A method for extracting phage nucleic acid based on a centrifugal column method
By optimizing the phage nucleic acid extraction process using centrifugation column method and urea to replace proteinase K, the high cost of reagent kits in phage research was solved, achieving efficient and low-cost phage genome extraction.
Patent Information
- Application Number
- CN202411773629.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-05
- Publication Date
- 2025-11-28
- Estimated Expiration
- 2044-12-05
AI Technical Summary
Existing methods for extracting phage nucleic acids rely on expensive and high-loss commercial kits, resulting in high costs and making them unsuitable for widespread application in phage research.
A column-based method was adopted, using 8 mol/L urea as the protein denaturation and lysis buffer instead of proteinase K. Combined with the manual preparation of denaturing buffer, washing buffer and nucleic acid elution buffer, the extraction steps were optimized to achieve efficient extraction of bacteriophage nucleic acid.
This method reduces the economic cost of phage nucleic acid extraction, shortens the extraction time, increases the number of extractions, and enables rapid purification of phage genomic nucleic acids, making it suitable for routine molecular biology experiments.
Smart Images

Figure CN119639734B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of molecular biology, and relates to a bacteriophage nucleic acid extraction technology, in particular to a centrifugal column method-based bacteriophage nucleic acid extraction method. BACKGROUND
[0002] Bacteriophage is a kind of virus that can specifically infect bacteria, fungi, actinomycetes and other microorganisms, and is a biological entity composed of a layer of protein or lipid protein composed of an internal nucleic acid composed of a shell, widely distributed in soil, water, air or plants and animals, etc. Various environments, its bactericidal mechanism to bacteria is mainly mediated by host strain cell lysis of lytic bacteriophage, after adsorption and infection, lytic bacteriophage can use the host bacteria biosynthesis mechanism, finally make the host bacteria cell lysis and death and release the progeny bacteriophage, it was successfully applied to the treatment of bacterial infection in humans and animals in the early 1920s, but the large-scale application of antibiotics slowed down the development of bacteriophage therapy. Bacteriophage has high and strict host specificity, and almost does not affect human or animal cells while mediating the rapid lysis and death of host bacteria, showing high biological safety, at the same time, as an important member of the micro-ecological environment, it is involved in various aspects of maintaining the stability of the micro-ecosystem, and faces the difficulties of antibiotic resistance spread, and the application of bacteriophage and its derivatives as a potential alternative therapy for antibiotics has again attracted widespread attention from researchers.
[0003] In order to clarify the mechanism behind the bacteriophage biology characteristics, and guide the development of new therapies and antibacterial drugs, the extraction of bacteriophage genomic nucleic acid sequence is essential in many studies. Bacteriophage genome information can reveal its internal mechanisms such as infection mechanism, gene function, drug resistance, host specificity, etc. Before carrying out modification, synthesis of new artificial bacteriophages or biological component delivery research using bacteriophage vectors based on genetic engineering and synthetic biology strategies, the genomic information of bacteriophage must be understood in detail. Due to the similarity between bacteriophage and eukaryotic viruses, the conventional bacteriophage nucleic acid sequence extraction method mainly relies on commercial viral extraction kits. The most critical step in these kits is to use protease K (such as DNA Viral Genome Extraction Kit; Solarbio, D2400) or OBProtease Solution (such as E.Z.N.A. Viral DNA Kit; Omega, D3892) to lyse bacteriophage coat proteins, expose internal nucleic acids, and use silica-based nucleic acid adsorption columns to adsorb nucleic acids, then rinse multiple times to achieve the purpose of purifying and recovering bacteriophage nucleic acids. The initial purpose of developing these kits is to extract eukaryotic viral genomes. Although there is some similarity between the enrichment and purification of eukaryotic viruses and bacteriophage research, the operation of bacteriophage enrichment and purification is much simpler than that of eukaryotic viruses. The standard steps provided in commercial kits can be reasonably simplified when applied to bacteriophage nucleic acid extraction. In addition, the commonly used protease K and OB Protease Solution have a high loss rate and are relatively expensive, which is not conducive to their widespread application in bacteriophage research to some extent.
[0004] Currently, there is no patent scheme for bacteriophage nucleic acid extraction and few commercial schemes. Therefore, it is particularly important to develop a simple, efficient and low-cost bacteriophage nucleic acid extraction method for bacteriophage and its derivatives research. SUMMARY
[0005] The purpose of the present application is to provide a method for extracting bacteriophage nucleic acid based on centrifugal column method, which overcomes the problem of high loss rate and high price of current bacteriophage extraction kits.
[0006] The present application is realized by the following technical scheme: a method for extracting bacteriophage nucleic acid based on centrifugal column method, characterized in that the method comprises the following steps:
[0007] (1) Take 1 mL of bacteriophage enrichment solution, mix it with an equal volume of denaturing lysis solution, invert and mix well, and stand at room temperature for 3 min;
[0008] (2) Take 1.6 mL denaturation buffer, mix with the solution of the previous step, gently turn up and down for 6-10 times, place at room temperature for 5 min, then centrifuge at 13000 r / min for 10 min at 4℃, and carefully take the supernatant;
[0009] (3) Put the supernatant of the previous step into a nucleic acid adsorption column, stand for 2 min, then centrifuge at 12000 r / min for 2 min at 4℃, discard the waste liquid, and if the liquid is more, it can be added in several times;
[0010] (4) Add 600 μL rinse solution to the adsorption column, centrifuge at 12000 r / min for 1 min at 4℃, and discard the waste liquid;
[0011] (5) Repeat step (4) once;
[0012] (6) Centrifuge the adsorption column at 12000 r / min at 4℃ for 2 min, open the cover, and place at room temperature for 5 min to remove the residual rinse solution;
[0013] (7) Put the adsorption column into a clean centrifuge tube, add 50 μL sterilized deionized water to the center of the adsorption membrane, place at room temperature for 5 min, and centrifuge at 12000 r / min for 1 min at 4℃;
[0014] (8) The eluate obtained by centrifugation is again put into a new adsorption column, stand at room temperature for 2 min, centrifuge at 12000 r / min for 2 min at 4℃, and the phage genomic DNA can be obtained.
[0015] 2. The method for extracting phage nucleic acid based on the centrifugal column method according to claim 1, wherein the preparation of the phage enrichment solution in step (1) is as follows: 5 mL of host bacteria-phage overnight culture is centrifuged at 5000 r / min for 15 min at 4℃, and the supernatant is filtered through a 0.22 μm filter membrane to obtain the phage enrichment solution.
[0016] 3. The method for extracting phage nucleic acid based on the centrifugal column method according to claim 1, wherein the preparation of the denaturation lysis solution in step (1) is as follows: Tris 30-50 mmol / L, NaCl 500 mmol / L, and urea 6-8 mol / L are fully dissolved in 1000 mL of deionized water, and hydrochloric acid is used to adjust the pH to 7.5 to obtain the denaturation lysis solution.
[0017] 4. The method for extracting phage nucleic acid based on the centrifugal column method according to claim 1, wherein the preparation of the denaturation buffer in step (2) is as follows: potassium acetate 3 mol / L and acetic acid 5 mol / L are added to 1000 mL of deionized water to obtain the denaturation buffer.
[0018] 5. The method for extracting bacteriophage nucleic acid based on a centrifugal column according to claim 1, wherein the rinse solution in step (4) is prepared by dissolving 10 mmol / L Tris in 200 mL deionized water, adjusting the pH to 7.5 with hydrochloric acid, and adding 800 mL anhydrous ethanol before use.
[0019] The positive effects of the above technical solution are:
[0020] (1) The protease K or OB Protease Solution in the commercial virus nucleic acid extraction kit is replaced by a protein denaturation lysis solution containing 8 mol / L urea and stable at room temperature, which can effectively hydrolyze the bacteriophage protein coat and release the internal nucleic acid for adsorption and recovery, effectively reducing the economic cost in the process of bacteriophage nucleic acid extraction.
[0021] (2) All reagents used in the present application can be manually prepared, and based on the commercial virus nucleic acid extraction kit, the extraction steps are further optimized, and the bacteriophage genomic nucleic acid for further experimental analysis can be obtained within 8 steps, and the nucleic acid extraction can be completed within 45 minutes, which has the advantages of short time and high efficiency.
[0022] (3) The present application creatively proposes a standardized process for extracting bacteriophage nucleic acid, which fills the research gap in the related field and lays a foundation for bacteriophage related research. BRIEF DESCRIPTION OF DRAWINGS
[0023] Figure 1 The picture is a plaque picture of the T7 bacteriophage standard strain.
[0024] Figure 2 The picture is a plaque picture of the T4-like bacteriophage P9.
[0025] Figure 3 The picture is a plaque picture of the T7-like bacteriophage Q5.
[0026] Figure 4 The picture is a plaque picture of the N4-like bacteriophage PWJ.
[0027] Figure 5 The picture is an evolutionary tree based on the large subunit sequence of the terminator enzyme.
[0028] Figure 6 The picture is a gel electrophoresis map of PCR verification based on the large subunit sequence of the terminator enzyme primer after extracting bacteriophage nucleic acid using the present method, wherein Marker, T7 standard strain, bacteriophage P9, bacteriophage Q5, and bacteriophage PWJ. DETAILED DESCRIPTION
[0029] The technical solutions of the present application will be further described below in combination with specific examples and comparative examples, but should not be understood as limitations to the present application. Examples
[0030] This example will specifically show the specific operation process and steps of purifying and enriching the phages before extracting the phage nucleic acid.
[0031] Strains, reagents and media involved in the examples:
[0032] The phages used in the experiments were T7 phage standard strain (purchased from Beina Biological Technology Co., Ltd., item number: BNCC358500; Genbank accession number: NC_001604.1), T4-like phage P9 (preserved in the laboratory; Genbank accession number: MT630408.1), T7-like phage Q5 (preserved in the laboratory; Genbank accession number: MZ833439.1) and N4-like phage PWJ (preserved in the laboratory; Genbank accession number: OR237807.1). The phage plaque morphology is shown in Figure 1 to Figure 4 .
[0033] The strains used in the experiments were Escherichia coli BL21 (DE3) (T7 phage standard strain host bacteria, purchased from Shengong Bioengineering (Shanghai) Co., Ltd., item number: B528414), Escherichia coli C600 (phage P9, Q5 host bacteria, preserved in the laboratory) and Pseudomonas aeruginosa ATCC27853 (phage PWJ host bacteria, preserved in the laboratory).
[0034] LB nutrient agar medium (1 L): weigh 40 g of LB agar medium, dissolve in 1 L of deionized water, sterilize at 121℃ for 20 min and prepare for use.
[0035] LB broth medium (1 L): weigh 21 g of LB broth medium, dissolve in 1 L of deionized water, sterilize at 121℃ for 20 min and prepare for use.
[0036] 0.7% semi-solid medium (1 L): weigh 21 g of LB broth medium and 7.0 g of agar powder, dissolve in 1 L of deionized water, sterilize at 121℃ for 20 min and prepare for use.
[0037] Phage recovery and enrichment:
[0038] Take out the phage preservation solution frozen at -20℃, recover to room temperature, and then take 100 μL and mix with 100 μL of the logarithmic growth phase culture of the host bacteria in 5 mL of LB broth medium. Incubate at 37℃ and 150 r / min for 18 h. After the incubation, centrifuge the culture at 4℃ and 5000 r / min for 15 min. Take the supernatant and pass it through a 0.22 μm filter. The obtained filtrate is the phage enrichment solution.
[0039] Gradient dilute the phage enrichment solution to an appropriate multiple (in this experiment, the dilution multiple is selected to be 10 -8 ). Use the double-layer plate method to purify the phage. Take 100 μL of the diluted phage suspension and mix with 100 μL of the corresponding host bacteria liquid in 5 mL of semi-solid medium. Uniformly spread on the previously prepared LB nutrient agar medium plate and incubate at 37℃ for 6-12 h. During the incubation, observe intermittently. After observing the appearance of single transparent and uniform phage plaques, stop the incubation and pick the single phage plaque. Mix with 100 μL of the logarithmic growth phase culture of the corresponding host bacteria in 5 mL of LB broth medium. Incubate at 37℃ and 150 r / min for 18 h. After the incubation, centrifuge the culture at 4℃ and 5000 r / min for 15 min. Take the supernatant and pass it through a 0.22 μm filter. The obtained filtrate is the phage purification enrichment solution.
[0040] Take 100 μL of the phage purification enrichment solution, gradient dilute to an appropriate multiple, and use the double-layer plate method again to count the phage plaques to convert the titer. In this study, it is calculated that the titer of the T7 phage standard strain used is 3.16×10 13 cfu / mL, the titer of the phage P9 is 1.79×10 13 cfu / mL, the titer of the phage Q5 is 4.5×10 13 cfu / mL, and the titer of the phage PWJ is 6.6×10 11 cfu / mL.
[0041] The remaining phage purification enrichment solution can be used for nucleic acid extraction operation. Example
[0042] This example will specifically show the preparation method of the denaturation lysis solution, denaturation buffer, and rinsing solution, as well as the detailed operation steps of phage nucleic acid extraction using the present technology.
[0043] Prepare the denaturation lysis solution: dissolve Tris 30-50 mmol / L, NaCl 500 mmol / L, and urea 6-8 mol / L in 1000 mL of deionized water. Adjust the pH to 7.5 using hydrochloric acid to obtain the solution.
[0044] Denaturation buffer: Potassium acetate 3 mol / L, acetic acid 5 mol / L, add deionized water to 1000 mL.
[0045] Rinse buffer: Tris 10 mmol / L, dissolve in 200 mL deionized water, adjust pH to 7.5 with hydrochloric acid, add 800 mL anhydrous ethanol before use.
[0046] Use sterilized deionized water as nucleic acid eluent.
[0047] Nucleic acid extraction process:
[0048] I. Take 1 mL of pre-stored or freshly prepared phage purification enrichment solution, mix with an equal volume of denaturation lysis solution, invert and mix well, and stand at room temperature for 3 min.
[0049] II. Take 1.6 mL of denaturation buffer, mix with the solution obtained in the previous step, and gently invert 6-10 times, stand at room temperature for 5 min, centrifuge at 4°C, 13000 r / min for 10 min, and carefully take the supernatant.
[0050] III. Place the supernatant from the previous step into a nucleic acid adsorption column (purchased from Hangzhou Beiwu Medical Technology Co., Ltd., or similar silica-based nucleic acid adsorption column), stand for 2 min, centrifuge at 4°C, 12000 r / min for 2 min, discard the waste liquid, and if the liquid is too much, add it in batches.
[0051] IV. Add 600 μL of rinse buffer (check if anhydrous ethanol has been added before use) to the adsorption column, centrifuge at 4°C, 12000 r / min for 1 min, and discard the waste liquid.
[0052] V. Repeat step IV once.
[0053] VI. Centrifuge the adsorption column at 4°C, 12000 r / min for 2 min, open the lid, and stand at room temperature for 5 min to remove the residual rinse buffer.
[0054] VII. Place the adsorption column back into a sterile 1.5 mL centrifuge tube, and add 50 μL of sterilized deionized water to the center of the adsorption membrane, stand at room temperature for 5 min, and centrifuge at 4°C, 12000 r / min for 1 min.
[0055] VIII. Place the eluent obtained by centrifugation into a new adsorption column, and place the new adsorption column into another sterile 1.5 mL centrifuge tube, stand at room temperature for 2 min, and centrifuge at 4°C, 12000 r / min to obtain phage genomic DNA, which can be stored at -20°C for long-term preservation.
[0056] The nucleic acid concentrations of the four phage nucleic acids extracted in Example 1 were detected using a micro-UV spectrophotometer. The obtained T7 phage standard nucleic acid concentration was 23.6 ng / μL, the phage P9 nucleic acid concentration was 19.6 ng / μL, the phage Q5 nucleic acid concentration was 21.6 ng / μL, and the phage PWJ nucleic acid concentration was 24.3 ng / μL, which met the nucleic acid concentration required for PCR or conventional molecular biology experiments. Example
[0057] This example will specifically demonstrate the practical application of the nucleic acid extraction product after applying the present technology in PCR.
[0058] The T7 phage standard strain (Genbank accession number: NC_001604.1), T4-like phage P9 (Genbank accession number: MT630408.1), T7-like phage Q5 (Genbank accession number: MZ833439.1), and N4-like phage PWJ (Genbank accession number: OR237807.1) have known whole genome information after Illumina sequencing. The sequence of the large subunit of the termination enzyme was extracted and BLASTed with the Genbank database, and an evolutionary tree based on the large subunit of the termination enzyme was drawn. Figure 5 ).
[0059] According to the sequence information of the large subunit of the termination enzyme, four detection primers were designed and synthesized (Shanghai Genechem Co., Ltd.), and the nucleic acid extracted in Example 2 was used as a template for PCR detection.
[0060] The upstream primer T7_F for T7 standard strain detection was ATGTGCGTTCGTTGTGTGG (SEQ ID No. 1), and the downstream primer T7_R was AGGAGAGTGGTCAGGATTGG (SEQ ID No. 2). The PCR amplification program was: 95°C pre-denaturation for 3 min, 94°C denaturation for 25 s, 56°C annealing for 25 s, 72°C extension for 15 s, 35 cycles, 72°C extension for 5 min, and the target fragment size was 211 bp.
[0061] The upstream primer P9_F for phage P9 detection was CAGCCTGGTATAGTTGAATGG (SEQ ID No. 3), and the downstream primer P9_R was CAGGAATCGTGGAAGTTTGG (SEQ ID No. 4). The PCR amplification program was: 95°C pre-denaturation for 3 min, 94°C denaturation for 25 s, 56°C annealing for 25 s, 72°C extension for 15 s, 35 cycles, 72°C extension for 5 min, and the target fragment size was 158 bp.
[0062] Upstream primer Q5_F for phage Q5 detection: GTTTCCGTGATGGCTACTCC (SEQ ID No. 5), downstream primer Q5_R: CAAATACGCATCTCCTTCATACC (SEQ ID No. 6), PCR amplification procedure: 95°C pre-denaturation for 3 min, 94°C denaturation for 25 s, 56°C annealing for 25 s, 72°C extension for 15 s, 35 cycles, 72°C extension for 5 min, target fragment size 199 bp.
[0063] Upstream primer PWJ_F for phage PWJ detection: GAAAGCTGTCGCAGATGAGG (SEQ ID No. 7), downstream primer PWJ_R: ATGCGTAGGTGAAGGACTGG (SEQ ID No. 8), PCR amplification procedure: 95°C pre-denaturation for 3 min, 94°C denaturation for 25 s, 56°C annealing for 25 s, 72°C extension for 15 s, 35 cycles, 72°C extension for 5 min, target fragment size 201 bp.
[0064] PCR amplification system (20 μL): template 1 μL, 2X M5 HiPer plus Taq HiFi PCR mix 10 μL, upstream primer 0.5 μL, downstream primer 0.5 μL, ddH2O 8 μL, PCR product was detected by 1.7% agarose gel electrophoresis at 211 bp, 158 bp, 199 bp and 201 bp, and the PCR results are shown in Figure 6
[0065] This example illustrates the Solarbio centrifugal column method virus nucleic acid extraction kit.
[0066] According to the nucleic acid extraction process in the specification as follows:
[0067] I. Take 0.5 mL of virus supernatant, centrifuge at 12000 rpm for 5 min, and try to aspirate the supernatant, discard the precipitate.
[0068] II. Add 20 μL of proteinase K to the virus supernatant, mix well, digest at 65°C for 10-20 min, and mix well several times during the period.
[0069] III. Add 500 μL of Solution V into the tube and mix well. Add 400 μL of absolute ethanol into the tube and mix well. At this time, there may be flocculent precipitate, which does not affect the extraction of DNA. Both the solution and the flocculent precipitate can be added into the adsorption column and stand for 2 min. (The maximum volume of the adsorption column is 750 μL, which can be added in two times. After the adsorption in the first time, the remaining solution can be added into the column, stand and centrifuge.)
[0070] IV. Centrifuge at 12000 rpm for 2 min, discard the waste liquid, and place the adsorption column into the collection tube.
[0071] V. Add 600 μL of rinsing solution (check whether absolute ethanol has been added before use) into the adsorption column, centrifuge at 12000 rpm for 1 min, discard the waste liquid, and place the adsorption column into the collection tube.
[0072] VI. Add 600 μL of rinsing solution into the adsorption column, centrifuge at 12000 rpm for 1 min, discard the waste liquid, and place the adsorption column into the collection tube.
[0073] VII. Centrifuge at 12000 rpm for 2 min, and place the adsorption column into a room temperature or 50℃ incubator for several minutes. The purpose is to remove the residual rinsing solution in the adsorption column. Otherwise, the ethanol in the rinsing solution will affect the subsequent experiments such as enzyme digestion and PCR.
[0074] VIII. Place the adsorption column into a clean centrifuge tube, and add 50 μL-100 μL of elution solution preheated at 65℃ dropwise to the center of the adsorption membrane. Stand at room temperature for 5 min, and centrifuge at 12000 rpm for 1 min.
[0075] IX. Add the elution solution obtained by centrifugation into the adsorption column, stand at room temperature for 2 min, and centrifuge at 12000 rpm for 2 min, to obtain high-quality viral genomic DNA.
[0076] The viral nucleic acid extraction reagent kit of Solarbio centrifugal column method uses proteinase K for nucleic acid extraction. In order to achieve the optimal enzymatic reaction condition, it is necessary to incubate at 65℃ for 10 min, and then add a buffer solution containing EDTA and SDS to precipitate the protein. The supernatant is then centrifuged for extraction. The present method uses a lysis buffer, which does not need to be heated and can be reacted at room temperature. The reaction time is shortened to 5 min. No buffer solution for precipitating protein is needed. The supernatant can be directly centrifuged for the next step, which is simple and easy to operate.
[0077] This example illustrates the viral nucleic acid extraction reagent kit of Omega centrifugal column method.
[0078] The nucleic acid extraction process according to the specification is as follows:
[0079] 1. Transfer the sample to a 2 mL centrifuge tube. If the volume is less than 250 μL, add 10 mM Tris-HCl or PBS buffer to make up the volume to 250 μL.
[0080] 2. Add 10 μL OB Protease Solution, 4 μL Linear Acrylamide and 250 μL BL Buffer, and vortex at high speed for 15 s to mix.
[0081] 3. Incubate in a water bath at 65°C for 10 minutes, gently vortexing once during the process.
[0082] 4. Add 260 μL of anhydrous ethanol, vortex for 20 seconds to mix thoroughly, and then briefly centrifuge to collect the droplets from the tube cap.
[0083] V. HiBind ® Insert DNA Mini Columns into the collection tube, transfer the mixture obtained in step 4 into the binding column, centrifuge at 8000 xg for 1 min at room temperature, and discard the filtrate and collection tube.
[0084] 6. Insert the HiBind® DNA Mini Columns into a new collection tube, add 500 μL of HBC Buffer (diluted with isopropanol) to the binding column, centrifuge at 8000 xg for 1 min, and discard the filtrate.
[0085] 7. Replace the HiBind® DNA Mini Columns back into the collection tube, add 700 μL of DNA Wash Buffer (diluted with anhydrous ethanol) to the binding column, centrifuge at 8000 xg for 1 min, and discard the filtrate.
[0086] 8. Repeat step 7.
[0087] 9. Put the HiBind® DNA Mini Columns back into the collection tube and centrifuge at 12000 xg for 2 min.
[0088] 10. Insert the HiBind® DNA Mini Columns into a new 1.5 mL centrifuge tube, add 50~100 μL of preheated 65℃ Elution Buffer to the binding column, incubate at room temperature for 5 min, and then centrifuge at 8000 xg for 1 min to elute the DNA.
[0089] 11. Repeat step 10 for a second elution, and store the product at -20℃.
[0090] The operation of the virus nucleic acid extraction kit based on the Omega centrifugal column method is complicated, and the steps are many, so it is not convenient for popularization and application.
[0091] According to the corresponding description, the phage nucleic acid extraction is carried out according to the scheme in Example 2, Comparative Example 1 and Comparative Example 2, and specific performance values are shown in Table 1:
[0092] Table 1 Comparison of phage nucleic acid extraction performance
[0093] Extraction method Storage method Required steps Required time Extraction times Cost price Remarks Example 2 All reagents can be stored at room temperature for a long time 8 steps 30~45 min 180 times 80~90 yuan None Control Example 1 Proteinase K needs to be stored at -20℃ for a long time, and the rest of the reagents can be stored at room temperature 9 steps 40~50 min 50 times 200~300 yuan None Control Example 2 OB Protease Solution needs to be stored at 4℃ for a long time, and the rest of the reagents can be stored at room temperature 11 steps 40~60 min 50 times 550~650 yuan Additional isopropyl alcohol needs to be added
[0094] Compared with Comparative Example 1 and Comparative Example 2, the present application uses urea instead of proteinase K, greatly reduces the price of consumables used for preparing reagents, and the cost of preparing 200 mL at a time is about 80 yuan, which is much lower than the cost of existing reagent kits, and the existing reagent kits can be used for about 50 times, while the reagent kit of the present application can extract about 180 times if 200 mL of lysis solution is prepared, the number of extraction times is increased, the cost is more economical, and it is convenient to use. The reagents used can be manually prepared and stored at room temperature for a long time, without the need to add other reagents, the extraction time is shorter, the nucleic acid extraction can be completed within 45 minutes, the number of extraction times is 3.6 times that of the reagent kit method, and it has the absolute advantages of short time and high efficiency.
[0095] In summary, the present application provides a phage nucleic acid extraction method based on the centrifugal column method, and is applied in PCR experiments, which saves the experimental cost on the basis of the commercial virus nucleic acid extraction kit, and can quickly extract phage nucleic acid for application in conventional molecular biology experiments.
Claims
1. A method for extracting phage nucleic acid based on centrifugation column method, characterized in that: The method includes the following steps: (1) Take 1 mL of phage enrichment solution and mix it with an equal volume of denaturing lysis buffer by inverting. Let it stand at room temperature for 3 min. Preparation of the phage enrichment solution: Centrifuge 5 mL of host bacteria-phage overnight culture at 4℃, 5000 r / min for 15 min, and filter the supernatant through a 0.22 μm filter membrane. Preparation of the denaturing lysis buffer: Dissolve Tris 30-50 mmol / L, NaCl 500 mmol / L, and urea 6-8 mol / L in 1000 mL of deionized water and adjust the pH to 7.5 with hydrochloric acid. (2) Take 1.6 mL of denaturing buffer, mix it with the solution from the previous step, gently invert it 6 to 10 times, let it stand at room temperature for 5 min, then centrifuge at 13000 r / min for 10 min at 4℃, and carefully take the supernatant; The denaturing buffer is prepared as follows: potassium acetate 3 mol / L, acetic acid 5 mol / L, and deionized water is added to 1000 mL. (3) Place the supernatant from the previous step into the nucleic acid adsorption column, let it stand for 2 min, then centrifuge at 12000 r / min for 2 min at 4℃, discard the waste liquid, and add it in batches if there is a lot of liquid. (4) Add 600 μL of washing solution to the adsorption column, centrifuge at 12000 r / min for 1 min at 4℃, and discard the waste liquid; The washing solution is prepared as follows: Tris 10 mmol / L, fully dissolved in 200 mL of deionized water, pH adjusted to 7.5 with hydrochloric acid, and 800 mL of anhydrous ethanol added before use. (5) Repeat step (4) once; (6) Centrifuge the adsorption column at 4℃ and 12000 r / min for 2 min, open the cap and let it stand at room temperature for 5 min to remove the rinsing solution residue. (7) Place the adsorption column into a clean centrifuge tube, add 50 μL of sterile deionized water to the center of the adsorption membrane, place at room temperature for 5 min, and centrifuge at 12000 r / min for 1 min at 4℃. (8) The elution obtained by centrifugation is placed in a new adsorption column, placed at room temperature for 2 min, and centrifuged at 12000 r / min for 2 min at 4℃ to obtain phage genomic DNA.
Citation Information
Patent Citations
Novel method for extracting phage genome DNA
CN109371011A
Method for bacterial cell lysis and bacteriophage DNA isolation
IN201911031265A