Tobacco polyphenol oxidase gene NtPPO15 and application thereof in inhibiting tobacco browning and improving tobacco resistance to maturity and baking

By regulating the expression of the tobacco polyphenol oxidase gene NtPPO15, the problem of tobacco leaves turning brown during the curing process was solved, thereby improving the curing resistance and maturity of tobacco leaves and enhancing tobacco quality and economic benefits.

CN119639775BActive Publication Date: 2026-06-05TOBACCO RESEARCH INSTITUTE OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES (QINGZHOU TOBACCO RESEARCH INSTITUTE OF CHINA NATIONAL TOBACCO COMPANY) +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411711529.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-27
Publication Date
2026-06-05
Estimated Expiration
2044-11-27

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively regulate the enzymatic browning reaction in tobacco, causing tobacco leaves to easily turn brown during the curing process, affecting the quality and maturity of the tobacco leaves, and there is a lack of application of genetic methods.

Method used

By using the tobacco polyphenol oxidase gene NtPPO15 and its related sequences and promoters, the expression level of the NtPPO15 gene was regulated through gene editing and overexpression to control the browning of tobacco and improve ripening resistance.

Benefits of technology

By regulating the expression of the NtPPO15 gene, tobacco browning was significantly inhibited, the curing resistance and maturity of tobacco leaves were improved, and the quality and economic benefits of tobacco leaves were enhanced.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119639775B_ABST
    Figure CN119639775B_ABST
Patent Text Reader

Abstract

This invention provides a tobacco polyphenol oxidase gene. NtPPO15 This invention relates to the inhibition of tobacco browning and the improvement of tobacco's ripening and roasting resistance, and its application in these areas. Through experimental screening, key genes related to tobacco browning and roasting resistance were identified. NtPPO15 Further investigation was conducted by constructing a GUS staining vector. NtPPO15 This invention investigated promoter activity and gene expression sites, and further explored gene function through gene editing and overexpression. The invention experimentally demonstrates the benefits provided by this invention. NtPPO15 These genes are key genes involved in browning during the ripening and curing process of tobacco, and they regulate... NtPPO15 NtPPO15 The expression level of genes can control the browning of tobacco, improve the ripening and roasting resistance of tobacco, improve the quality of tobacco products, reduce the number of harvests, greatly improve economic benefits, and can also be used to screen tobacco varieties with excellent quality. Therefore, it has good and broad market application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of tobacco gene technology, specifically relating to the tobacco polyphenol oxidase gene. NtPPO15 Its application in inhibiting tobacco browning and improving tobacco's resistance to ripening and baking. Background Technology

[0002] The curing characteristics of tobacco leaves are an inevitable reflection of the differences in fresh tobacco quality. These characteristics can be summarized as "easy to cure" and "resistant to curing." "Easy to cure" mainly reflects the yellowing characteristics of tobacco leaves and the ease with which they are colored after yellowing. Tobacco leaves that yellow more easily and fix their color more easily are considered easy to cure, while those that yellow more easily are considered difficult to cure. "Resistant to curing" mainly refers to the sensitivity or tolerance of tobacco leaves to the curing environment during the color-fixing stage. Tobacco leaves that are not sensitive to the color-fixing environment and do not easily turn brown are considered to have good curing resistance; otherwise, they are considered not resistant to curing. The ease and resistance to curing of tobacco leaves are significantly influenced by genetic factors. Due to different genetic bases, some varieties are very easy to cure, while tobacco leaves with good curing resistance have lower PPO activity, and tobacco leaves with poor curing resistance have higher PPO activity.

[0003] During the curing process, the color of tobacco leaves gradually changes from yellow to brown, and even dark brown. This is because the substances contained within the tobacco leaves are converted into a type of dark-colored substance under the action of oxidases. This complex process is called the enzymatic browning reaction of tobacco. The occurrence of the enzymatic browning reaction of tobacco is closely related to the quality of tobacco. The color-fixing characteristics of tobacco leaves are usually measured by whether they easily turn brown after curing and entering the color-fixing period. The enzymatic browning reaction of tobacco has a series of adverse effects on the quality of tobacco. During this process, the yellow color of the tobacco leaves gradually disappears, and different degrees of discoloration gradually appear. Ashing, steaming, and blackening of tobacco leaves follow one after another. At the same time, it also causes the tobacco leaves to become thinner, lighter, less elastic, more fragile, and less combustible, resulting in a serious decline in the quality of the tobacco leaves.

[0004] At the same time, improving the ripening tolerance of mature tobacco leaves can reduce the number of harvests, promote the integration of agricultural machinery and agronomy, cultivate varieties with relatively concentrated maturity, and solve key difficulties that restrict mechanization.

[0005] Currently, the regulation of enzymatic browning in tobacco is mainly achieved through two aspects: first, regulating the ambient oxygen concentration, which can effectively control the rate of the reaction by controlling the oxygen concentration in the curing chamber; second, regulating the activity of polyphenol oxidase (PPO) in tobacco leaves. The methods for regulating PPO activity in tobacco leaves mainly focus on adjusting the ambient temperature and relative humidity, adjusting the pH value, or using some PPO inhibitors and other physicochemical methods. There are few reports on using genetic methods to reduce the activity of polyphenol oxidase, thereby reducing the occurrence of enzymatic browning. Summary of the Invention

[0006] In view of the above-mentioned situation in the prior art, the purpose of this invention is to provide a tobacco polyphenol oxidase gene. NtPPO15 Its application in inhibiting tobacco browning and improving tobacco's resistance to ripening and baking.

[0007] To achieve the above-mentioned objectives, the present invention employs the following technical solution:

[0008] This invention provides a tobacco polyphenol oxidase gene. NtPPO15 Its nucleotide sequence is shown in SEQ ID NO.1.

[0009] Furthermore, the tobacco polyphenol oxidase gene was amplified. NtPPO15 The primer sequences are shown in SEQ ID NO.6 and SEQ ID NO.7.

[0010] This invention provides tobacco polyphenol oxidase. NtPPO15 Its amino acid sequence is shown in SEQ ID NO.2.

[0011] This invention provides a gene that drives tobacco polyphenol oxidase. NtPPO15 The promoter for expression has the nucleotide sequence shown in SEQ ID NO.3.

[0012] Furthermore, the primer sequences for amplifying the promoter are shown in SEQ ID NO.4 and SEQ ID NO.5.

[0013] The present invention also provides the aforementioned tobacco polyphenol oxidase gene. NtPPO15 Applications in inhibiting tobacco browning and improving tobacco's resistance to ripening and baking.

[0014] Compared with the prior art, the advantages and technical effects of the present invention are: the present invention first screens out key genes related to tobacco browning during the ripening and curing periods. NtPPO15 Further investigation was conducted by constructing a GUS staining vector. NtPPO15 Promoter activity and gene expression sites; through construction NtPPO15 The specific subcellular localization of NtPPO15 protein was investigated by fusing it with GFP protein; and the function of the gene was studied in depth through gene editing and overexpression. This invention experimentally demonstrates the benefits provided by the invention. NtPPO15 These genes are key genes involved in browning during the ripening and curing process of tobacco, and they regulate... NtPPO15 The expression level of genes can control the browning of tobacco, improve its ripening and roasting resistance, improve the quality of tobacco products, greatly increase economic benefits, and can also be used to screen tobacco varieties with excellent quality. Therefore, it has good and broad market application prospects. Attached Figure Description

[0015] The present invention will now be described in further detail with reference to the accompanying drawings and specific embodiments.

[0016] Figure 1 This describes the color change of tobacco leaves during the dark treatment process in a darkroom experiment.

[0017] Figure 2 These are the expression levels of 12 tobacco PPO genes in this invention;

[0018] Figure 3 This refers to the darkroom processing at 0h, 24h, 48h, 72h, and 96h. NtPPO15 Gene expression levels;

[0019] Figure 4 yes NtPPO15 Promoter amplification diagram;

[0020] Figure 5 This shows the GUS staining of leaf tissue from T0 generation of promoter-transgenic tobacco.

[0021] Figure 6 yes NtPPO15 Subcellular localization results of genes;

[0022] Figure 7 It is the identification of overexpression positive strains (7A) and NtPPO15 Gene expression levels (7B) (WT: common tobacco K326);

[0023] Figure 8 yes NtPPO15 Appearance comparison between the overexpression strain and ordinary tobacco K326;

[0024] Figure 9 It is a control under darkroom processing (WT) and NtPPO15 Overexpression of color changes in the middle leaves of the material;

[0025] Figure 10 yes NtPPO15 Results of PPO activity in the middle leaves of overexpressing lines and control (WT) lines;

[0026] Figure 11 It is a control under darkroom processing (WT) and NtPPO15 Color changes in the middle leaves of gene-edited materials;

[0027] Figure 12 yes NtPPO15 Results of PPO activity in the middle leaves of gene-edited lines and controls (WT). Detailed Implementation

[0028] To enhance understanding of the present invention, preferred embodiments are described below. Those skilled in the art should understand that the specific descriptions below are illustrative rather than restrictive and should not be construed as limiting the scope of protection of the present invention.

[0029] Example 1: Transcriptome changes in tobacco leaves in response to darkness stress

[0030] 1. Dark box test

[0031] Dark-box experiments reflect the ease and resistance to curing of flue-cured tobacco based on the rate of yellowing and browning of tobacco leaves under dark conditions. This invention uses the common tobacco variety K326 as the experimental material, designs a dark-box experiment, and utilizes transcriptome sequencing technology to study gene expression changes during the browning process of tobacco leaves. The aim is to identify the expression changes of key genes in metabolic pathways related to tobacco leaf browning and to elucidate the transcriptional regulatory mechanism of tobacco leaf browning.

[0032] A dark, sealed dark chamber was constructed according to the requirements of the tobacco industry standard YC / T 311-2009 for dark chamber testing. A 1.2m x 0.75m rectangular cardboard box was wrapped in black film and placed in a dark room to maintain a dark, airtight, room-temperature environment. Three fresh tobacco leaves of uniform maturity from the middle section of K326 (three replicates) were placed in the dark chamber at room temperature. Every 12 hours initially, and every 24 hours later, the tobacco leaves were removed and observed and photographed in the same well-lit location until the leaves turned 30% brown. Samples were taken every 24 hours and stored at -80°C for later use in transcriptome sequencing.

[0033] The phenotype of tobacco leaves was observed under dark chamber treatment conditions, and the color changes of tobacco leaves during the dark stress process were as follows: Figure 1 As shown, Figure 1 The results showed that the tobacco leaves began to turn brown after 60-72 hours.

[0034] 2. Transcriptional analysis of polyphenol oxidase gene in tobacco leaves under dark box treatment

[0035] To identify which polyphenol oxidase genes in tobacco leaves are involved in the dark stress response, this invention analyzed the expression of 12 PPO genes identified in tobacco. HTSeq was used to statistically analyze the read count for each gene, which was then used as the raw expression level. The read count was positively correlated with the true expression level of the gene, as well as gene length and sequencing depth. To ensure comparability of gene expression levels between different genes and samples, expression levels were normalized using FPKM (Fragments Per Kilobases Per Millionfragments). FPKM represents the number of fragments per kilobase length from a particular gene per million fragments, and a heatmap was plotted based on the FPKM values. The results are as follows: Figure 2 As shown, from Figure 2 As can be seen from this, among the 12 NtPPO genes, NtPPO15 As the coercion of darkness progressed, the level of expression clearly increased, indicating... NtPPO15 Genes specifically participate in the browning reaction of tobacco leaves.

[0036] 3. qRT-PCR validation of transcriptome data

[0037] To validate differentially expressed key genes identified in transcriptome sequencing analysis, qRT-PCR was used to analyze samples treated in a dark chamber at 0h, 24h, 48h, 72h, and 96h. NtPPO15 Gene expression was verified. Figure 3 Experimental results show that after 72 hours of dark box treatment, NtPPO15 Expression levels were significantly upregulated, and qRT-PCR analysis further demonstrated that under darkness stress... NtPPO15 Genes are associated with browning and heat resistance in tobacco leaves.

[0038] Example 2: NtPPO15 Expression pattern analysis and gene function research

[0039] 1. Amplification NtPPO15 gene promoters

[0040] In order to conduct in-depth research NtPPO15 Gene expression characteristics and regulatory mechanisms, first cloned NtPPO15 promoters (such as) Figure 4 ), and analyzed the cloned sequences.

[0041] by NtPPO15 Using the 5′-upstream sequence as a reference, a specific primer Pro was designed. NtPPO15 -F / R:

[0042] Pro NtPPO15-F: AGGCACAGCAATGATGAG (SEQ ID NO.4);

[0043] Pro NtPPO15 -R:AGGAATGACCACCAACAATA(SEQ ID NO.5);

[0044] Using primer Pro from the K326 genome of common tobacco NtPPO15 Fragments obtained by -F / R cloning were analyzed by cloning sequencing. NtPPO15 The gene promoter fragment is 2145 bp in length (as shown in SEQ ID NO.3). This sequence was imported into the PlantCARE database for further analysis. NtPPO15 Analysis of the cis-acting elements in the promoter region revealed that, in addition to the large number of TATA and CAAT boxes and numerous photoresponsive elements (I-box, LTR, G-Box, GA-motif, GATA-motif, GT1-motif, etc.) found in general promoters, the sequence also contained many specific response elements.

[0045] 2. Promoter function analysis and construction of plant expression vectors

[0046] Will NtPPO15 After purification, the promoter amplification product was ligated into a TA cloning vector to obtain pro. NtPPO15 -TA, using primer 1301 with a connector- NtPPO15 -pro_F / R, with pro NtPPO15 PCR amplification was performed using TA as a template, and the product was recovered from the gel after gel digestion. The PCAMBIA1301 vector was digested with BamHI and NcoI to remove the 35S promoter, and the product was then recovered from the gel. Subsequently, seamless cloning was used to... NtPPO15 The promoter sequence was ligated into the PCAMBIA1301 variant, and DH5α competent cells were transformed using the heat shock method. Identification was performed by colony PCR, and plasmids were extracted and sequenced after amplification. The constructed recombinant plasmid Pro... NtPPO15 -PCAMBIA1301 was used for genetic transformation of tobacco.

[0047] 1301- NtPPO15 -pro_F: aattcgagctcggtacccggggatccAGGCACAGCAATGATGAG(BamHI)

[0048] 1301- NtPPO15 -pro_r:ttaccctcagatctaccatggTATAACTTTTAATTGGTTTAGGGTGT(NcoI)

[0049] The results are as follows Figure 5 As shown, NtPPO15 The promoters of all genes can regulate the expression of the GUS gene in leaves and flowers. Further microscopic observation of the leaves revealed that the vascular bundles and glandular trichomes contained a deeper blue color, therefore... NtPPO15 Its expression in leaves and vascular bundles is higher than in surrounding tissues. Furthermore, NtPPO15 The promoter can drive the expression of the GUS gene in sepals, petals, stamens and pistils. The expression level is high in sepals, partially expressed in petals, expressed in anthers of stamens but not in filaments, and expressed in the top of style and part of stigma of pistils.

[0050] Example 3, Subcellular Localization

[0051] To determine the specific subcellular location of NtPPO15 protein, green fluorescent protein (GFP) was used as a reporter protein. NtPPO15 The C-terminus of the GFP fluorescent protein gene was fused, and the PCAMBIA35S-EGFP vector was digested with KpnI. The target gene was then ligated to the vector using a seamless cloning method. The resulting plasmid was transformed into *E. coli* DH5α, and positive colonies were obtained after colony PCR identification. The fusion expression plasmid was then validated by sequencing. NtPPO15 -PCAMBia35S-EGFP was transformed into Agrobacterium GV3101 and transiently expressed in Nitraria benthamiana. The GFP fluorescence signal was detected using laser confocal microscopy to verify the subcellular localization of the NtPPO15 protein. Results are as follows: Figure 6 ,show NtPPO15 The PCAMBia35S-EGFP fusion protein is primarily located in chloroplasts.

[0052] Example 4: Gene Overexpression Experiment

[0053] 1. Cloning of the target gene and construction of the vector

[0054] The present invention provides NtPPO15 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the corresponding amino acid sequence of the protein is shown in SEQ ID NO.2. Using cDNA extracted from common tobacco K326 after 72 hours of treatment in a dark chamber as a template, amplification was performed... NtPPO15 Gene coding sequence, amplified NtPPO15 The upstream and downstream primer sequences of the gene are shown in SEQ ID NO.6 and SEQ ID NO.7. Homologous recombination primers were used. NtPPO15 -KpnI-F / R constructs a fragment containing the target fragment NtPPO15 Gene overexpression recombinant vector NtPPO15-PCAMBIA35S-eGFP was synthesized and transformed into Escherichia coli DH5α. After the positive strain was expanded and cultured, plasmids were extracted and transformed into Agrobacterium to infect tobacco leaves.

[0055] NtPPO15 -F: ATGGCTTCTCTTCCACTCCCC (SEQ ID NO.6);

[0056] NtPPO15 -R: TCAATCCTCAAGCACAATCTTGACTCC (SEQ ID NO.7);

[0057] NtPPO15 -KpnI-F: ACGAACGATAGCCATGGTACCAATGGCTTCTCTTCCACTCCCC (SEQ IDNO.8);

[0058] NtPPO15 -KpnI-R: ATGTTAACAAGGCCTGGTACCTCAATCCTCAAGCACAATCTTGACTCC (SEQ ID NO. 9).

[0059] 2. Screening of positive seedlings from the T0 generation

[0060] The primers were designed as follows. Genomic DNA was extracted from the regenerated seedlings and used as a template for PCR amplification and verification.

[0061] 35s-F: AGCAAGTGGATTGATGTGA;

[0062] NtPPO15-OE-R: GGTGGAAAGGAAGGAAAAGC

[0063] Genetic transformation of tobacco was carried out using Agrobacterium-mediated transformation, and a total of overexpressing [substances] were obtained. NtPPO15 ( NtPPO15 15 plants (-OE) were selected, and DNA was extracted from young leaves of T0 generation plants for PCR reaction. Figure 7 As shown in A, 15 plants NtPPO15 -OE all plants could amplify bands, while the negative control wild-type plants could not amplify bands, indicating that 15 plants NtPPO15 -OE transgenic seedlings were all positive.

[0064] Total RNA was extracted from leaves of transgenic positive seedlings and reverse transcribed into cDNA for quantitative real-time PCR analysis. The appropriate primers for quantification are: RT. NtPPO15 -F: TTCCCTCCACCATCAACCA; RT NtPPO15 -R: CACCATCACAATAAGCACAA. The results showed that 13 plants... NtPPO15 The expression levels of the overexpression lines were significantly higher than those of wild-type tobacco, and the overexpression lines... NtPPO15 -OE-8 expression was the highest ( Figure 7 B).

[0065] 3. Phenotypic analysis of overexpression lines under dark box treatment

[0066] NtPPO15 The overexpression strains showed no significant differences in plant type and appearance compared to the common tobacco K326 strain. Figure 8 As shown. T0 generation was selected during the budding stage. NtPPO15 The middle leaves of -OE-overexpressing positive plants and control K326 plants were subjected to dark treatment to observe the browning phenotype of the leaves and evaluate the tobacco's resistance to curing. The results are as follows: Figure 9 As shown.

[0067] Referring to Gao Yunpeng et al., the 2023 method was used to quantitatively determine the proportions of green, yellow, and brown areas in tobacco leaves (Gao Yunpeng, Fang Song, Wang Yihui, et al. Effect of harvest maturity on color changes during cigar tobacco leaf drying [J]. China Tobacco Science, 2023, 44(04): 87-93+102.). The results are shown in Table 1. During the dark chamber treatment from 0 to 72 h, the green area of ​​the middle leaves gradually decreased, while the yellow area gradually increased. At 72 h, the tobacco leaves turned completely yellow, and... NtPPO15 - The yellowing rate of tobacco leaves in the OE strain was 81.05%, higher than that of the control (71.95%). The browning of the middle tobacco leaves mainly occurred after yellowing (72 h), and the degree of browning gradually stabilized between 168 and 192 h. NtPPO15 -OE overexpression lines showed significantly greater browning of tobacco leaves than the wild-type control, at 192 h. NtPPO15 The browning area of ​​tobacco leaves in the -OE strain was 76.15%, compared to 53.21% in the control.

[0068] Table 1. Percentage of color change area in the middle leaves of overexpression materials and wild-type tobacco under dark box treatment.

[0069]

[0070] 4. Determination of polyphenol oxidase activity

[0071] Using a polyphenol oxidase (PPO) kit (Suzhou Gres Biotechnology Co., Ltd., catalog number G0113W), the process was handled in a darkroom. NtPPO15 PPO activity was measured in OE-overexpressing lines and wild-type lines.

[0072] Weigh 0.1g of dried sample (the sample was blanched at 105℃ for 3min, then dried at 60℃ to constant weight, pulverized, and passed through a 40-60 mesh sieve to obtain the dried sample), add 1mL of extraction solution, homogenize in an ice bath, centrifuge at 4℃×12000rpm for 15min, take the supernatant, and determine the polyphenol oxidase activity.

[0073] The results are as follows Figure 10 As shown, at various time points after the black-box processing, NtPPO15 The PPO activity in the middle leaves of the -OE overexpression strains was higher than that in the WT strains; and the PPO activity was highest at 72h.

[0074] Example 6: Gene Editing

[0075] 1. Gene knockout

[0076] According to tobacco NtPPO15 The gene sequence (shown in SEQ ID NO.1) was used to design a knockout target. NtPPO15 The target sequence design is shown in Table 2. After linearizing the CRISPR / Cas expression vector backbone, it was linked with the annealing product and introduced into the downstream region of the U6 promoter and the upstream region of the gRNA. The vector also enhances the expression of Cas9 protein through two tandem 35S strong promoters.

[0077] Table 2 Target site sequences of gene editing vectors

[0078]

[0079] well-built NtPPO15 - CRISPR / Cas9 recombinant plasmids were used to transform tobacco plants via Agrobacterium-mediated transformation. DNA was extracted from T0 generation plants, amplified by PCR, and then sequenced using Sanger sequencing (BGI Genomics Co., Ltd., Shenzhen). The primers used are shown in Table 3.

[0080] Table 3 Primers for gene editing detection

[0081]

[0082] Sequencing results revealed 6 strains. NtPPO15 Gene knockout plants, one of which is homozygous. NtPPO15 -4-GE, the mutation type is the insertion of one base. As shown in Table 4:

[0083] Table 4. Types of homozygous gene-editing mutations

[0084]

[0085] 2. NtPPO15 -GE knockout plant phenotypic analysis

[0086] Select T0 generation during the current budding stage NtPPO15 The middle leaves of gene-edited lines and wild-type control plants were subjected to darkness treatment to observe the browning phenotype and evaluate the tobacco leaves' tolerance to curing. Results are as follows: Figure 11 As shown in Table 5. Similarly, the proportions of green, yellow, and brown areas in the tobacco leaves were determined, and the results showed that during the dark box processing, NtPPO15 Both the gene knockout lines and the WT line showed a gradual decrease in green leaf area and an increase in yellow area over time, with an overall increasing trend in the degree of browning of tobacco leaves. Within 96-120 h, NtPPO15 The middle leaves of the gene knockout strain turned completely yellow, followed by obvious browning of the tobacco leaves after 120 hours. At 192 hours, the browning degree (WT) was 60.5%. NtPPO15 -GE was 23.9%. Overall, the central leaf NtPPO15 Compared with the control WT, the gene knockout line showed a significant reduction in browning, indicating a significant improvement in the tobacco leaves' resistance to baking.

[0087] Table 5. Percentage of color change area in the middle leaves of gene-edited materials and wild-type tobacco under dark box treatment.

[0088]

[0089] 4. Analysis of polyphenol oxidase activity in gene-edited materials

[0090] Further PPO activity was measured in the leaves treated in the dark chamber, and the results are as follows: Figure 12 As shown, it can be seen that throughout the entire dark processing process, NtPPO15 The PPO activity of the gene-edited lines was lower than that of the control group (WT); at 96 h, NtPPO15 -The PPO activity of the GE strain was significantly lower than that of the control.

[0091] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions claimed by the present invention.

Claims

1. Driver of tobacco polyphenol oxidase gene NtPPO15 The promoter of expression is characterized by, Its nucleotide sequence is shown in SEQ ID NO.

3.

2. Tobacco polyphenol oxidase gene NtPPO15 Its application in inhibiting tobacco browning is characterized by, The application involves reducing gene density through gene editing. NtPPO15 The expression level of the tobacco polyphenol oxidase gene can be reduced, thereby inhibiting tobacco browning. NtPPO15 The nucleotide sequence is shown in SEQ ID NO.

1.

3. The application according to claim 2, characterized in that, The gene editing includes gene knockout and gene design. NtPPO15 Targeted knockout sites , In genes NtPPO15 Inserting a mutated base into the gene makes the gene... NtPPO15 Expression deactivation.

4. The application according to claim 3, characterized in that, Gene NtPPO15 The knockout target sequences are shown in SEQ ID NO.10 and SEQ ID NO.11.