0.40mL / min. Column temperature 35℃, injection volume 2μL. Mass spectrometry conditions: electrospray ionization source (ESI); scanning mode: positive ion scanning; detection mode: multiple reaction monitoring (MRM); ion source temperature 450℃; ionization voltage 5500V; spray pressure 275.8kPa. The results showed that compared with the low concentration of GABA in the blank medium MRS, the concentration of GABA in the fermentation supernatant of Lactococcus lactis M6 increased significantly, and the accumulated amount was 5.23±0.19g / L, indicating that Lactococcus lactis M6 can produce and secrete GABA in the stable period ( Figure 3 ).

[0053] Example 3: Detection of butyrate production ability of Lactococcus lactis M6

[0054] 100 μL of the Lactococcus lactis M6 suspension cultured in MRS liquid medium to the stable phase was inoculated into a new 8 mL MRS liquid medium. After culturing for 24 h, the suspension was collected (the number of viable bacteria was 1 × 10 8CFU / mL), centrifuged at 10000r / min and 4℃ for 5min, collected the supernatant, and filtered the supernatant through a 0.22μm filter membrane. The sample determination method was improved on the basis of the previously reported method (Jing, Food Chemistry, 2021). In general, the determination was performed by gas chromatograph, the chromatographic column was Agilent J&W DB-FFAP column (30m×0.25mm×0.25μm); the injection volume was 1μL. The injection port temperature was 250℃, the split ratio was 10:1, and the program temperature program was: the starting temperature was 80℃, maintained for 2min; increased to 180℃ at 10℃ / min, maintained for 2min; increased to 230℃ at 3℃ / min, maintained for 5min. The detector was a flame ionization detector (FID) at a temperature of 240℃. The carrier gas was high-purity nitrogen with a flow rate of 1 mL / min; the tail gas was nitrogen with a flow rate of 25 mL / min; the hydrogen flow rate was 30 mL / min; and the air flow rate was 300 mL / min. Standard samples of butyric acid were used to calibrate the retention time of the chromatographic peak, extract the chromatographic peak area, and perform quantitative analysis using the standard curve. The results showed that compared with the blank culture medium MRS, the concentration of butyric acid in the fermentation supernatant of Lactococcus lactis M6 increased significantly, and the accumulated amount was 214.77±8.28 mg / L, indicating that Lactococcus lactis can produce and secrete butyric acid during the stable period ( Figure 4 ), with the potential to improve intestinal health.

[0055] Example 4: Detection of Antioxidant Capacity of Lactococcus lactis M6

[0056] Lactococcus lactis M6 was inoculated into MRS liquid culture medium and cultured for 24 hours, then centrifuged at 10,000 rpm and 4°C for 5 minutes to collect the bacteria; the bacteria were washed twice with sterile saline and resuspended to obtain a bacterial suspension with an optical density of 5.0 at 600 nm for subsequent detection.

[0057] Determination of DPPH free radical scavenging ability. Take 1mL DPPH solution (0.2 mmol / L ethanol solution) and mix it with 1mL bacterial suspension in the sample group. After reacting in the dark for 30min at room temperature, centrifuge it at 4000r / min for 5min, and measure the absorbance of the supernatant at 517nm. Use PBS instead of bacterial suspension as the blank control group, and use PBS instead of DPPH solution as the reaction liquid group without DPPH. The absorbance (A2) is measured at 517nm for the calculation of DPPH scavenging rate.

[0058] The calculation formula of DPPH clearance rate was: DPPH clearance rate (%) = [(A0–A1+A2) / A0]×100.

[0059] Wherein: A0 is the absorbance value of the blank control group; A1 is the absorbance value of the sample group; A2 is the absorbance value of the reaction solution without DPPH.

[0060] The results showed that Lactococcus lactis M6 had excellent antioxidant properties, and the free radical DPPH scavenging rate was 77.94±3.17% ( Figure 5 ).

[0061] Example 5: Detection of antibacterial ability of Lactococcus lactis M6

[0062] The antibacterial activity was determined by the Oxford cup method, and the diameter of the inhibition zone was used to express the antibacterial ability of the strain.

[0063] 1. Inoculate Lactococcus lactis M6 into MRS broth medium, culture at 37°C and 150 r / min on a shaker for 24 h, and take the Lactococcus lactis M6 culture liquid (viable cell count is 1×10 8 CFU / mL) and centrifuged to obtain the supernatant for later use.

[0064] 2. Inoculate Staphylococcus aureus BNCC186335, Escherichia coli BNCC133264, and Listeria monocytogenes BNCC185986 into nutrient broth medium, respectively, and culture at 37°C and 150 r / min on a shaker for 24 h to obtain seed solution for use. Sterilize nutrient agar at 121°C for 30 min, and when cooled to about 55°C, add the above pathogenic bacteria seed solution at a 0.1% v / v addition amount to make the pathogenic bacteria inoculation concentration be (1-2)×10 5 CFU / mL, pour into plates and wait for cooling and solidification before use.

[0065] 3. Place 3 to 4 sterile Oxford cups evenly on the plate obtained in step 2, add 200 μL of the supernatant obtained in step 1 to each Oxford cup, culture at 37°C for 24 h, measure the diameter of the inhibition zone, and repeat three times for each treatment.

[0066] The antibacterial substances produced by probiotics play an important role in regulating intestinal flora, and their antibacterial activity has great potential in food preservation and antiseptic treatment. The results are shown in Table 1. It can be seen that Lactococcus lactis M6 has a good inhibitory ability against three common intestinal pathogens. And the effect is better than the control strain Lactobacillus rhamnosus LGG.

[0067] Table 1 Inhibitory ability of Lactococcus lactis M6 against three pathogenic bacteria

[0068]

[0069] Example 6: Detection of acid and bile resistance of Lactococcus lactis M6

[0070] The pH of the MRS liquid medium was adjusted to 2, 2.5 and 3 respectively with hydrochloric acid. The Lactococcus lactis M6 activated twice was added at 1×10 8 The inoculum of CFU / mL was inoculated into culture medium with different pH values, and cultured at 37°C. After 3h of culture, the fermentation broth was diluted to a suitable gradient and inoculated into MRS solid culture medium. After 24h of culture at 37°C, the viable bacteria were counted. The control group was the number of viable bacteria after 0h of acid treatment. The survival rate of lactic acid bacteria was calculated using the following formula:

[0071] Survival rate (%) = number of live bacteria at 3h / number of live bacteria at 0h × 100%.

[0072] Different concentrations of bile salt solutions (0, 0.15%, 0.3%) (w / v) were prepared, and Lactococcus lactis M6 activated twice was incubated at 1×10 8 The inoculum of CFU / mL was inoculated in MRS liquid culture medium containing different concentrations of bile salts (0, 0.15%, 0.3%) and cultured at 37°C. After 12 hours of culture, the fermentation broth was diluted to a suitable gradient and inoculated into MRS solid culture medium. After culturing at 37°C for 24 hours, the live bacteria were counted. The control group was the live bacteria count with a bile salt concentration of 0%, and the survival rate of lactic acid bacteria was calculated.

[0073] In the human digestive system, the pH value of the stomach is usually between 1.5 and 3.5, so the conditions of pH 2, pH 2.5 and pH 3 are very suitable for simulating the gastric acid environment. The survival of Lactococcus lactis M6 in these acidic environments shows that the strain has strong acid resistance. Figure 6 As shown in the figure, under pH 2, the survival rate was 89.76±4.51%. Despite the strong acidity, the strain was still able to survive and showed good acid resistance. In particular, under pH 2.5 and pH 3, the survival rates of the strain reached 99.43±4.87% and 105.66±3.62%, respectively, and even showed a survival rate exceeding the initial value at pH 3. Therefore, Lactococcus lactis M6 can better pass through the gastric acid environment and enter the intestine, showing its potential probiotic properties.

[0074] Bile salts are important components of digestive juices in the intestines, and their concentrations are approximately between 0.1% and 0.3%. Choosing 0%, 0.15%, and 0.3% bile salt concentrations for tolerance testing is consistent with the actual intestinal environment of the human body. Figure 7As shown in the figure, Lactococcus lactis M6 showed a survival rate of 115.97±3.67% under 0% bile salt conditions, indicating that the strain can grow normally in the absence of bile salts. As the bile salt concentration increased, the survival rate of the strain decreased, but at bile salt concentrations of 0.15% and 0.3%, the survival rate remained at a high level of 89.94±3.21% and 86.44±4.03%, respectively, indicating that the strain has a strong bile salt tolerance and can adapt to the bile acid environment in the intestine. Therefore, Lactococcus lactis M6 can grow stably in the intestine and exert its probiotic effect.

[0075] Example 7: Detection of the ability of Lactococcus lactis M6 to resist in vitro digestion

[0076] (1) Preparation of artificial saliva: Referring to the formula shown in Table 2, prepare 20 mL of oral electrolyte solution, and adjust the pH value to 7, then add 2000 U / mL α-amylase, wait for it to dissolve evenly, sterilize the microporous filter membrane, and set aside. (2) Preparation of artificial gastric juice: Referring to the formula shown in Table 2, prepare 40 mL of gastric electrolyte solution, and adjust the pH value to 3, then add 2000 U / mL pepsin and 60 U / mL lipase, wait for it to dissolve evenly, sterilize the microporous filter membrane, and set aside. (3) Preparation of artificial intestinal juice: Referring to the formula shown in Table 2, prepare 80 mL of intestinal electrolyte solution, and adjust the pH value to 7, then add 100 U / mL pancreatic enzyme and 0.3 mg / mL bile salt, wait for it to dissolve evenly, sterilize the microporous filter membrane, and set aside.

[0077] After Lactococcus lactis M6 was activated twice, the resulting bacterial solution (viable cell count of 1×10 8 CFU / mL) was mixed with artificial saliva at a volume ratio of 1:1, placed at 37°C for 2 minutes, and then the mixture was mixed with artificial gastric juice at a volume ratio of 1:1, and placed in an oscillating incubator at 37°C and a rotation speed of 120-150r / min for 2 hours to simulate gastric digestion. Subsequently, the digested mixture was mixed with artificial intestinal juice at a volume ratio of 1:1, and placed at 37°C for 2 hours to simulate intestinal digestion. The survival rate of lactic acid bacteria was calculated by measuring the number of live bacteria before and after simulated digestion. The results showed that ( Figure 8), after in vitro simulated digestion, the number of live bacteria of Lactococcus lactis M6 dropped from 8.11 log CFU / mL to 7.477 log CFU / mL, which is 92.19% of the number before digestion, indicating that the strain can still maintain a high activity during the simulated digestion process. The simulated digestion process simulates the effects of the human oral cavity and gastrointestinal tract, which usually has a certain inhibitory effect on probiotics, so it can maintain a ratio close to the original number of live bacteria, indicating that Lactococcus lactis M6 has good digestion resistance and can survive and enter the intestine in an in vitro simulated digestion environment. This result further supports the application potential of this strain as a probiotic in the human digestive tract, especially the ability to maintain a certain activity under the harsh conditions of the digestive system, laying the foundation for its probiotic effect.

[0078] Table 2 Electrolyte solution formula composition

[0079]

[0080] Example 8: Detection of surface hydrophobicity and self-aggregation ability of Lactococcus lactis M6

[0081] (1) Determination of cell surface hydrophobicity

[0082] Lactococcus lactis M6 was activated twice, and then cultured to form a bacterial solution. The bacterial solution was then divided into 50 mL centrifuge tubes and centrifuged, washed with PBS 2-3 times, and the OD was adjusted. 600 is 0.5±002, recorded as A0; add 3mL of xylene to the same volume of bacterial suspension and vortex mix for 1min; incubate at 37℃ for 5h; take the aqueous phase after the two phases are separated, measure its absorbance at 600nm and record it as A2; repeat three independent experiments.

[0083] The calculation formula for hydrophobicity is: Hydrophobicity (%) = (A0-A2) / A0×100%.

[0084] The affinity of bacteria for organic reagents is commonly used to measure the cell surface properties of lactic acid bacteria, and it can also preliminarily evaluate the ability of bacteria to bind to host epithelial cells. This study evaluated the hydrophobicity of lactic acid bacteria to the organic solvent xylene. Fig. 9 It can be seen that the hydrophobicity of Lactococcus lactis M6 to xylene is 50.455±3.68%. Under the same conditions, the hydrophobicity of the Lactobacillus rhamnosus LGG control group is 42.27±2.46%. The results show that Lactococcus lactis M6 has a high ability to adhere to cells.

[0085] (2) Determination of self-aggregation ability

[0086] Adjust the OD of Lactococcus lactis M6 600is 0.5±002, recorded as A0; take 4mL of bacterial suspension and place it at 37℃ for 24h; take the upper liquid and measure the absorbance at 600nm wavelength, recorded as A 24 ; Three independent experiments were performed in duplicate.

[0087] The calculation formula of self-aggregation capacity is: self-aggregation capacity (%) = (A0-A 24 ) / A0×100%.

[0088] The ability to self-aggregate can be used to initially characterize the ability of potential probiotics to adhere to the intestinal epithelium and other cells. Self-aggregation is mainly the ability of bacteria to interact with the body in a non-specific manner, which is an important condition for intestinal colonization. Fig.10 The results showed that the self-aggregation ability of Lactococcus lactis M6 after incubation at 37°C for 24 h was 53.75±2.77%, which was higher than that of Lactobacillus rhamnosus LGG (45.11±1.79%). This strain showed excellent colonization ability in the intestine.

[0089] Example 9: Safety testing of Lactococcus lactis M6

[0090] (1) Hemolysis test: The activated Lactococcus lactis M6 strain was streaked onto Columbia blood agar medium and cultured at 37°C for 24 h. Staphylococcus aureus was used as a positive control strain to observe whether hemolysis occurred.

[0091] Since many bacteria produce some kind of hemolysin that causes blood cells to lyse and die, causing the host to become ill, the safety of bacteria used in food or medicine cannot be guaranteed. Therefore, in order to ensure that lactic acid bacteria can be safely used in the food and pharmaceutical industries, hemolytic testing is a very important part of the in vitro safety assessment of probiotics. Fig.11 As shown, the one in the middle of the plate is Staphylococcus aureus, which exhibits β-hemolysis; the three surrounding points are all Lactococcus lactis M6, which do not exhibit β-hemolysis, indicating that the hemolytic safety of this strain meets the standard.

[0092] (2) Determination of antibiotic tolerance. The antibiotic sensitivity of the strain was determined by the drug sensitivity paper agar diffusion method. The Lactococcus lactis M6 strain was activated twice and cultured overnight for 24 hours and then evenly spread on the MRS plate. Then, 8 drug sensitivity paper discs, including penicillin, erythromycin, kanamycin, tetracycline, chloramphenicol, vancomycin, ciprofloxacin, and metronidazole drug sensitivity test paper discs, were evenly pasted on the surface of the MRS plate. The drug sensitivity paper discs were gently pressed with tweezers to prevent them from falling off. Then, they were placed at 37°C for 24 hours. The diameter of the inhibition zone of each drug sensitivity disc was measured, and the average value was taken after three measurements.

[0093] Table 3 Sensitivity of Lactococcus lactis M6 to 8 antibiotics

[0094]

[0095] Note: d is the diameter of the inhibition zone of the antibiotic sensitive paper to lactic acid bacteria, “-” d≤5mm; “+”: 5mm≤d<15mm; “++”: 15mm≤d<25mm; “+++”: d≥25mm to indicate the sensitivity of antibiotics to lactic acid bacteria.

[0096] In order to ensure that Lactococcus lactis M6 can be safely used in the food and pharmaceutical industries, the safety of the strain was further evaluated from the perspective of antibiotic sensitivity. As shown in Table 3, the bacteria are sensitive to most of the eight antibiotics; especially to erythromycin, tetracycline, chloramphenicol, and penicillin; however, they are less sensitive or resistant to metronidazole, erythromycin, and vancomycin, but this does not indicate a safety hazard; some scholars have shown that probiotics are resistant to specific antimicrobial drugs, which can increase the application of probiotics. They can work together with antibiotics to help restore intestinal flora.

[0097] Comparative Example 1: Production of butyric acid by Lactococcus lactis BNCC195305

[0098] Specific implementation method Referring to Example 3, the difference is that Lactococcus lactis M6 is replaced by Lactococcus lactis BNCC195305, and the butyric acid content in the supernatant after fermentation is detected. The results show that after fermentation of Lactococcus lactis BNCC195305, the butyric acid accumulation is 13.67 mg / mL, which is much lower than the fermentation yield of Lactococcus lactis M6 described in the present invention.

[0099] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A strain of Lactococcus lactis ( Lactococcus lactis ) M6, characterized in that, The Lactococcus lactis M6 has been deposited in the China General Microbiological Culture Collection Center with a deposit number of CGMCC No. 32405 and a deposit date of October 30, 2024.

2. A microbial preparation containing the Lactococcus lactis M6 according to claim 1.

3. The microbial preparation according to claim 2, characterized in that In the microbial preparation, the number of Lactococcus lactis M6 is not less than 1×10 8 CFU / mL or 1×10 8 CFU / g.

4. A product containing the Lactococcus lactis M6 according to claim 1 or the microbial preparation according to claim 2 or 3.

5. The product according to claim 4, characterized in that The product includes a food or a medicine.

6. The product according to claim 5, characterized in that The food includes health food.

7. A method for producing GABA and / or butyric acid, characterized in that: The Lactococcus lactis M6 according to claim 1 is fermented.

8. Use of the Lactococcus lactis M6 according to claim 1 or the microbial preparation according to claim 2 or 3 in the production of GABA and / or butyric acid.

9. Use of the Lactococcus lactis M6 according to claim 1 or the microbial preparation according to claim 2 or 3 in the preparation of an antioxidant.

10. Use of the Lactococcus lactis M6 according to claim 1 or the microbial preparation according to claim 2 or 3 in the preparation of an antibacterial agent, characterized in that: The antibacterial agent is used for inhibiting Staphylococcus aureus, Escherichia coli and / or Listeria monocytogenes.

Images