Viral vectors

Abstract

The present disclosure relates to antagonists that directly or indirectly target serine / arginine rich splicing factor 1 (SRSF1); a viral vector comprising a nucleic acid sequence encoding an SRSF1 antagonist. Also disclosed is the use of the vector in gene therapy for the treatment of neurodegenerative diseases, such as amyotrophic lateral sclerosis (ALS) or sporadic amyotrophic lateral sclerosis that is not caused by amplification of the pathological C9ORF72 hexonucleotide repeat, and methods thereof.

Description

[0001] Field of the Disclosure

[0002] The present disclosure relates to an antagonist that directly or indirectly targets Serine / ArginineRich Splicing Factor 1 (SRSF1); a viral vector comprising a nucleic acid sequence encoding the SRSF1 antagonist. Also disclosed are uses of the vector in gene therapy for treating neurodegenerative diseases such as amyotrophic lateral sclerosis (ALS) or sporadic amyotrophic lateral sclerosis not caused by pathological C9ORF72 hexanucleotide repeat expansion and methods thereof.

[0003] BACKGROUND OF THE DISCLOSURE

[0004] Gene therapy aims to treat diseases in the long term by introducing genetic material that changes cellular function. There are several gene therapy approaches, such as delivering functional genes to replace defective genes, inactivating toxic genes by gene silencing or antisense, introducing or overexpressing missing genes in the host, and gene editing approaches. Virus-based vectors such as adenovirus (Ad), adeno-associated virus (AAV), self-complementary AAV, and retroviruses (i.e., lentiviruses) are most commonly used to deliver genetic material.

[0005] The safety of gene therapy vectors requires special attention because gene therapy vectors will exist in the patient's body for a long time, and gene therapy vectors must be designed to reduce genotoxic effects, immune responses, or prevent activation of neighboring genes near the integration site. The backbone of the viral vector usually contains a protein capsid for packaging the expressed nucleic acid, genetic information describing the expressed nucleic acid placed between the inverted terminal repeats, and elements that allow effective expression in the host (such as promoter elements). When delivering small-sized genetic materials such as short hairpin RNA (shRNA) or antisense oligonucleotides, non-expressed "stuffer" nucleotide sequences are usually required to improve the targeting efficiency and expression of the shRNA or oligonucleotide nucleic acid and achieve optimal packaging capacity.

[0006] Neurodegenerative diseases are usually caused by neuronal dysfunction or neuronal loss, affecting millions of people worldwide. Neurodegenerative diseases are more common in the aging population and include, but are not limited to, amyotrophic lateral sclerosis (ALS), multiple sclerosis, Parkinson's disease, Alzheimer's disease, motor neuron and Huntington's disease. ALS and frontotemporal dementia (FTD) are adult-onset neurodegenerative diseases for which there is no effective treatment. ALS is the most common form of motor neuron disease (MND), a general term for a group of neurological disorders characterized by degeneration and loss of motor neurons. ALS is characterized by selective degeneration of upper and lower motor neurons, leading to muscle wasting and premature death usually caused by respiratory failure and paralysis. About 90% of ALS cases are classified as sporadic, and about 10% of cases show genetic components and familial inheritance. FTD is the second most common form of early-onset dementia, characterized by the gradual loss of neuronal cells in the frontal and temporal lobes, leading to changes in cognitive function and personality.

[0007] The most common genetic cause of ALS and FTD is a hexanucleotide repeat expansion of GGGGCC in the first intron of the open reading frame 72 (C9orf72) gene on chromosome 9, known as C9ALS / FTD.

[0008] Antisense oligonucleotide therapy targeting C9ORF72 is in clinical trials, which aims to reduce the expression of repeat sequence expansion without affecting the normal expression of C9orf72, thereby reducing the toxicity of RNA and DPR. Patent US10,801,027, which is incorporated herein by reference, demonstrated that depletion of the export adapter serine / arginine-rich splicing factor 1 (SRSF1) inhibited the nuclear export of pathological C9ORF72 repeat sequence transcripts that maintain hexanucleotide repeat sequence expansion.

[0009] However, while depletion of SRSF1 is effective in patients with ALS caused by hexanucleotide repeat expansion, the present disclosure identifies that depletion of SRSF1 can also produce neuroprotective effects in sporadic ALS cases that are not caused by pathological C9ORF72 hexanucleotide repeat expansion.

[0010] This disclosure describes

[0011] According to one aspect of the present invention, a viral vector is provided, which comprises a transcription cassette for expressing a nucleic acid molecule in a mammalian host cell, wherein the nucleic acid molecule is operably linked to a promoter, and the promoter is suitable for expressing the nucleic acid molecule in the mammalian host cell, characterized in that the vector comprises a non-expressed nucleotide sequence, and wherein the nucleic acid molecule encodes an antagonist targeting a serine / arginine-rich splicing factor (SRSF1) or a SRSF1 peptide sequence.

[0012] Non-expressed nucleotide sequences are often referred to as "stuffer" sequences. Stuffer nucleotide sequences are known in the art and are non-expressed nucleotide sequences that provide optimal viral packaging for viral-based vectors. PCT / US2013 / 031644 discloses stuffer sequences, which is incorporated herein by reference in its entirety. Stuffer nucleotide sequences can be placed between viral inverted terminal repeats, on either side of the transgene of interest, or two stuffer sequences can be added on each side of the transgene of interest.

[0013] In a preferred embodiment of the invention, the antagonist is a polypeptide or peptide.

[0014] In a preferred embodiment of the present invention, the antagonist is a nucleic acid-based agent.

[0015] In a preferred embodiment of the present invention, the nucleic acid-based agent is an antisense nucleic acid, an inhibitory RNA or a shRNA or a miRNA molecule, which is complementary to a nucleic acid encoding a serine / arginine-rich splicing factor (SRSF1) and inhibits its expression.

[0016] Preferably, the SRSF1 comprises or consists of the sequence listed in SEQ ID NO 67.

[0017] Alternatively, the SRSF1 comprises or consists of the sequence set forth in SEQ ID NO 76.

[0018] The nucleic acid based agent is designed with reference to the sequence set forth in SEQ ID NO 67, or alternatively is designed with reference to the sequence set forth in SEQ ID NO 76.

[0019] In a preferred embodiment of the invention, the nucleic acid-based agent is an inhibitory RNA.

[0020] In a preferred embodiment of the invention, the nucleic acid-based agent is antisense RNA.

[0021] In a further preferred embodiment of the present invention, the inhibitory RNA is a shRNA or miRNA molecule.

[0022] A technique for specifically eliminating gene function is to introduce double-stranded RNA (also called small inhibitory or interfering RNA (siRNA, shRNA and miRNA)) into cells, thereby destroying mRNA complementary to the sequence contained in the siRNA molecule. The siRNA molecule contains two complementary RNA chains (sense strand and antisense strand), which anneal to each other to form a double-stranded RNA molecule. The siRNA molecule is usually derived from the exon of the gene to be eliminated. The mechanism of RNA interference is currently being elucidated. Many organisms respond to the presence of double-stranded RNA by activating a cascade that leads to the formation of siRNA. The presence of double-stranded RNA activates a protein complex containing RNaseIII, which processes the double-stranded RNA into smaller fragments (siRNA, about 21-29 nucleotides in length), which become part of the ribonucleoprotein complex. The siRNA acts as a guide to cause the RNase complex to cut the mRNA complementary to the antisense strand of the siRNA, thereby destroying the mRNA.

[0023] In a preferred embodiment of the present invention, the length of the inhibitory RNA molecule is between 19 nucleotides [nt] and 29 nt. More preferably, the length of the inhibitory RNA molecule is between 21 nt and 27 nt. Preferably, the length of the inhibitory RNA molecule is about 21 nt.

[0024] In a preferred embodiment of the present invention, the inhibitory RNA comprises or consists of a nucleotide sequence listed in SEQ ID NO: 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57 or 58.

[0025] In a preferred embodiment of the present invention, the shRNA comprises or consists of a nucleotide sequence selected from the group consisting of SEQ ID NOs 2, 3, 4, 5, 6, 7, 8, 9, 10 and 11.

[0026] In a preferred embodiment of the present invention, the shRNA comprises or consists of the nucleotide sequence listed in SEQ ID NO 7.

[0027] In a preferred embodiment of the present invention, the shRNA comprises or consists of the nucleotide sequence listed in SEQ ID NO 10.

[0028] In a preferred embodiment of the present invention, the shRNA comprises the nucleotide sequence listed in SEQ ID NO 11 or consists of it.

[0029] In a preferred embodiment of the present invention, the peptide comprises an amino acid sequence of at least 10 amino acids in length and comprises all or part of the amino acid sequence set forth in SEQ ID NO:59.

[0030] In a preferred embodiment of the present invention, the peptide comprises an amino acid sequence of at least 32 amino acids in length and comprises the amino acid sequence set forth in SEQ ID NO:59.

[0031] In a preferred embodiment of the invention, the length of the peptide is at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 29, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or at least 100 amino acids, but less than the full length amino acid sequence listed in SEQ ID NO:60 or 61.

[0032] In a preferred embodiment of the present invention, the peptide consists of the amino acid sequence set forth in SEQ ID NO:59.

[0033] In an alternative embodiment of the invention, the peptide is a dominant negative protein comprising a modification of the amino acid sequence set forth in SEQ ID NO:60 or 61.

[0034] In a preferred embodiment of the present invention, the dominant negative protein comprises or consists of the amino acid sequence set forth in SEQ ID NO: 60 or 61, wherein the amino acid sequence is modified by adding, deleting or substituting one or more amino acid residues.

[0035] In a preferred embodiment of the present invention, the modified protein comprises or consists of the amino acid sequence set forth in SEQ ID NO: 62 or 63.

[0036] In a preferred embodiment of the present invention, the nucleic acid molecule comprises a nucleic acid sequence encoding a polypeptide or peptide as set forth in SEQ ID NO: 89, or a sequence that is 90% identical to the sequence set forth in SEQ ID NO: 89.

[0037] In a further preferred embodiment of the present invention, the length of the nucleic acid sequence is at least 36 nucleotides.

[0038] In a preferred embodiment of the invention, the peptide comprises an amino acid sequence that is at least 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40 or 42 amino acids in length and is set forth in SEQ ID NO:90.

[0039] In a preferred embodiment of the present invention, the peptide comprises the amino acid sequence set forth in SEQ ID NO: 75 (GSWQDLKDHMREA).

[0040] In a preferred embodiment of the present invention, the viral vector comprises an RNA Pol III terminator.

[0041] Preferably, the terminator comprises the nucleic acid sequence 5'TTTTTT 3'.

[0042] In a preferred embodiment of the present invention, the vector comprises an inverted terminal repeat nucleotide sequence.

[0043] Inverted terminal repeats (ITRs) are usually located upstream and downstream of the transcription cassette. Alternatively, the ITRs are located upstream and downstream of the transcription cassette, the non-expressed nucleotide sequence and any optional regulatory elements.

[0044] In a preferred embodiment of the present invention, the ITR sequence is set forth in SEQ ID NO 64.

[0045] In a preferred embodiment of the present invention, the ITR sequence is set forth in SEQ ID NO 88.

[0046] In a preferred embodiment of the present invention, the promoter is selected from the group consisting of H1 polymerase III promoter, U6 promoter, U7 promoter or mammalian 7SK promoter.

[0047] In a further preferred embodiment of the present invention, the promoter is the H1 polymerase III promoter.

[0048] In a preferred embodiment, the H1 polymerase III promoter is set forth in SEQ ID NO 65.

[0049] Viruses are usually used as carriers for delivering foreign genes. Commonly used carriers include recombinantly modified enveloped or non-enveloped DNA and RNA viruses, such as baculoviridae, parvoviridae, picornoviridiae, herpesveridiae, poxviridae, adenoviridae, picornnaviridiae or retroviridae (such as slow virus). Chimeric vectors can also be used, which utilize favorable elements in each parental vector characteristic (see, for example, Feng, et al (1997) Nature Biotechnology 15: 866-870). This viral vector can be wild-type, or can be transformed into replication defective, conditional replication or replicable type by recombinant DNA technology. Conditional replication type viral vectors are used to achieve selective expression in specific cell types while avoiding harmful broad-spectrum infection. Examples of conditionally replicating vectors are described in Pennisi, E. (1996) Science 274:342-343; Russell, and SJ (1994) Eur. J. of Cancer 30A(8):1165-1171.

[0050] Preferred viral vectors are derived from adenovirus, adeno-associated virus or retrovirus genomes.

[0051] In a preferred embodiment of the invention, the viral-based vector is an adeno-associated virus [AAV].

[0052] In a preferred embodiment of the present invention, the adeno-associated virus is a self-complementary adeno-associated virus (scAAV).

[0053] In a preferred embodiment, the viral-based vector is selected from the group consisting of: AAV2, AAV3, AAV6, AAV13; AAV1, AAV4, AAV5, AAV6, AAV9 and AAVrh10.

[0054] In a preferred embodiment, the scAAV is selected from the group consisting of: scAAV2, scAAV3, scAAV6, scAAV13; scAAV1, scAAV4, scAAV5, scAAV6, scAAV9 and scAAVrh10.

[0055] In a preferred embodiment of the present invention, the viral based vector is scAAV9 or scAAVrh10.

[0056] In an alternative preferred embodiment of the present invention, said viral-based vector is a lentiviral vector.

[0057] According to another aspect of the present invention, there is provided a pharmaceutical composition comprising the viral vector according to the present invention and an excipient or carrier.

[0058] The viral vector composition of the present invention is administered in the form of a pharmaceutically acceptable preparation. Such preparations may conventionally contain pharmaceutically acceptable concentrations of salts, buffers, preservatives, compatible carriers, and adjuvant therapeutic agents. The expression vector composition of the present invention may be administered by any conventional route, including injection or gradual infusion over time, particularly intrathecal (such as lumbar puncture) and / or intracerebral administration.

[0059] The viral vector compositions of the present invention are administered in an effective amount. An "effective amount" is the amount of the expression vector used alone or in combination with other doses that can produce the desired response. In the case of treating a disease, the desired response is to inhibit the development of the disease. This may only involve temporarily slowing the development of the disease, although more preferably, it involves permanently stopping the development of the disease. This can be monitored by conventional methods. Of course, this amount will depend on the specific condition being treated, the severity of the condition, individual patient parameters (including age, physical condition, body shape and weight), the duration of treatment, the nature of concurrent treatment (if any), the specific route of administration, and similar factors within the knowledge and expertise of the medical practitioner. These factors are well known to those of ordinary skill in the art and can be resolved by only routine experimentation. In general, it is preferred to use the maximum dose of a single component or a combination thereof, that is, the highest safe dose based on sound medical judgment. However, it will be understood by those of ordinary skill in the art that patients may insist on using a lower dose or a tolerable dose for medical reasons, psychological reasons, or indeed any other reason.

[0060] The viral vector composition used in the above method is preferably sterile and contains an effective amount of the expression vector according to the present invention, so as to produce the desired reaction in a weight or volume unit suitable for application to the patient. The vector dosage applied to the subject can be selected according to different parameters, particularly according to the mode of administration used and the state of the subject. Other factors include the required treatment cycle. If the subject does not react sufficiently at the initial dose applied, a higher dose (or substantially higher doses achieved by different, more local delivery routes) can be used within the range allowed by the patient's tolerance. Those of ordinary skill in the art also know other schemes for applying the vector composition, wherein the dosage, injection schedule, injection site, mode of administration, etc. may be different from the above scheme. Compositions can be applied to mammals other than humans (such as for testing purposes or veterinary treatment purposes) under substantially the same conditions as above. The subject used herein is a mammal, preferably a human being, and includes non-human primates, cattle, horses, pigs, sheep, goats, dogs, cats or rodents.

[0061] When applied, the viral vector composition of the present invention is applied in a pharmaceutically acceptable amount and in the form of a pharmaceutically acceptable composition. The term "pharmaceutically acceptable" refers to a non-toxic substance that does not interfere with the effectiveness of the biological activity of the active agent. Such preparations may generally contain salts, buffers, preservatives, compatible carriers, and optional other therapeutic agents (e.g., therapeutic agents commonly used to treat specific disease indications). When used in medicine, the salt should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts can also be conveniently used to prepare pharmaceutically acceptable salts thereof, and are not excluded from the scope of the present invention. These pharmacological and pharmaceutically acceptable salts include, but are not limited to, salts prepared from the following acids: hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, maleic acid, acetic acid, salicylic acid, citric acid, formic acid, malonic acid, succinic acid, etc. In addition, pharmaceutically acceptable salts can also be prepared as alkali metal salts or alkaline earth salts, such as sodium salts, potassium salts or calcium salts.

[0062] The pharmaceutical composition containing the viral vector according to the present invention may contain a suitable buffer, including a salt form of acetic acid; a salt form of citric acid; a salt form of boric acid; and a salt form of phosphoric acid. The pharmaceutical composition may also optionally contain a suitable preservative, such as benzalkonium chloride; chlorobutanol; parabens and thimerosal.

[0063] Viral vector compositions can be conveniently presented in unit dosage form and can be prepared by any method well known in the pharmaceutical field. All methods include the step of combining an active agent with a carrier constituting one or more auxiliary components. The preparation can be prepared using a suitable dispersant or wetting agent and a suspending agent according to known methods. Sterile injection preparations can also be sterile injection solutions or suspensions in non-toxic, parenterally acceptable diluents or solvents, such as solutions in 1,3-butanediol. Acceptable solvents that can be used include water, Ringer's solution, and isotonic sodium chloride solution. In addition, sterile fixed oils are generally used as solvents or suspension media. For this purpose, any mild fixed oil can be used, including synthetic monoglycerides or diglycerides. In addition, fatty acids such as oleic acid can also be used to prepare injections. Carrier preparations suitable for oral, subcutaneous, intravenous, intramuscular, etc. administration can be found in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA.

[0064] According to another aspect of the present invention, there is provided a viral vector according to the present invention for use as a medicament.

[0065] According to another aspect of the present invention, there is provided a viral vector according to the present invention for use in treating a neurodegenerative disease.

[0066] In a preferred embodiment of the present invention, the neurodegenerative disease is selected from the group consisting of amyotrophic lateral sclerosis (ALS), sporadic amyotrophic lateral sclerosis, familial ALS caused by mutations other than pathological C9ORF72-repeat sequence expansion, frontotemporal dementia (FTD), motor neuron disease, frontotemporal lobardementia (FTLD), Huntington's disease and Fragile X-associated tremor / ataxia syndrome (FXTAS).

[0067] In a preferred embodiment of the invention, the neurodegenerative disease is amyotrophic lateral sclerosis (ALS).

[0068] In a preferred embodiment of the invention, the neurodegenerative disease is sporadic and / or familial amyotrophic lateral sclerosis.

[0069] In a preferred embodiment of the present invention, the neurodegenerative disease is ALS not caused by pathological C9ORF72-repeat sequence expansion.

[0070] In a preferred embodiment of the invention, the neurodegenerative disease is sporadic frontotemporal dementia (FTD).

[0071] In a preferred embodiment of the invention, the neurodegenerative disease is Fragile X-associated tremor / ataxia syndrome (FXTAS).

[0072] According to another aspect of the present invention, there is provided a cell transfected with the viral vector according to the present invention.

[0073] In a preferred embodiment of the invention, the cells are neurons and / or astrocytes.

[0074] In a preferred embodiment of the invention, the neurons are motor neurons and / or astrocytes.

[0075] According to another aspect of the present invention, there is provided a method for treating or preventing a neurodegenerative disease, comprising administering a therapeutically effective amount of the viral vector according to the present invention to prevent and / or treat the neurodegenerative disease.

[0076] In a preferred method of the invention, the neurodegenerative disease is sporadic amyotrophic lateral sclerosis and familial amyotrophic lateral sclerosis.

[0077] In a preferred method of the invention, the neurodegenerative disease is amyotrophic lateral sclerosis.

[0078] In a preferred embodiment of the present invention, the neurodegenerative disease is ALS not caused by pathological C9ORF72-repeat sequence expansion.

[0079] In a preferred method of the invention, the neurodegenerative disease is sporadic frontotemporal dementia (FTD).

[0080] In a preferred method of the invention, the neurodegenerative disease is Fragile X-associated tremor / ataxia syndrome (FXTAS).

[0081] According to another aspect of the present invention, an isolated nucleic acid molecule is provided, which encodes a shRNA molecule comprising or consisting of a nucleotide sequence selected from the group consisting of SEQ ID NOs 2, 3, 4, 5, 6, 7, 8, 9, 10 and 11.

[0082] The present invention includes sequence variants corresponding to the recorded SEQ IDs. Sequence variants refer to sequences that have 1, 2, 3, 4 or 5 nucleotide base changes compared to the reference sequence.

[0083] In a preferred embodiment of the present invention, the nucleic acid molecule comprises SEQ ID

[0084] O The nucleotide sequence listed in 7 or consisting thereof.

[0085] In a preferred embodiment of the present invention, the nucleic acid molecule comprises or consists of the nucleotide sequence set forth in SEQ ID NO 10.

[0086] In a preferred embodiment of the present invention, the nucleic acid molecule comprises the nucleotide sequence listed in SEQ ID NO 11 or consists of it.

[0087] According to another aspect of the present invention, there is provided a shRNA molecule comprising a nucleotide sequence or a variant thereof selected from the group consisting of:

[0088] SRSF1-shRNA1 (SEQ ID NO 91):

[0089] GCUGAUGUUUACCGAGAUGGC UUCAAGAGA GCCAUCUCGGUAAACAUCAGC;

[0090] SRSF1-shRNA2 (SEQ ID NO 92):

[0091] GGAGUUUGUACGGAAAGAAGA UUCAAGAGA UCUUCUUUCCGUACAAACUCC;

[0092] SRSF1-shRNA3 (SEQ ID NO 93):

[0093] GGAAAGAAGAUAUGACCUAUG UUCAAGAGA CAUAGGUCAUAUCUUCUUUCC;

[0094] SRSF1-shRNA4 (SEQ ID NO 94):

[0095] GAAAGAAGAUAUGACCUAUGC UUCAAGAGA GCAUAGGUCAUAUCUUCUUUC;

[0096] SRSF1-shRNA5 (SEQ ID NO 95):

[0097] GCCUACAUCCGGGUUAAAGUU UUCAAGAGA AACUUUAACCCGGAUGUAGGC;

[0098] SRSF1-shRNA6 (SEQ ID NO 96):

[0099] GGGCCCAGAAGUCCAAGUUAU UUCAAGAGA AUAACUUGGACUUCUGGGCCC;

[0100] SRSF1-shRNA7 (SEQ ID NO 97):

[0101] GGCCCAGAAGUCCAAGUUAUG UUCAAGAGA CAUAACUUGGACUUCUGGGCC;

[0102] SRSF1-shRNA8 (SEQ ID NO 98):

[0103] GCCCAGAAGUCCAAGUUAUGG UUCAAGAGA CCAUAACUUGGACUUCUGGGC;

[0104] SRSF1-shRNA9 (SEQ ID NO 99):

[0105] GGAAGAUCUCGAUCUCGAAGC UUCAAGAGA GCUUCGAGAUCGAGAUCUUCC; and

[0106] SRSF1-shRNA10 (SEQ ID NO 100):

[0107] GCAGAGGAUCACCACGCUAUU UUCAAGAGA AAUAGCGUGGUGAUCCUCUGC.

[0108] In a preferred embodiment of the present invention, the shRNA molecule comprises the nucleotide sequence listed in SEQ ID NO 96 or a variant thereof, or consists of the nucleotide sequence listed in SEQ ID NO 96 or a variant thereof.

[0109] In a preferred embodiment of the present invention, the shRNA molecule comprises the nucleotide sequence listed in SEQ ID NO 99 or a variant thereof, or consists of the nucleotide sequence listed in SEQ ID NO 99 or a variant thereof.

[0110] In a preferred embodiment of the present invention, the shRNA molecule comprises the nucleotide sequence listed in SEQ ID NO 100 or a variant thereof, or consists of the nucleotide sequence listed in SEQ ID NO 100 or a variant thereof.

[0111] According to one aspect of the present invention, there is provided an isolated nucleic acid molecule or shRNA according to the present invention for use as a medicament.

[0112] According to another aspect of the present invention, there is provided an isolated nucleic acid molecule or shRNA according to the present invention for use in treating a neurodegenerative disease.

[0113] In a preferred embodiment of the present invention, the neurodegenerative disease is selected from the group consisting of amyotrophic lateral sclerosis (ALS), sporadic amyotrophic lateral sclerosis, familial ALS caused by mutations other than pathological C9ORF72-repeat sequence expansion, frontotemporal dementia (FTD), motor neuron disease, frontotemporal lobar dementia (FTLD), Huntington's disease and fragile X-associated tremor / ataxia syndrome (FXTAS).

[0114] In a preferred embodiment of the invention, the neurodegenerative disease is amyotrophic lateral sclerosis (ALS).

[0115] In a preferred embodiment of the invention, the neurodegenerative disease is sporadic and / or familial amyotrophic lateral sclerosis.

[0116] In a preferred embodiment of the present invention, the neurodegenerative disease is ALS not caused by pathological C9ORF72-repeat sequence expansion.

[0117] In a preferred embodiment of the invention, the neurodegenerative disease is sporadic frontotemporal dementia (FTD).

[0118] In a preferred embodiment of the invention, the neurodegenerative disease is Fragile X-associated tremor / ataxia syndrome (FXTAS).

[0119] According to one aspect of the present invention, there is provided a siRNA molecule comprising or consisting of a nucleic acid sequence designed according to the shRNA listed in SEQ ID NOs 77-86.

[0120] According to one aspect of the present invention, there is provided a siRNA molecule according to the present invention for use as a medicament.

[0121] According to another aspect of the present invention, there is provided a siRNA molecule according to the present invention for use in treating a neurodegenerative disease.

[0122] In a preferred embodiment of the present invention, the neurodegenerative disease is selected from the group consisting of amyotrophic lateral sclerosis (ALS), sporadic amyotrophic lateral sclerosis, familial ALS caused by mutations other than pathological C9ORF72-repeat sequence expansion, frontotemporal dementia (FTD), motor neuron disease, frontotemporal lobar dementia (FTLD), Huntington's disease and fragile X-associated tremor / ataxia syndrome (FXTAS).

[0123] In a preferred embodiment of the invention, the neurodegenerative disease is amyotrophic lateral sclerosis (ALS).

[0124] In a preferred embodiment of the invention, the neurodegenerative disease is sporadic and / or familial amyotrophic lateral sclerosis.

[0125] In a preferred embodiment of the present invention, the neurodegenerative disease is ALS not caused by pathological C9ORF72-repeat sequence expansion.

[0126] In a preferred embodiment of the invention, the neurodegenerative disease is sporadic frontotemporal dementia (FTD).

[0127] In a preferred embodiment of the invention, the neurodegenerative disease is Fragile X-associated tremor / ataxia syndrome (FXTAS).

[0128] According to one aspect of the present invention, a cell penetrating polypeptide is provided, which comprises or consists of the amino acid sequence listed in SEQ ID NO 90.

[0129] In a preferred embodiment of the present invention, the length of the polypeptide is between 12 and 42 amino acids, or preferably between 13 and 42 amino acids.

[0130] In a further preferred embodiment of the present invention, the polypeptide comprises or consists of the amino acid sequence set forth in SEQ ID NO 75.

[0131] According to one aspect of the present invention, there is provided a polypeptide according to the present invention for use as a medicament.

[0132] According to another aspect of the present invention, there is provided a polypeptide according to the present invention for use in treating a neurodegenerative disease.

[0133] In a preferred embodiment of the present invention, the neurodegenerative disease is selected from the group consisting of amyotrophic lateral sclerosis (ALS), sporadic amyotrophic lateral sclerosis, familial ALS caused by mutations other than pathological C9ORF72-repeat sequence expansion, frontotemporal dementia (FTD), motor neuron disease, frontotemporal lobar dementia (FTLD), Huntington's disease and fragile X-associated tremor / ataxia syndrome (FXTAS).

[0134] In a preferred embodiment of the invention, the neurodegenerative disease is amyotrophic lateral sclerosis (ALS).

[0135] In a preferred embodiment of the invention, the neurodegenerative disease is sporadic and / or familial amyotrophic lateral sclerosis.

[0136] In a preferred embodiment of the present invention, the neurodegenerative disease is ALS not caused by pathological C9ORF72-repeat sequence expansion.

[0137] In a preferred embodiment of the invention, the neurodegenerative disease is sporadic frontotemporal dementia (FTD).

[0138] In a preferred embodiment of the invention, the neurodegenerative disease is Fragile X-associated tremor / ataxia syndrome (FXTAS).

[0139] According to another aspect of the present invention, an antagonist comprising a nucleic acid molecule is provided, wherein the nucleic acid molecule comprises a nucleotide sequence designed according to human serine / arginine-rich splicing factor (SRSF1), and wherein the nucleic acid molecule inhibits the expression of SRSF1.

[0140] In a preferred embodiment of the present invention, the nucleic acid molecule is a double-stranded nucleic acid molecule comprising a sense strand and an antisense strand containing nucleotide sequences, wherein the antisense nucleotide strand is suitable for annealing to a nucleic acid molecule encoding human SRSF1 through complementary base pairing.

[0141] In a preferred embodiment of the present invention, the double-stranded nucleic acid molecule is RNA. Preferably, the RNA is siRNA or miRNA.

[0142] In an alternative embodiment of the present invention, the nucleic acid molecule is a single-stranded nucleotide sequence comprising an antisense nucleotide sequence, wherein the antisense nucleotide sequence is suitable for annealing to a nucleic acid molecule encoding SRSF1 through complementary base pairing.

[0143] In a preferred embodiment of the present invention, the single-stranded nucleic acid is DNA.

[0144] In a further preferred embodiment of the present invention, the single-stranded nucleic acid is DNA and / or RNA.

[0145] Preferably, the DNA and / or RNA is a therapeutic antisense oligonucleotide, such as an antisense oligonucleotide, a splice-switching oligonucleotide, a gapmer or the like.

[0146] Preferably, the DNA is an antisense oligonucleotide.

[0147] In a preferred embodiment of the present invention, the nucleic acid molecule encoding human SRSF1 is set forth in SEQ ID NO:67.

[0148] In a preferred embodiment of the invention, the antagonist comprises a nucleic acid molecule of at least 15 nucleotides in length.

[0149] In a preferred embodiment of the present invention, the antagonist comprises a nucleic acid molecule comprising the nucleotide sequence set forth in SEQ ID NO: 67, wherein the nucleic acid molecule is a double-stranded inhibitory RNA having a length of 19-23 nucleotides.

[0150] In a preferred embodiment of the invention, the antagonist comprises a nucleic acid molecule comprising modified nucleotides.

[0151] In a preferred embodiment of the present invention, the double-stranded nucleic acid molecules comprising the sense nucleic acid molecule and the antisense nucleic acid molecule comprise modified nucleotides.

[0152] In a preferred embodiment of the present invention, the modified nucleotide / sugar is selected from the following group: 3'-terminal deoxy-thymine (dT) nucleotides, 2'-0-methyl modified nucleotides, 2'-fluorine modified nucleotides, 2'-deoxy modified nucleotides, locked nucleotides, unlocked nucleotides, conformationally restricted nucleotides, constrained ethyl nucleotides, basic nucleotides, nucleotides), 2'-amino modified nucleotides, 2'-0-allyl modified nucleotides, 2'-C-alkyl modified nucleotides, 2'-hydroxy modified nucleotides, 2'-methoxyethyl modified nucleotides, 2'-0-alkyl modified nucleotides, morpholino nucleotides, phosphoramidates, nucleotides containing non-natural bases, tetrahydropyran modified nucleotides, 1,5-anhydrohexitol modified nucleotides, cyclohexenyl modified nucleotides, nucleotides containing thiophosphate groups, nucleotides containing dithiophosphates (PS2), nucleotides containing methylphosphonate groups, nucleotides containing 5'-phosphates, and nucleotides containing 5'-phosphate mimetics (e.g., 5'-vinyl phosphate), nucleotides containing 2'-deoxy-2'-fluoro and 2' methyl sugar groups.

[0153] In a preferred embodiment of the present invention, the double-stranded nucleic acid molecules comprising the sense nucleic acid molecule and the antisense nucleic acid molecule comprise a modified sugar.

[0154] In a preferred embodiment of the present invention, the modified sugar is selected from the following group: a modified version of the ribosyl moiety, such as an -O-modified RNA, such as 2'-O-alkyl or 2'-O-(substituted)alkyl, such as 2'-O-methyl, T-O-(2-cyanoethyl), 2'-O-(2-methoxy)ethyl (2'-MOE), 2'-O-(2-thiomethyl)ethyl, 2'-O-butyryl, -O-propargyl, 2'-O-allyl, 2'-O-(2-amino)propyl, 2'-O-(2-(dimethylamino)propyl), 2'-O-(2-amino)ethyl, 2'-O-(2-(dimethylamino)ethyl); 2'-deoxy (DNA); 2'-O-(haloalkoxy)methyl, such as 2' -0-(2-chloroethoxy)methyl (MCEM), -O-(2,2-dichloroethoxy)methyl (DCEM); 2'-<3-alkoxycarbonyl, such as T-0-[2-(methoxycarbonyl)ethyl] (MOCE), 2'-O-[2-(N-methylcarbamoyl)ethyl] (MCE), T-0-[2-(N,N-dimethylcarbamoyl)ethyl] (DCME); 2'-halogenated, such as 2'-F, FANA (2'-F arabinosyl nucleic acid); carbasugar and azasugar modifications; 3'-O-alkyl, such as 3'-0-methyl, 3'-0-butyryl, VO-propargyl and their derivatives.

[0155] In a preferred embodiment of the present invention, the antagonist comprises or consists of a nucleotide sequence designed according to a target nucleic acid sequence selected from the following group:

[0156] TGGCACTGGTGTCGTGGAGTTTGTA(SEQ ID NO 110);

[0157] TGGTGTCGTGGAGTTTGTACGGAAA (SEQ ID NO 111);

[0158] TCGTGGAGTTTGTACGGAAAGAAGA (SEQ ID NO 112);

[0159] AAGATATGACCTATGCAGTTCGAAA(SEQ ID NO 113);

[0160] GAGAAACTGCCTACATCCGGGTTAA(SEQ ID NO 114);

[0161] CGGGTTAAAGTTGATGGGCCCAGAA (SEQ ID NO 115);

[0162] TGATGGGCCCAGAAGTCCAAGTTAT(SEQ ID NO 116);

[0163] CAGAAGTCCAAGTTATGGAAGATCT (SEQ ID NO 117);

[0164] GAGAAGCAGAGGATCACCACGCTAT (SEQ ID NO 118); and

[0165] CGTCATAGCAGATCTCGCTCTCGTA (SEQ ID NO 119).

[0166] In a preferred embodiment of the present invention, the antagonist comprises a nucleic acid molecule comprising a nucleotide sequence, wherein the nucleic acid molecule is a double-stranded inhibitory RNA having a length of 19-23 nucleotides.

[0167] According to another aspect of the present invention, there is provided a pharmaceutical composition comprising an antagonist according to the present invention and including an excipient or carrier.

[0168] According to another aspect of the present invention there is provided an antagonist according to the present invention for use as a medicament.

[0169] According to another aspect of the present invention, there is provided an antagonist of the present invention for use in treating a neurodegenerative disease.

[0170] In a preferred embodiment of the invention, the neurodegenerative disease is amyotrophic lateral sclerosis (ALS).

[0171] In a preferred embodiment of the invention, the neurodegenerative disease is sporadic and / or familial amyotrophic lateral sclerosis.

[0172] In a preferred embodiment of the present invention, the neurodegenerative disease is ALS not caused by pathological C9ORF72-repeat sequence expansion.

[0173] In an alternative preferred embodiment of the present invention, said neurodegenerative disease is sporadic frontotemporal dementia (FTD).

[0174] In an alternative preferred embodiment of the present invention, the neurodegenerative disease is Fragile X-associated tremor / ataxia syndrome (FXTAS).

[0175] Throughout the description and claims of this specification, the words "comprising" and "containing" and variations of these two words, such as "comprising" and "comprises", mean "including but not limited to", and are not intended to (and do not) exclude other parts, additives, ingredients, entities (integers) or steps. "Substantially composed of..." means having these basic entities, but also including entities that have no substantial effect on the functions of these basic entities.

[0176] Throughout the description and claims of this specification, unless the context otherwise requires, the singular encompasses the plural. In particular, where the indefinite article is used, the specification should be understood to include both the plural and the singular unless the context otherwise requires.

[0177] Features, entities, characteristics, compounds, chemical moieties or groups described in conjunction with one aspect, embodiment or example of the invention are to be understood to be applicable to any other aspect, embodiment or example described herein unless incompatible therewith.

[0178] Embodiments of the present invention will now be described by way of example only and with reference to the following drawings:

[0179] Figure 1 Differentiation and co-culture timeline of motor neurons and astrocytes from healthy controls and sporadic ALS (sALS) patients;

[0180] Figure 2 .Images show that MNs treated with lentivirus expressing SRSF1-miRNA retain neuron-specific processes / axons, whereas MNs treated with LV_Ctrl-miRNA degenerate and die;

[0181] Figure 3 The bar graph shows the MN survival rate expressed as the ratio (%) of MN quantified on day 3 to MN quantified on day 1. Two-way ANOVA and Tukey's multiple comparison test; NS: not significant; **: p<0.01; ***: p<0.001; ****: p<0.0001;

[0182] Figure 4 .Western immunoblotting showed that all three shRNAs resulted in efficient depletion of SRSF1 and inhibition of RAN translation of the V5-tagged DPR;

[0183] Figure 5.Bar graphs represent mean ± SEM (two-way ANOVA and Tukey's multiple comparison test; NS: not significant; ****: p < 0.0001; n = 3 biological replicates). Quantification of 3 independent triplicate experiments;

[0184] Figure 6 C9ORF72-ALS / FTD mice were injected with 8x 10 10 scAAV9_Ctrl-shRNA_GFP vector genomes (vg) or 6x 10 10 scAAV9_SRSF1-shRNA10_GFP vg. Animals were sacrificed 1 and 3 months after injection. Western blot showed that scAAV9_SRSF1-shRNA10_GFP virus caused specific depletion of SRSF1 in C9ORF72-ALS / FTD mice and wild-type C57BL / 6 mice (not shown), while Ctrl-shRNA had no effect. GAPDH was used as a loading control;

[0185] Figure 7 : Map of scAAV_SRSF1 132-144CPP_GFP (SEQ ID NOs 1 and 101);

[0186] Figure 8 : Map of scAAV_SRSF1 89-120CPP_GFP (SEQ ID NOs 74 and 102);

[0187] Fig. 9 :(A) Western blot shows depletion of SRSF1 and inhibition of RAN translation of sense DPRs after co-transfection with scAAV SRSF1-shRNA10_GFP, H1-CPP1_GFP, and H1-CPP2_GFP, but not when CPP transcription is driven by the RNAPII promoter. Expression levels of SRSF1 and DPRs in three biological replicates are quantified in panels B and C, respectively. (D) MTT cell proliferation assays in three biological replicates show that scAAV SRSF1-shRNA10_GFP, H1-CPP1_GFP, and H1-CPP2_GFP can alleviate cytotoxicity mediated by DPR expression, but not when CPP transcription is driven by the RNAPII promoter;

[0188] Fig.10:(A) Western blot shows depletion of SRSF1 and inhibition of RAN translation of antisense DPRs after co-transfection with scAAV SRSF1-shRNA10_GFP, H1-CPP1_GFP, and H1-CPP2_GFP, but not when CPP transcription is driven by the RNAPII promoter. Expression levels of SRSF1 and DPRs in three biological replicates are quantified in panels B and C, respectively. (D) MTT cell proliferation assays in three biological replicates show that scAAV SRSF1-shRNA10_GFP, H1-CPP1_GFP, and H1-CPP2_GFP can alleviate cytotoxicity mediated by DPR expression, but not when CPP transcription is driven by the RNAPII promoter;

[0189] Fig.11 .map of scAAV_SRSF1-shRNA10_GFP (SEQ ID NOs 66 and 103);

[0190] Fig.12 Quantification of DPR in mouse brain. C9ORF72-ALS / FTD (C9-Tg) mice were injected intrathecally (transcisternally) with 6x10 10 scAVV9_Ctrl-shRNA_GFP vector genome (vg) or two doses of scAAV9_SRSF1-shRNA10_GFP (4x10 10 and 8x10 10 vg) of the vector genome (vg). Non-transgenic (NTg) mice were used as controls. One month (A) or three months (B) after injection, the animals were sacrificed and the poly-GP (poly-GP) DPR in the cerebellum / brainstem was quantified by MSD-ELISA (mean ± SEM; one-way ANOVA with Tukey correction for multiple comparisons; NS: not significant, **: p < 0.01, ****: p < 0.0001; n = 4-6 mice / group). The poly-GP DPR was quantified according to the standard curve established with the GPx7 peptide and normalized to the level of untreated C9-Tg mice as 100%;

[0191] Fig.13 Viral transduction in mouse brain. C9ORF72-ALS / FTD mice were injected intrathecally (transcisternally) with 5x10 10Vector genomes (vg) of scAAV9_H1-SRSF1-CPP1_GFP or scAAV9_H1-CPP2_GFP were injected into the cerebrum for immunohistochemical analysis. One month after injection, the animals were sacrificed and anti-GFP immunofluorescence microscopy was performed on the brain. Representative images are shown on midbrain sections. GFP co-expression is shown in the green channel. DAPI (blue channel) and NeuN (red channel) stain nuclei and mature neurons, respectively. Side panels: Enlarged immunofluorescence images showing transduction and scAAV9-mediated GFP co-expression in neurons and microglial cells. Scale bars represent 500 μm; and

[0192] Fig.14 Virus biodistribution and DPR quantification in mouse brain. C9ORF72-ALS / FTD (C9-Tg) mice were injected intrathecally (transcisternally) with 5x10 10 Vector genomes (vg) of scAAV9_H1-SRSF1-CPP1_GFP or scAAV9_H1-CPP2_GFP. Non-transgenic (NTg) mice served as controls. One month after injection, animals were sacrificed. (A) qPCR quantification of viral DNA extracted from the brain (cerebellum) and spinal cord (n=3), showing efficient transduction. (B) MSD-ELISA quantification of poly-GP DPR in the cerebellum / brainstem (mean ± SEM; one-way ANOVA, multiple comparisons were corrected by Tukey; **: p<0.01, ****: p<0.0001; N=3 mice / group). Poly-GPDPR was quantified according to a standard curve established with GPx7 peptide and normalized to the level of untreated C9-Tg mice as 100%.

[0193] Materials and Methods

[0194] Part 1: SRSF1 depletion promotes the survival of motor neurons derived from sALS patients co-cultured with astrocytes

[0195] 1 / Differentiation and co-culture timeline of motor neurons and astrocytes from healthy controls and sporadic ALS (sALS) patients:

[0196] summary: iMotor Neuron (iMN) and iAstrocyte (iAstrocyte) were treated with 5 MOI (multiplicity of infection) of lentivirus (LV) expressing Ctrl-miRNA or 2-chained miRNA against SRSF1 (constructs described in Hautbergue et al, Nature Communications 2017; 8: 16063 and our patent WO2017207979A1) on day 18 and day 3 of differentiation, respectively, and then co-culture was established from day 20 (iMN) / day 5 (iA). The survival of iMNs was quantified by high content automated live imaging on days 22, 23 and 24. Unlike the lentivirus used in this system, scAAV9 cannot effectively transduce cells in vitro.

[0197] Detailed protocol: Co-culture of patient-derived astrocytes and motor neurons

[0198] Differentiation of iMotor Neuron (iMN). Neurons (iNeurons) derived from human patients and controls were differentiated from induced neural progenitor cells (iNPCs) using a modified version of the protocol (Meyer K et al. Proc. Natl. Acad. Sci. USA 2014; 111: 829–832) described previously (Hautbergue GM et al, Nature Communications 2017; 8: 16063). Briefly, 100,000 iNPCs were placed in 6-well plates coated with fibronectin (Millipore) and expanded to 70-80% confluence. Once they reached this confluence, the iNPC culture medium was changed to neuronal differentiation medium (DMEM / F-12 with glutamax, supplemented with 1% N2, 2% B27 (Gibco), containing 2.5 μM DAPT (Tocris)) to determine differentiation into the neuronal lineage on day 1. On day 3, neuronal differentiation medium was supplemented with 1 μM retinoic acid (Sigma), 0.5 μM smoothened agonist (SAG) (Millipore), and 2.5 μM forskolin (Sigma) for 7 days until day 10. This protocol typically yields 70% β-III tubulin (Tuj1) positive cells. To obtain iMotor Neurons (iMNs), approximately 5,000 iNeurons per well were re-plated on fibronectin-coated 96-well plates and maintained in iNeuron differentiation medium (containing retinoic acid, SAG, and forskolin) supplemented with BDNF, CNTF, and GDNF (all at 20 ng / ml) for the final 14 days of differentiation.

[0199] Differentiation of iAstrocytes. Astrocytes (iAstrocytes) derived from human patients were differentiated from iNPCs as previously described (MeyerK et al. Proc. Natl. Acad. Sci. USA 2014; 111: 829–832; Hautbergue GM et al, Nature Communications 2017; 8: 16063) and cultured for 5 days in DMEM glutamax (Gibco) containing 10% FBS (Sigma) and 0.02% N2 (Invitrogen). Cells were maintained in a 37°C incubator with 5% CO2.

[0200] Co-culture of patient-derived iMNs and iAstrocytes. iAstrocytes were removed on day 5 of differentiation, and approximately 5,000 iAstrocytes were re-seeded on iMNs on day 20 of differentiation. Co-cultured iMNs and iAstrocytes were maintained for 4 days in a neuronal differentiation medium containing BDNF, GDNF, and CTNF (all 20 ng / ml). 12 hours after the start of co-culture (on day 21), 1 or 10 μM CPP was added to the culture medium, and iMN / iAstrocytes were imaged for 72 hours on days 22, 23, and 24. In order to knock down SRSF1, on day 18 of iMN differentiation and day 3 of iAstrocyte differentiation, iMNs and iAstrocytes were transduced with lentivirus (LV) (Hautbergue GM et al, Nature Communications 2017; 8: 16063) expressing control or SRSF1-RNAi co-expressing GFP at 5 MOI 48 hours before co-culture.

[0201] Part II: scAAV9 drives the expression of SRSF1-shRNA

[0202] Preclinical vector design: scAAV_SRSF1-shRNA_GFP

[0203] 1 / SRSF1-shRNA cassette targeting mouse, rat, non-human primate, and human SRSF1

[0204] The region 448-750 (3' end of the open reading frame) of human SRSF1, which is highly conserved with mouse SRSF1, was selected.

[0205] Human SRSF1 (NM_006924.4) SEQ ID NO 67

[0206] gctgatgtttaccgagatggcactggtgtcgtggagtttgtacggaaagaagatatgacctatgcagttcgaaaactggataacactaagtttagatctcatgagggagaaactgcctacatccggg ttaaagttgatgggccc agaa gtccaagttatggaagatctcgatctcgaagccgtagtcgtagcagaagccgtagcagaagcaacagcaggagtcgcagttatccccaaggagaagcagaggatcaccacgctattctccccgtcatagcagatctcgctctcgtacataa

[0207] Lentiviral constructs ttaaagttgatgggcccagaa miRNA (SEQ ID NO 87) is used to target human and mouse SRSF1 (Hautbergue et al. Nature Communications 2017; 8: 16063 and in our patent WO2017207979A1)

[0208] Design shRNA using the following website:

[0209] Block-iT RNAi Designer Tool: http: / / rnaidesigner.lifetechnologies.com / rnaiexpress /

[0210] Table 1: SEQ ID NO 2-11

[0211]

[0212]

[0213] Table 2: Prediction of off-targets of common human / mouse sequences targeting SRSF1 using siSPOTR (Boudreau RL et al. Nucleic Acids Res. 2013; 41(1):e9) and the most effective sequences predicted

[0214]

[0215] SRSF1 target shRNA6 sequence: 5'-GGGCCCAGAAGTCCAAGTTAT-3' (SEQ ID NO 7)

[0216] Antisense / mature shRNA6 sequence: 5'-AUAACUUGGACUUCUGGGCCC-3' (SEQ ID NO 82) SRSF1 target shRNA9 sequence: 5'-GGAAGATCTCGATCTCGAAGC-3' (SEQ ID NO 10)

[0217] Antisense / mature shRNA9 sequence: 5'-GCUUCGAGAUCGAGAUCUUCC-3' (SEQ ID NO 85) SRSF1 target shRNA10 sequence: 5'-GCAGAGGATCACCACGCTATT-3' (SEQ ID NO 11) Antisense / mature shRNA10 sequence: 5'-AAUAGCGUGGUGAUCCUCUGC-3' (SEQ ID NO 86)

[0218] 2 / Comparison of human (NM_006924.4; SEQ ID NO 104) and mouse (NM_173374.4; SEQ ID NO 105) SRSF1

[0219] On the aligned human and mouse SRSF1 open reading frames, sequences corresponding to shRNAs 7, 10, and 11 (with the highest predicted efficiency and the least predicted off-target effects) are highlighted.

[0220]

[0221]

[0222] 3 / Clone the shRNA targeting SRSF1 into the scAAV_GFP vector

[0223] We then designed and custom synthesized the following oligonucleotides for cloning shRNA7, 10, and 11 into the scAAV_H1 promoter_GFP vector (SEQ ID NOs 68-73):

[0224] Cut BamHI / cut HindIII Red sequence corresponds to the targeted region of SRSF1 Blue sequence corresponds to antisense / mature shRNA Black sequence corresponds to the hairpin loop SRSF1 shRNA_6_fwd (SEQ ID NO 68)

[0225]

[0226] SRSF1 shRNA_6_rev(SEQ ID NO 69):

[0227]

[0228] SRSF1 shRNA_9_fwd(SEQ ID NO 70):

[0229]

[0230] SRSF1 shRNA_9_rev(SEQ ID NO 71):

[0231]

[0232] SRSF1 shRNA_10_fwd(SEQ ID NO 72):

[0233]

[0234] SRSF1 shRNA_10_rev(SEQ ID NO 73):

[0235]

[0236] 5 / Full sequence of a preclinical scAAV vector co-expressing the SRSF1-shRNA cassette (under the control of the constitutively expressed RNAPIII H1 promoter) and eGFP (under the control of the weak RNAPII eF-1α core promoter to avoid potential GFP-induced toxicity)

[0237] scAAV_SRSF1-shRNA10_GFP circular sequence (5,648 bp) SEQ ID NO 66

[0238] 5'...

[0239] GCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAA

[0240] AGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAA

[0241] GGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAA

[0242] ATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCC

[0243] CTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGC

[0244] TTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAAC

[0245] CCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTAT

[0246] CGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAG

[0247] TGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGA

[0248] AAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCA

[0249] GATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACG

[0250] AAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAAT

[0251] GAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCAC

[0252] CTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGG

[0253] AGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCA

[0254] ATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAA

[0255] TTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCAT

[0256] CGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATC

[0257] CCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTT

[0258] ATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGT

[0259] GAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGA

[0260] TAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAA

[0261] GGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTT

[0262] CACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAA

[0263] ATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATAC

[0264] ATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGT

[0265] CTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTCGCGCGTTT

[0266] CGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCG

[0267] GGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCA

[0268] GAGCAGATTGTACTGAGAGTGCACCATAGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCA

[0269] GATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGG

[0270] CGATTCCAACATCCAATAAATCATACAGGCAAGGCAAAGAATTAGCAAATTAAGCAATAAAGCCTCAGAGCA

[0271] TAAAGCTAAATCGGTTGTACCAAAAACATTATGACCCTGTAATACTTTTGCGGGAAGCCTTTATTTCAACGCA

[0272] AGGATAAAAATTTTTAGAACCCTCATATATTTTAAATGCAATGCCTGAGTAATGTGTAGGTAAAGATTCAAACG

[0273] GGTGAGAAAGGCCGGAGACAGTCAAATCACCATCAATATGATATTCAACCGTTCTAGCTGATAAATTCATGCCG

[0274] GAGAGGGGTAGCTATTTTTGAGAGGTCTTCTACAAAGGCTATCAGGTCATTGCCTGAGAGTCTGGAGCAAACAAGA

[0275] GAATCGCCGGGGGGGGGGGGGGGGGGGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGC

[0276] AAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCC

[0277] AACTCCATCACTAGGGGTTCCTCAGATCGATCTCTCCCCAGCATGCAGGCCTCTGCAGTCGACGGGCCCGGCATG

[0278] CGTTTTACTCCCCAGCATGCCTGCTATTCTCTTCCCAATCCTCCCCCTTGCTGTCCTGCCCCACCCCACCCCCCAG

[0279] AATAGAATGACACCTACTCAGACAATGCGATGCAATTTCCTCATTTTATTAGGAAAGGACAGTGGGAGTGGCAC

[0280] CTTCCAGGGTCAAGGAAGGCACGGGGGAGGGGCAAACAACAGATGGCTGGCAACTAGAAGGCACAGTCGAGG

[0281] CTGATCAGCGAGCTCTAGGAATTTTACTTGTACAGCTCGTCCATGCCGAGAGTGATCCCGGCGGCGGTCACGAA

[0282] CTCCAGCAGGACCATGTGATCGCGCTTCTCGTTGGGGTCTTTGCTCAGGGCGGACTGGGTGCTCAGGTAGTGGTT

[0283] GTCGGGCAGCAGCACGGGGCCGTCGCCGATGGGGGTGTTCTGCTGGTAGTGGTCGGCGAGCTGCACGCTGCCGT

[0284] CCTCGATGTTGTGGCGGATCTTGAAGTTCACCTTGATGCCGTTCTTCTGCTTGTCGGCCATGATATAGACGTTGTG

[0285] GCTGTTGTAGTTGTACTCCAGCTTGTGCCCCAGGATGTTGCCGTCCTCCTTGAAGTCGATGCCCTTCAGCTCGATG

[0286] CGGTTCACCAGGGTGTCGCCCTCGAACTTCACCTCGGCGCGGGTCTTGTAGTTGCCGTCGTCCTTGAAGAAGATG

[0287] GTGCGCTCCTGGACGTAGCCTTCGGGCATGGCGGACTTGAAGAAGTCGTGCTGCTTCATGTGGTCGGGGTAGCG

[0288] GCTGAAGCACTGCACGCCGTAGGTCAGGGTGGTCACGAGGGTGGGCCAGGGCACGGGCAGCTTGCCGGTGGTG

[0289] CAGATGAACTTCAGGGTCAGCTTGCCGTAGGTGGCATCGCCCTCGCCCTCGCCGGACACGCTGAACTTGTGGCC

[0290] GTTTACGTCGCCGTCCAGCTCGACCAGGATGGGCACCACCCCGGTGAACAGCTCCTCGCCCTTGCTCACCATGCC

[0291] TGTGTTCTGGCGGCAAACCCGTTGCGAAAAAGAACGTTCACGGCGACTACTGCACTTATATACGGTTCTCCCCCA

[0292] CCCTCGGGAAAAAGGCGGAGCCAGTACACGACATCACTTTCCCAGTTTACCCCGCGCCACCTTCTCTAGGCACC

[0293] GGATCAATTGCCGACCCCTCCCCCCAACTTCTCGGGGACTGTGGGCGATGTGCGCTCTGCCCACTGAATCTTCTC

[0294] GAGCCTCTAGATACCACAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAG

[0295] CTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAA

[0296] AACGACGGCCAGTGAATTCATATTTGCATGTCGCTATGTGTTCTGGGAAATCACCATAAACGTGAAATGTCTTTG

[0297] GATTTGGGAATCTTATAAGTTCTGTATGAGACCACTCGGATCCGCAGAGGATCACCACGCTATTTTCAAGAGAA

[0298] ATAGCGTGGTGATCCTCTGCCTTTTTTGGAAAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGT

[0299] TATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTATCTAGAGCGGTACCACGCGTGAATT

[0300] GAATTCAGATCCACGCGTGAATTCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGT

[0301] CGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGGGCGATGAACGGTAATCGT

[0302] AAAACTAGCATGTCAATCATATGTACCCCGGTTGATAATCAGAAAAGCCCCAAAAACAGGAAGATTGTATAAGC

[0303] AAATATTTAAATTGTAAGCGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTTAAC

[0304] CAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGACCGAGATAGGGTTGAGTGTTGTTCCAGT

[0305] TTGGAACAAGAGTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGAT

[0306] GGCCCACTACGTGAACCATCACCCTAATCAAGTTTTTTGGGGTCGAGGTGCCGTAAAGCACTAAATCGGAACCC

[0307] TAAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGGCGAACGTGGCGAGAAAGGAAGGGAAGAAAGC

[0308] GAAAGGAGCGGGCGCTAGGGCGCTGGCAAGTGTAGCGGTCACGCTGCGCGTAACCACCACACCCGCCGCGCTT

[0309] AATGCGCCGCTACAGGGCGCGTACTATGGTTGCTTTGACGAGCACGTATAACGTGCTTTCCTCGTTAGAATCAGA

[0310] GCGGGAGCTAAACAGGAGGCCGATTAAAGGGATTTTAGACAGGAACGGTACGCCAGAATCCTGAGAAGTGTTT

[0311] TTATAATCAGTGAGGCCACCGAGTAAAAGAGTCTGTCCATCACGCAAATTAACCGTTGTCGCAATACTTCTTTGA

[0312] TTAGTAATAACATCACTTGCCTGAGTAGAAGAACTCAAACTATCGGCCTTGCTGGTAATATCCAGAACAATATTA

[0313] CCGCCAGCCATTGCAACGGAATCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGC...3'

[0314] Function of 6 / scAAV9-driven SRSF1-shRNA10 expression in mouse brain.

[0315] C9ORF72-ALS / FTD mice were injected with 8x 10 10 scAAV9_Ctrl-shRNA_GFP vector genomes (vg) or 6x 10 10 scAAV9_SRSF1-shRNA10_GFP vg. Animals were sacrificed 1 and 3 months after injection. Western blot showed that scAAV9_SRSF1-shRNA10_GFP virus led to specific depletion of SRSF1 in C9ORF72-ALS / FTD mice and wild-type C57Bl6 mice (not shown), while Ctrl-shRNA had no effect. GAPDH was used as a loading control.

[0316] 4 / ITR sequence

[0317] SEQ ID NO 64:

[0318] ITR1:5'-ccactccctctctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccggcctcagt gagcgagcgagcgcgcagagaggggagtggccaactccatcactaggggttcct-3'

[0319] SEQ ID NO 88:

[0320] ITR2:5'-ccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagt gagcgagcgagcgcgcag-3'

[0321] Cell permeable peptide sequence

[0322] SRSF1 132-144CPP nucleotide sequence:

[0323] 5'-GGCAGCTGGCAGGATCTGAAAGATCATATGCGCGAAGCCGGCGGTGGGAAACCGATTCCCAACCCGCTGCTGGGCCTCGATAGCACCGGCGGATATGGTCGCAAAAAGCGCAGACAGCGCCGGAGG

[0324] -3' (SEQ ID NO 89)

[0325] SRSF1 132-144CPP sequence, corresponding to SRSF1 amino acids 132-144, V5 tag and protein transduction domain TAT amino acids 47-57: Nt-GSWQDLKDHMREAGGGKPIPNPLLGLDSTGGYGRKKRRQRRR–Ct (SEQ ID NO 90)

[0326] 5 / scAAV_SRSF1 89-120CPP_GFP loop sequence (5,692 bp) (SEQ ID NO 74)

[0327] 5'...

[0328] GCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAA

[0329] AGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAA

[0330] GGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAA

[0331] ATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCC

[0332] CTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGC

[0333] TTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAAC

[0334] CCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTAT

[0335] CGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAG

[0336] TGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGA

[0337] AAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCA

[0338] GATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACG

[0339] AAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAAT

[0340] GAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCAC

[0341] CTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGG

[0342] AGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCA

[0343] ATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAA

[0344] TTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCAT

[0345] CGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATC

[0346] CCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTT

[0347] ATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGT

[0348] GAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGA

[0349] TAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAA

[0350] GGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTT

[0351] CACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAA

[0352] ATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATAC

[0353] ATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGT

[0354] CTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTCGCGCGTTT

[0355] CGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCG

[0356] GGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCA

[0357] GAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCA

[0358] TCAGGCGATTCCAACATCCAATAAATCATACAGGCAAGGCAAAGAATTAGCAAAATTAAGCAATAAAGCCTCA

[0359] GAGCATAAAGCTAAATCGGTTGTACCAAAAACATTATGACCCTGTAATACTTTTGCGGGAGAAGCCTTTATTTCA

[0360] ACGCAAGGATAAAAATTTTTAGAACCCTCATATATTTTAAATGCAATGCCTGAGTAATGTGTAGGTAAAGATTC

[0361] AAACGGGTGAGAAAGGCCGGAGACAGTCAAATCACCATCAATATGATATTCAACCGTTCTAGCTGATAAATTCA

[0362] TGCCGGAGAGGGTAGCTATTTTGAGAGGTCTCTACAAAGGCTATCAGGTCATTGCCTGAGAGTCTGGAGCAAA

[0363] CAAGAGAATCGCCGGGGGGGGGGGGGGGGGGGGGGGGCCACTCCCTCTCGCGCTCGTCGCTCACTGAGGCCGCCC

[0364] GGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGT

[0365] GGCCAACTCCATCACTAGGGGTTCCTCAGATCGATCTCTCCCCAGCATGCGTTTTACCTCCCCAGCATGCCTGCT

[0366] ATTCTCTTCCCAATCTCCCCCCTTGCTGTCCTGCCCCACCCCCACCCCCCAGAATAGAATGACACCTACTCAGACA

[0367] ATGCGATGCAATTTCCTCATTTTATTAGGAAAGGACAGTGGGAGTGGCACCTTCCAGGGTCAAGGAAGGCACGG

[0368] GGGAGGGGCAAACAACAGATGGCTGGCAACTAGAAGGCACAGTCGAGGCTGATCAGCGAGCTCTAGGAATTTT

[0369] ACTTGTACAGCTCGTCCATGCCGAGAGTGATCCCGGCGGCGGTCACGAACTCCAGCAGGACCATGTGATCGCGC

[0370] TTCTCGTTGGGGTCTTTGCTCAGGGCGGACTGGGTGCTCAGGTAGTGGTTGTCGGGCAGCAGCACGGGGCCGTC

[0371] GCCGATGGGGGTGTTCTGCTGGTAGTGGTCGGCGAGCTGCACGCTGCCGTCCTCGATGTTGTGGCGGATCTTGAA

[0372] GTTCACCTTGATGCCGTTCTTCTGCTTGTCGGCCATGATATAGACGTTGTGGCTGTTGTAGTTGTACTCCAGCTTG

[0373] TGCCCCAGGATGTTGCCGTCCTCCTTGAAGTCGATGCCCTTCAGCTCGATGCGGTTCACCAGGGTGTCGCCCTCG

[0374] AACTTCACCTCGGCGCGGGTCTTGTAGTTGCCGTCGTCCTTGAAGAAGATGGTGCGCTCCTGGACGTAGCCTTCG

[0375] GGCATGGCGGACTTGAAGAAGTCGTGCTGCTTCATGTGGTCGGGGTAGCGGCTGAAGCACTGCACGCCGTAGGT

[0376] CAGGGTGGTCACGAGGGTGGGCCAGGGCACGGGCAGCTTGCCGGTGGTGCAGATGAACTTCAGGGTCAGCTTG

[0377] CCGTAGGTGGCATCGCCCTCGCCCTCGCCGGACACGCTGAACTTGTGGCCGTTTACGTCGCCGTCCAGCTCGACC

[0378] AGGATGGGCACCACCCCGGTGAACAGCTCCTCGCCCTTGCTCACCATGCCTGTGTTCTGGCGGCAAACCCGTTGC

[0379] GAAAAAGAACGTTCACGGCGACTACTGCACTTATATACGGTTCTCCCCCACCCTCGGGAAAAAGGCGGAGCCAG

[0380] TACACGACATCACTTTCCCAGTTTACCCCGCGCCACCTTCTCTAGGCACCGGATCAATTGCCGACCCCTCCCCCC

[0381] AACTTCTCGGGGACTGTGGGCGATGTGCGCTCTGCCCACTGAATCTTCTCGAGCCTCTAGATACCACAGGCTGCG

[0382] CAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAA

[0383] GGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTCATATTT

[0384] GCATGTCGCTATGTGTTCTGGGAAATCACCATAAACGTGAAATGTCTTTGGATTTGGGAATCTTATAAGTTCTGT

[0385] ATGAGACCACTCGGATCCGAAGCCACCATGCCGCGCAGCGGCCGCGGCACCGGCCGCGGTGGGGGCGGCGGTG

[0386] GAGGTGGCGGAGCCCCGAGAGGCCGCTATGGACCGCCCAGCCGCCGGAGCGAAGGCGGTGGGAAACCGATTCC

[0387] CAACCCGCTGCTGGGCCTCGATAGCACCGGCGGATATGGTCGCAAAAAGCGCAGACAGCGCCGGAGGTAATTTT

[0388] TTAAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATA

[0389] CGAGCCGGAAGCATAAAGTGTATCTAGAGCGGTACCACGCGTGAATTGAATTCAGATCCACGCGTGAATTCCAC

[0390] TCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGG

[0391] CGGCCTCAGTGAGCGAGCGAGCGCGCAGGGCGATGAACGGTAATCGTAAAACTAGCATGTCAATCATATGTACC

[0392] CCGGTTGATAATCAGAAAAGCCCCAAAAACAGGAAGATTGTATAAGCAAATATTTAAATTGTAAGCGTTAATAT

[0393] TTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTTAACCAATAGGCCGAAATCGGCAAAATCCCT

[0394] TATAAATCAAAAGAATAGACCGAGATAGGGTTGAGTGTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAA

[0395] CGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTACGTGAACCATCACCCTAAT

[0396] CAAGTTTTTTGGGGTCGAGGTGCCGTAAAGCACTAAATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGCTTGA

[0397] CGGGGAAAGCCGGCGAACGTGGCGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCA

[0398] AGTGTAGCGGTCACGCTGCGCGTAACCACCACACCCGCCGCGCTTAATGCGCCGCTACAGGGCGCGTACTATGG

[0399] TTGCTTTGACGAGCACGTATAACGTGCTTTCCTCGTTAGAATCAGAGCGGGAGCTAAACAGGAGGCCGATTAAA

[0400] GGGATTTTAGACAGGAACGGTACGCCAGAATCCTGAGAAGTGTTTTTATAATCAGTGAGGCCACCGAGTAAAAG

[0401] AGTCTGTCCATCACGCAAATTAACCGTTGTCGCAATACTTCTTTGATTAGTAATAACATCACTTGCCTGAGTAGA

[0402] AGAACTCAAACTATCGGCCTTGCTGGTAATATCCAGAACAATATTACCGCCAGCCATTGCAACGGAATCGCCAT

[0403] TCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGC-3’

[0404] Sequence of the 6 / 5 / scAAV_SRSF1 132-144CPP_GFP circular sequence (5,651 bp) (SEQ ID NO 1)

[0405] 5’...

[0406] GCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAA

[0407] AGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAA

[0408] GGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAA

[0409] ATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCC

[0410] CTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGC

[0411] TTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAAC

[0412] CCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTAT

[0413] CGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAG

[0414] TGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGA

[0415] AAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCA

[0416] GATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACG

[0417] AAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAAT

[0418] GAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCAC

[0419] CTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGG

[0420] AGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCA

[0421] ATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAA

[0422] TTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCAT

[0423] CGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATC

[0424] CCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTT

[0425] ATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGT

[0426] GAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGA

[0427] TAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAA

[0428] GGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTT

[0429] CACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAA

[0430] ATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATAC

[0431] ATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGT

[0432] CTAAGAAACCATTATTATCATGACATTAACCTATAAAAAATAGGCGTATCACGAGGCCCTTTCGTCTCGCGCGTTT

[0433] CGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCG

[0434] GGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCA

[0435] GAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCA

[0436] TCAGGCGATTCCAACATCCAATAAATCATACAGGCAAGGCAAAGAATTAGCAAAATTAAGCAAAAGCCTCA

[0437] GAGCATAAAGCTAAATCGGTTGTACCAAAAACATTATGACCCTGTAATACTTTTGCGGGAGAAGCCTTATTTCA

[0438] ACGCAAGGATAAAAATTTTTAGAACCCTCATATATTTTAAATGCAATGCCTGAGTAATGTGTAGGTAAAGATTC

[0439] AAACGGGTGAGAAAGGCCGGACAGTCAAATCACCATCAATATGATATTCAACCGTTCTAGCTGATAAATTCA

[0440] TGCCGGAGAGGGTAGCTATTTTTGAGAGGTCTCTACAAAGGCTATCAGGTCATTGCCTGAGAGTCTGGAGCAAA

[0441] CAAGAGAATCGCCGGGGGGGGGGGGGGGGGGGGGGGGCCACTCCCTCTCGCGCTCGTCGCTCACTGAGGCCGCCC

[0442] GGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGT

[0443] GGCCAACTCCATCACTAGGGGTTCCTCAGATCGATCTCTCCCCAGCATGCGTTTTACCTCCCCAGCATGCCTGCT

[0444] ATTCTCTTCCCAATCCTCCCCCTTGCTGTCCTGCCCCACCCCACCCCCCAGAATAGAATGACACCTACTCAGACA

[0445] ATGCGATGCAATTTCCTCATTTTATTAGGAAAGGACAGTGGGAGTGGCACCTTCCAGGGTCAAGGAAGGCACGG

[0446] GGGAGGGGCAAACAACAGATGGCTGGCAACTAGAAGGCACAGTCGAGGCTGATCAGCGAGCTCTAGGAATTTT

[0447] ACTTGTACAGCTCGTCCATGCCGAGAGTGATCCCGGCGGCGGTCACGAACTCCAGCAGGACCATGTGATCGCGC

[0448] TTCTCGTTGGGGTCTTTGCTCAGGGCGGACTGGGTGCTCAGGTAGTGGTTGTCGGGCAGCAGCACGGGGCCGTC

[0449] GCCGATGGGGGTGTTCTGCTGGTAGTGGTCGGCGAGCTGCACGCTGCCGTCCTCGATGTTGTGGCGGATCTTGAA

[0450] GTTCACCTTGATGCCGTTCTTCTGCTTGTCGGCCATGATATAGACGTTGTGGCTGTTGTAGTTGTACTCCAGCTTG

[0451] TGCCCCAGGATGTTGCCGTCCTCCTTGAAGTCGATGCCCTTCAGCTCGATGCGGTTCACCAGGGTGTCGCCCTCG

[0452] AACTTCACCTCGGCGCGGGTCTTGTAGTTGCCGTCGTCCTTGAAGAAGATGGTGCGCTCCTGGACGTAGCCTTCG

[0453] GGCATGGCGGACTTGAAGAAGTCGTGCTGCTTCATGTGGTCGGGGTAGCGGCTGAAGCACTGCACGCCGTAGGT

[0454] CAGGGTGGTCACGAGGGTGGGCCAGGGCACGGGCAGCTTGCCGGTGGTGCAGATGAACTTCAGGGTCAGCTTG

[0455] CCGTAGGTGGCATCGCCCTCGCCCTCGCCGGACACGCTGAACTTGTGGCCGTTTACGTCGCCGTCCAGCTCGACC

[0456] AGGATGGGCACCACCCCGGTGAACAGCTCCTCGCCCTTGCTCACCATGCCTGTGTTCTGGCGGCAAACCCGTTGC

[0457] GAAAAAGAACGTTCACGGCGACTACTGCACTTATATACGGTTCTCCCCCACCCTCGGGAAAAAGGCGGAGCCAG

[0458] TACACGACATCACTTTCCCAGTTTACCCCGCGCCACCTTCTCTAGGCACCGGATCAATTGCCGACCCCTCCCCCC

[0459] AACTTCTCGGGGACTGTGGGCGATGTGCGCTCTGCCCACTGAATCTTCTCGAGCCTCTAGATACCACAGGCTGCG

[0460] CAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAA

[0461] GGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTCATATTT

[0462] GCATGTCGCTATGTGTTCTGGGAAATCACCATAAACGTGAAATGTCTTTGGATTTGGGAATCTTATAAGTTCTGT

[0463] ATGAGACCACTCGGATCCGTTTAGTGAACCGTCAGAAGCCACCATGGGCAGCTGGCAGGATCTGAAAGATCATA

[0464] TGCGCGAAGCCGGCGGTGGGAAACCGATTCCCAACCCGCTGCTGGGCCTCGATAGCACCGGCGGATATGGTCGC

[0465] AAAAAGCGCAGACAGCGCCGGAGGTAATTTTTTAAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAA

[0466] ATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTATCTAGAGCGGTACCACGCGT

[0467] GAATTGAATTCAGATCCACGCGTGAATTCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCA

[0468] AAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGGGCGATGAACGGTA

[0469] ATCGTAAAACTAGCATGTCAATCATATGTACCCCGGTTGATAATCAGAAAAGCCCCAAAAACAGGAAGATTGTA

[0470] TAAGCAAATATTTAAATTGTAAGCGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTT

[0471] TTAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGACCGAGATAGGGTTGAGTGTTGTT

[0472] CCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGG

[0473] GCGATGGCCCACTACGTGAACCATCACCCTAATCAAGTTTTTTGGGGTCGAGGTGCCGTAAAGCACTAAATCGG

[0474] AACCCTAAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGGCGAACGTGGCGAGAAAGGAAGGGAAG

[0475] AAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCAAGTGTAGCGGTCACGCTGCGCGTAACCACCACACCCGCCG

[0476] CGCTTAATGCGCCGCTACAGGGCGCGTACTATGGTTGCTTTGACGAGCACGTATAACGTGCTTTCCTCGTTAGAA

[0477] TCAGAGCGGGAGCTAAACAGGAGGCCGATTAAAGGGATTTTAGACAGGAACGGTACGCCAGAATCCTGAGAAG

[0478] TGTTTTTATAATCAGTGAGGCCACCGAGTAAAAGAGTCTGTCCATCACGCAAATTAACCGTTGTCGCAATACTTC

[0479] TTTGATTAGTAATAACATCACTTGCCTGAGTAGAAGAACTCAAACTATCGGCCTTGCTGGTAATATCCAGAACAA

[0480] TATTACCGCCAGCCATTGCAACGGAATCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGT

[0481] GCGGGCCTCTTCGCTATTACGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGC-3'

[0482] Function of scAAV9-driven SRSF1-shRNA10 expression in mouse brain.

[0483] C9ORF72-ALS / FTD mice were injected with 8x 10 10 scAAV9_Ctrl-shRNA_GFP vector genomes (vg) or 6x 10 10 scAAV9_SRSF1-shRNA10_GFP vg. Animals were sacrificed 1 and 3 months after injection. Western blot showed that scAAV9_SRSF1-shRNA10_GFP virus led to specific depletion of SRSF1 in C9ORF72-ALS / FTD mice and wild-type C57Bl6 mice (not shown), while Ctrl-shRNA had no effect. GAPDH was used as a loading control.

[0484] Example 1

[0485] 2 / Example of iMN imaging on day 24

[0486] On days 1, 2, and 3 of imaging, surviving MNs were quantified using high-content automated imaging (Opera Phenix). Figure 2 ) showed that MNs treated with lentivirus expressing SRSF1-miRNA retained neuronal-specific processes / axons, whereas MNs treated with LV_Ctrl-RNAi generated and died.

[0487] 3 / iMN quantification

[0488] Co-culture of MNs from healthy controls and sALS patients with astrocytes showed that LV_SRSF1-RNAi specifically promoted the survival of sALS MNs, at levels comparable to those of SRSF1 depletion in MNs from C9ORF72-ALD patients (Hautbergue GM et al, Nature Communications 2017; 8: 16063; Castelli et al. bioRxiv 2021.05.23.445325v2). The bar graph shows the MN survival rate expressed as the ratio (%) of MNs quantified on day 3 to MNs quantified on day 1. Two-way ANOVA with Tukey's multiple comparison test; NS: not significant; **: p<0.01; ***: p<0.001; ****: p<0.0001( Figure 3 ).

[0489] Example 2

[0490] 4 / Testing the function of SRSF1-shRNA in human cells and mouse brain

[0491] scAAV plasmids co-expressing GFP and SRSF1 shRNA6, 9, or 10 were co-transfected with sense or antisense C9ORF72-repeat reporter constructs that express V5-tagged sense or antisense dipeptide-repeat protein (DPR) in all frames in a repeat-associated, non-AUG (RAN) translational manner. Western immunoblotting showed that all 3 shRNAs effectively depleted SRSF1 and inhibited RAN translation of V5-tagged DPR. SRSF1-shRNA10 was selected for virus production and further experiments in mice because of its lowest POTS score and predicted genome-wide off-target effects in mice and humans.

[0492] Example 3

[0493] scAAV SRSF1-shRNA, CPP1 and CPP2 inhibit sense DPR production and rescue DPR-associated cytotoxicity in a human cell model of C9ORF72-ALS / FTD. Human HEK293T cells were co-transfected with a sense G4C2x45 C9ORF72-repeat plasmid expressing a sense V5-tagged dipeptide-repeat protein (DPR) in a RAN translational manner and scAAV plasmids expressing SRSF1-shRNA10 or 2 different cell-permeable peptides (CPP1: SRSF1 aa89-120 CPP (SEQ ID NO 59) and CPP2: SRSF1 aa132-144 CPP (SEQ ID NO 75)). We tested potential expression under the control of the mammalian ubiquitous RNA polymerase II (CBh) or RNA polymerase III (H1) promoter. Fig. 9 (A) Western blots show depletion of SRSF1 and inhibition of RAN translation of sense DPRs after co-transfection with scAAV SRSF1-shRNA10_GFP, H1-CPP1_GFP, and H1-CPP2_GFP, but not when CPP transcription is driven by the RNAPII promoter. Expression levels of SRSF1 and DPRs were quantified in triplicate biological experiments in panels B and C, respectively (bar graphs show mean ± SEM; one-way ANOVA; NS: not significant; ****: p < 0.0001). (D) MTT cell proliferation assays in three biological replicates show that scAAV SRSF1-shRNA10_GFP, H1-CPP1_GFP, and H1-CPP2_GFP can alleviate cytotoxicity mediated by DPR expression, but not when CPP transcription is driven by the RNAPII promoter. Bar graphs show mean ± SEM; one-way ANOVA; NS: not significant, ****: P < 0.0001.

[0494] Example 4

[0495] scAAV SRSF1-shRNA, CPP1 and CPP2 inhibit antisense DPR production and rescue DPR-associated cytotoxicity in a human cell model of C9ORF72-ALS / FTD. Human HEK293T cells were co-transfected with an antisense G2C4x43 C9ORF72-repeat plasmid expressing an antisense V5-tagged dipeptide-repeat protein (DPR) in a RAN translational manner and scAAV plasmids expressing SRSF1-shRNA10 or 2 different cell permeable peptides (CPP1: SRSF1 aa89-120 CPP (SEQ ID NO 59) and CPP2: SRSF1 aa132-144 CPP (SEQ ID NO 75)). We tested potential expression under the control of the mammalian ubiquitous RNA polymerase II (CBh) or RNA polymerase III (H1) promoter. Fig.10 In (A), Western blots show depletion of SRSF1 and inhibition of RAN translation of antisense DPRs after co-transfection with scAAV SRSF1-shRNA10_GFP, H1-CPP1_GFP, and H1-CPP2_GFP, but not when CPP transcription is driven by the RNAPII promoter. Expression levels of SRSF1 and DPRs were quantified in triplicate biological experiments in panels B and C, respectively (bar graphs show mean ± SEM; one-way ANOVA; NS: not significant; ****: p < 0.0001). Note that there is no expression of CPP1 or CPP2 from the CBh promoter encoding the proteins. (D) MTT cell proliferation assays in three biological replicates show that scAAV SRSF1-shRNA10_GFP, H1-CPP1_GFP, and H1-CPP2_GFP can alleviate cytotoxicity mediated by DPR expression, but not when CPP transcription is driven by the RNAPII promoter. The bar graphs show mean ± SEM; one-way ANOVA; NS: not significant, ****: P < 0.0001.

[0496] Example 5

[0497] Data of SRSF1-shRNA ( Fig.12 ) showed that the svAAV9-SRSF1-shRNA10 virus led to the suppression of DPR in the mouse brain and complemented the data showing that it led to the depletion of SRSF1 in the mouse brain.

[0498] Example 6

[0499] The data showed that scAAV9 viruses expressing CPP1 or CPP2 and co-expressing GFP efficiently transduced neurons and glial cells in the mouse brain ( Fig.13 ), and leads to DPR inhibition ( Fig.14 ).

Claims

1. A viral vector comprising a transcription cassette for expressing a nucleic acid molecule in a mammalian host cell, wherein the nucleic acid molecule is operably linked to a promoter, the promoter being suitable for expressing the nucleic acid molecule in the mammalian host cell, characterized in that The vector comprises a non-expressed nucleotide sequence, and wherein the nucleic acid molecule encodes an antagonist targeting serine / arginine-rich splicing factor (SRSF1). 2 . The viral vector according to claim 1 , wherein the SRSF1 comprises or consists of the sequence listed in SEQ ID NO 67. 3 .

3. The viral vector according to claim 1 or 2, wherein the antagonist is a nucleic acid molecule comprising a nucleic acid sequence encoding a polypeptide or peptide.

4. The viral vector of claim 1 or 2, wherein the antagonist is a nucleic acid-based agent.

5. The viral vector according to any one of claims 1-2 or 4, wherein the nucleic acid-based agent is an antisense nucleic acid, inhibitory RNA, shRNA or miRNA molecule that is complementary to a nucleic acid encoding a serine / arginine-rich splicing factor (SRSF1) and inhibits its expression.

6. The viral vector of claim 5, wherein the inhibitory RNA comprises or consists of a nucleotide sequence listed in SEQ ID NO: 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57 or 58.

7. The viral vector according to claim 5, wherein the shRNA comprises or consists of a nucleotide sequence selected from the group consisting of SEQ ID NOs 2, 3, 4, 5, 6, 7, 8, 9, 10 and 11.

8. The viral vector according to claim 7, wherein the shRNA comprises or consists of the nucleotide sequence listed in SEQ ID NO 7. 9 . The viral vector according to claim 7 , wherein the shRNA comprises or consists of the nucleotide sequence listed in SEQ ID NO 10. 10 . The viral vector according to claim 7 , wherein the shRNA comprises or consists of the nucleotide sequence listed in SEQ ID NO 11.

11. The viral vector of claim 3, wherein the peptide comprises an amino acid sequence of at least 32 amino acids in length and comprises the amino acid sequence set forth in SEQ ID NO:

59.

12. The viral vector according to claim 3, wherein the peptide is a dominant negative protein comprising a modification of the amino acid sequence set forth in SEQ ID NO: 60 or 61.

13. The viral vector according to claim 3, wherein the modified protein comprises or consists of the amino acid sequence listed in SEQ ID NO: 62 or 63.

14. The viral vector of claim 3, wherein the peptide comprises an amino acid sequence that is at least 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40 or 42 amino acids in length and is set forth in SEQ ID NO:

90.

15. The viral vector according to claim 3 or 14, wherein the peptide comprises the amino acid sequence set forth in SEQ ID NO: 75 (GSWQDLKDHMREA).

16. The viral vector according to any one of claims 1-3 and 11-15, wherein the viral vector comprises an RNA Pol III terminator.

17. The viral vector according to any one of claims 1 to 16, wherein the vector comprises an inverted terminal repeat nucleotide sequence, and optionally wherein the ITR sequence is set forth in SEQ ID NO 64 or SEQ ID NO 88.

18. The viral vector according to any one of claims 1-17, wherein the promoter is selected from the group consisting of an H1 polymerase III promoter, a U6 promoter, a U7 promoter, or a mammalian 7SK promoter.

19. The viral vector of claim 18, wherein the vector is an H1 polymerase III promoter and is optionally set forth in SEQ ID NO 65.

20. The viral vector of any one of claims 1-19, wherein the viral-based vector is an adeno-associated virus [AAV], optionally a self-complementary adeno-associated virus (scAAV).

21. The viral vector of claim 20, wherein the viral-based vector is scAAV9 or scAAVrh10.

22. A pharmaceutical composition comprising the viral vector according to any one of claims 1 to 21 and an excipient or carrier.

23. The viral vector according to any one of claims 1 to 21 for use as a medicament.

24. The viral vector according to any one of claims 1-21, for use in treating a neurodegenerative disease.

25. The viral vector of claim 24, wherein the neurodegenerative disease is amyotrophic lateral sclerosis (ALS).

26. The viral vector of claim 24, wherein the neurodegenerative disease is sporadic and / or familial amyotrophic lateral sclerosis.

27. The viral vector of claim 24, wherein the neurodegenerative disease is ALS that is not caused by pathological C9ORF72-repeat sequence expansion.

28. The viral vector of claim 24, wherein the neurodegenerative disease is sporadic frontotemporal dementia (FTD).

29. The viral vector of claim 24, wherein the neurodegenerative disease is fragile X-associated tremor / ataxia syndrome (FXTAS).

30. A cell transfected with a viral vector according to the present invention.

31. The cell of claim 30, wherein the cell is a neuron and / or an astrocyte, and optionally wherein the neuron is a motor neuron and / or an astrocyte.

32. An isolated nucleic acid molecule encoding a shRNA molecule comprising or consisting of a nucleotide sequence selected from the group consisting of SEQ ID NOs 2, 3, 4, 5, 6, 7, 8, 9, 10 and 11.

33. An isolated nucleic acid molecule according to claim 32, wherein the nucleic acid molecule comprises or consists of the nucleotide sequence set forth in SEQ ID NO 7.

34. The isolated nucleic acid molecule of claim 32, wherein the nucleic acid molecule comprises or consists of the nucleotide sequence set forth in SEQ ID NO 10.

35. The isolated nucleic acid molecule of claim 32, wherein the nucleic acid molecule comprises or consists of the nucleotide sequence set forth in SEQ ID NO 11.

36. A cell penetrating polypeptide comprising or consisting of the amino acid sequence set forth in SEQ ID NO 90.

37. The cell penetrating peptide of claim 36, wherein the polypeptide is between 13-42 amino acids in length.

38. The cell penetrating peptide according to claim 37, wherein the polypeptide comprises or consists of the amino acid sequence set forth in SEQ ID NO 75.

39. An antagonist comprising a nucleic acid molecule, wherein the nucleic acid molecule comprises a nucleotide sequence designed based on human serine / arginine-rich splicing factor (SRSF1), and wherein the nucleic acid molecule inhibits the expression of SRSF1.

40. The antagonist of claim 39, wherein the nucleic acid molecule is a double-stranded nucleic acid molecule comprising a sense strand and an antisense strand comprising a nucleotide sequence, wherein the antisense nucleotide strand is suitable for annealing to a nucleic acid molecule encoding human SRSF1 through complementary base pairing.

41. The antagonist of claim 40, wherein the double-stranded nucleic acid molecule is RNA.

42. The antagonist of claim 41, wherein the RNA is siRNA or miRNA.

43. The antagonist of claim 39, wherein the nucleic acid molecule is a single-stranded nucleotide sequence comprising an antisense nucleotide sequence, wherein the antisense nucleotide sequence is suitable for annealing to a nucleic acid molecule encoding SRSF1 through complementary base pairing.

44. The antagonist of claim 43, wherein the single-stranded nucleic acid is DNA and / or RNA, and optionally the DNA and / or RNA is a therapeutic antisense oligonucleotide, such as an antisense oligonucleotide, a splice-switching oligonucleotide, a gapmer or the like.

45. The antagonist of claim 44, wherein the DNA is an antisense oligonucleotide.

46. ​​The antagonist of any one of claims 39 to 45, wherein the nucleic acid molecule encoding human SRSF1 is set forth in SEQ ID NO:

67.

47. The antagonist of claim 46, wherein the antagonist comprises a nucleic acid molecule of at least 15 nucleotides in length.

48. The antagonist of claim 47, wherein the antagonist comprises a nucleic acid molecule comprising the nucleotide sequence set forth in SEQ ID NO:67, wherein the nucleic acid molecule is a double-stranded inhibitory RNA having a length of 19-23 nucleotides.

49. The antagonist of any one of claims 39 to 48, wherein the antagonist comprises a nucleic acid molecule comprising modified nucleotides and / or modified sugars.

50. The antagonist of claim 49, wherein the double-stranded nucleic acid molecules comprise sense and antisense nucleic acid molecules comprising modified nucleotides.

51. The antagonist of claim 50, wherein the modified nucleotide is selected from the group consisting of 3'-terminal deoxy-thymine (dT) nucleotides, 2'-O-methyl modified nucleotides, 2'-fluoro modified nucleotides, 2'-deoxy modified nucleotides, locked nucleotides, unlocked nucleotides, conformationally restricted nucleotides, constrained ethyl nucleotides, basic nucleotides, 2'-amino modified nucleotides, 2'-O-allyl modified nucleotides, 2'-C-alkyl modified nucleotides, 2'-hydroxy modified nucleotides, 2'-methoxyethyl modified nucleotides. Nucleotides, 2'-0-alkyl modified nucleotides, morpholino nucleotides, phosphoramidates, nucleotides containing non-natural bases, tetrahydropyran modified nucleotides, 1,5-anhydrohexitol modified nucleotides, cyclohexenyl modified nucleotides, nucleotides containing phosphorothioate groups, nucleotides containing phosphorodithioate (PS2), nucleotides containing methylphosphonate groups, nucleotides containing 5'-phosphate, and nucleotides containing 5'-phosphate mimetics such as 5'-vinyl phosphate, nucleotides containing 2'-deoxy-2'-fluoro and 2' methyl sugar groups.

52. The antagonist of any one of claims 49 to 51, wherein the double-stranded nucleic acid molecule comprising sense and antisense nucleic acid molecules comprises a modified sugar.

53. The antagonist of claim 52, wherein the modified sugar is selected from the group consisting of modified versions of the ribosyl moiety, such as -O-modified RNAs, such as 2'-O-alkyl or 2'-O-(substituted)alkyl, such as 2'-O-methyl, T-O-(2-cyanoethyl), 2'-O-(2-methoxy)ethyl (2'-MOE), 2'-O-(2-thiomethyl)ethyl, 2'-O-butyryl, -O-propargyl, 2'-O-allyl, 2'-O-(2-amino)propyl, 2'-O-(2-(dimethylamino)propyl), 2'-O-(2-amino)ethyl, 2'-O-(2-(dimethylamino)ethyl); 2'-deoxy (DN A); 2'-O-(haloalkoxy)methyl, such as 2'-0-(2-chloroethoxy)methyl (MCEM), -O-(2,2-dichloroethoxy)methyl (DCEM); 2'-<3-alkoxycarbonyl, such as T-0-[2-(methoxycarbonyl)ethyl] (MOCE), 2'-O-[2-(N-methylcarbamoyl)ethyl] (MCE), T-0-[2-(N,N-dimethylcarbamoyl)ethyl] (DCME); 2'-halo, such as 2'-F, FANA (2'-F arabinosyl nucleic acid); carbon sugar and azasugar modifications; 3'-O-alkyl, such as 3'-0-methyl, 3'-0-butyryl, VO-propargyl and their derivatives.

54. The antagonist of any one of claims 49 to 53, wherein the antagonist comprises a nucleotide sequence designed according to a target nucleic acid sequence selected from the group consisting of: TGGCACTGGTGTCGTGGAGTTTGTA(SEQ ID NO 110); TGGTGTCGTGGAGTTTGTACGGAAA (SEQ ID NO 111); TCGTGGAGTTTGTACGGAAAGAAGA (SEQ ID NO 112); AAGATATGACCTATGCAGTTCGAAA(SEQ ID NO 113); GAGAAACTGCCTACATCCGGGTTAA(SEQ ID NO 114); CGGGTTAAAGTTGATGGGCCCAGAA (SEQ ID NO 115); TGATGGGCCCAGAAGTCCAAGTTAT(SEQ ID NO 116); CAGAAGTCCAAGTTATGGAAGATCT (SEQ ID NO 117); GAGAAGCAGAGGATCACCACGCTAT (SEQ ID NO 118); and CGTCATAGCAGATCTCGCTCTCGTA (SEQ ID NO 119).

55. A pharmaceutical composition comprising an antagonist according to any one of claims 39 to 54 and including an excipient or carrier.

56. An antagonist according to any one of claims 39 to 54 for use as a medicament.

57. An antagonist according to any one of claims 39 to 54 for use in the treatment of a neurodegenerative disease.

58. The antagonist of claim 57, wherein the neurodegenerative disease is amyotrophic lateral sclerosis (ALS).

59. The antagonist of claim 58, wherein the neurodegenerative disease is sporadic and / or familial amyotrophic lateral sclerosis.

60. The antagonist of claim 58 or 59, wherein the neurodegenerative disease is ALS that is not caused by pathological C9ORF72-repeat sequence expansion.

61. The antagonist of claim 57, wherein the neurodegenerative disease is sporadic frontotemporal dementia (FTD).

62. The antagonist of claim 57, wherein the neurodegenerative disease is fragile X-associated tremor / ataxia syndrome (FXTAS).

63. A shRNA molecule comprising a nucleotide sequence or a variant thereof selected from the group consisting of: SRSF1-shRNA1 (SEQ ID NO 91): GCUGAUGUUUACCGAGAUGGC UUCAAGAGA GCCAUCUCGGUAAACAUCAGC; SRSF1-shRNA2 (SEQ IDNO 92): GGAGUUUGUACGGAAAGAAGA UUCAAGAGA UCUUCUUUCCGUACAAACUCC; SRSF1-shRNA3 (SEQ IDNO 93): GGAAAGAAGAUAUGACCUAUG UUCAAGAGA CAUAGGUCAUAUCUUCUUUCC; SRSF1-shRNA4 (SEQ IDNO 94): GAAAGAAGAUAUGACCUAUGC UUCAAGAGA GCAUAGGUCAUAUCUUCUUUC; SRSF1-shRNA5 (SEQ IDNO 95): GCCUACAUCCGGGUUAAAGUU UUCAAGAGAAACUUUAACCCGGAUGUAGGC; SRSF1-shRNA6 (SEQ IDNO 96): GGGCCCAGAAGUCCAAGUUAU UUCAAGAGAAUAACUUGGACUUCUGGGCCC; SRSF1-shRNA7 (SEQ IDNO 97): GGCCCAGAAGUCCAAGUUAUG UUCAAGAGA CAUAACUUGGACUUCUGGGCC; SRSF1-shRNA8 (SEQ IDNO 98): GCCCAGAAGUCCAAGUUAUGG UUCAAGAGACCAUAACUUGGACUUCUGGGC; SRSF1-shRNA9 (SEQ IDNO 99): GGAAGAUCUCGAUCUCGAAGC UUCAAGAGAGCUUCGAGAUCGAGAUCUUCC; and SRSF1-shRNA10 (SEQID NO 100): GCAGAGGAUCACCACGCUAUU UUCAAGAGAAAAGCGUGGUGAUCCUCUGC.

64. The shRNA molecule of claim 63, wherein the shRNA molecule comprises or consists of the nucleotide sequence set forth in SEQ ID NO 96 or a variant thereof.

65. The shRNA molecule of claim 63, wherein the shRNA molecule comprises or consists of the nucleotide sequence set forth in SEQ ID NO 99 or a variant thereof.

66. The shRNA molecule of claim 63, wherein the shRNA molecule comprises or consists of the nucleotide sequence set forth in SEQ ID NO 100 or a variant thereof.

Images