A fungus antagonistic to sexual mating of sugarcane smut pathogen and its application

Abstract

The present invention provides a fungus that antagonizes the sexual mating of sugarcane smut fungi and its application, belonging to the field of biological control technology. The dark green basket fungus T-15 provided by the present invention is a fungus isolated from soil, which can be well colonized in the soil. The present invention first discovered that the fungus can effectively antagonize the sexual mating of sugarcane smut fungi, causing it to lose its pathogenicity, and can be used to prevent and control sugarcane smut, with potential application value; the dark green basket fungus T-15 has an inhibitory effect on the infection of sugarcane smut fungi; the dark green basket fungus T-15 also has a certain growth-promoting potential and has the ability to produce iron carriers; the present invention provides a new fungus resource for the biological control of sugarcane smut.

Description

Technical Field

[0001] The invention relates to the technical field of biological control, in particular to a fungus capable of antagonizing sexual mating of sugarcane smut pathogen and application thereof. Background Art

[0002] Sugarcane is the most important sugar crop in my country, and is also an important raw material and strategic resource for light industry, chemical industry and energy. Sugarcane pests and diseases are important restrictive factors in sugarcane production, which can cause serious losses in sugarcane yield and quality. Among them, sugarcane smut is the most common, serious and difficult to control fungal disease in sugarcane growing areas. It is commonly known as the "cancer" of sugarcane, causing serious reductions in sugarcane sugar production and production. The economic losses caused each year can reach billions, which seriously threatens the continued high-quality development of the sugarcane industry.

[0003] Sugarcane smut is caused by Ustilago saccharum ( Sporisorium scitamineum ) is a systemic fungal disease caused by . Sugarcane whip smut fungus is heterothallic, and its life cycle goes through two stages: haploid sporophyte and binucleate mycelium. The haploid stage can only grow by budding and does not have infectivity and pathogenicity. Haploid spores of different mating types form binucleate mycelium with infectivity and pathogenicity after sexual mating, causing disease. Talaromyces fuscoviridis ) Report on sexual cooperation against sugarcane smut pathogen. Summary of the invention

[0004] The purpose of the present invention is to provide a fungus antagonistic to sexual mating of sugarcane smut pathogen and its application, so as to provide an effective means for biological control of sugarcane smut pathogen.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides a dark green basket fungus, wherein the dark green basket fungus is Talaromyces fuscoviridis T-15, the deposit number is CGMCC No.41660.

[0007] Preferably, the ITS sequence of the dark green Bacillaceae is shown in SEQ ID NO: 1;

[0008] The BenA sequence of the dark green Bacillaceae T-15 is shown in SEQ ID NO: 2;

[0009] The PRB2 sequence of the dark green Bacillaceae T-15 is shown in SEQ ID NO:3.

[0010] The present invention provides a method for culturing the above-mentioned dark green Basella ovale, comprising the following steps: inoculating the dark green Basella ovale BVDT-1 into a culture medium, culturing, and obtaining a dark green Basella ovale culture solution.

[0011] Preferably, the culturing time is more than 12 hours.

[0012] The present invention also provides a dark green Bacillaceae culture solution obtained by the above-mentioned culture method.

[0013] The present invention also provides the use of the above-mentioned dark green Basilicum, the cultivation method or the dark green Basilicum culture solution in the preparation of crop pathogenic fungi inhibitors.

[0014] Preferably, the crop pathogenic fungus is Ustilago canefolia.

[0015] The present invention also provides the use of the dark green Basalopsis or dark green Basalopsis culture solution in producing iron carriers.

[0016] The present invention also provides the use of the above-mentioned dark green Basilisk fungus, the cultivation method or the dark green Basilisk fungus culture solution in the preparation of plant disease biocontrol agents or plant growth promoters.

[0017] The present invention also provides a biocontrol agent for sugarcane smut, wherein the inhibitor contains the dark green basket fungus provided by the present invention.

[0018] Beneficial effects of the present invention:

[0019] The dark green basket fungus T-15 disclosed in the present invention is a fungus isolated from soil and can be well colonized in the soil. The present invention first discovered that the fungus can effectively antagonize sugarcane smut fungus for sexual mating, causing it to lose its pathogenicity, and can be used to prevent and control sugarcane smut, and has potential application value.

[0020] Pot experiments show that the dark green basket fungus T-15 has an inhibitory effect on the infection of sugarcane smut fungus; the dark green basket fungus T-15 also has a certain growth-promoting potential and the ability to produce siderophores; the present invention provides a new fungus resource for the biological control of sugarcane smut. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is a diagram showing the effect of dark green basket fungus T-15 in inhibiting the sexual maturation of sugarcane smut pathogen.

[0022] Figure 2 This is a colony image of dark green basket fungus T-15.

[0023] Figure 3 This is the morphology and microstructure of dark green basket fungus T-15.

[0024] Figure 4 This is the phylogenetic tree of the dark green basket fungus T-15.

[0025] Figure 5 This is a diagram showing the effect of dark green Bacillaceae T-15 producing iron carriers.

[0026] Figure 6 To investigate the biocontrol effect of inoculating dark green Bacillaceae T-15 against sugarcane smut.

[0027] Biological Deposit

[0028] The dark green cycad provided by the present invention is named as dark green cycad T-15 ( Talaromyces fuscoviridis T-15 ） , deposited on December 9, 2024 in the General Microbiology Center of China Microorganism Culture Collection, referred to as CGMCC, address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing. Institute of Microbiology, Chinese Academy of Sciences, Postal Code: 100101, the deposit number is CGMCC No.41660. DETAILED DESCRIPTION

[0029] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0030] The ITS sequence of the dark green Bacillaceae T-15 of the present invention is:

[0031] ACCTCGCGGCCCAACCTCCCACCCTTGTCTCTCTACCCCTGTTGCTTTGGCGGGCCCACCGGGGCCACCTGGTCGCCGGGGGACGCACGTCCCCGGGCCCGCGCCCGCCGAAGCGCTCTGTGAACCCTGAT GAAGATGGGCTGTCTGAGTACGATGAAAATTGTCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGA ATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTTCTGCCCTCAAGCACGGCTTGTGTGTTGGGTGTGGTCCCCCGGGGACCTGCCCGAAAGGCAGCGGCGAC GTCCGTCTGGTCCTCGAGCGTATGGGGCTCTGTCACTCGCTCGGGAAGGACCTGCGGGGGTTGGTCACCACCACATTTTACCACGGTTGACCTCGGATCAGGTAGGAGTTACCCGCTGAACTTAA, such as SEQID Shown in NO.1;

[0032] The BenA sequence of the dark green Bacillaceae T-15 of the present invention is:

[0033] CAATTGTCGCGACAACACACTGACTTTTCCAGGCAAATCATCTCTGCTGAGCACGGTCTCGATGGCTCCGGTGTGTAAGTATTACACGATTCGATTCCAGCTACAGACCAGCAATATCTGATCGTCAACAGCTACAATGGCTCCTCCGACCTCCAGTTGGAGCGTATGAATGTTTACTTCAACGAGGTGCGTCAGACGAT TCCACCATATAAACAAACGAAACTCATATGGTATAGGCCTCCGGCAACAAATACGTTCCCCGTGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTCCGCGCTGGTCCTTTTGGTCAGCTCTTCCGTCCCGACAACTTTGTTTTCGGTCAGTCCGGTGCTGGTAACAACTGGGCCAAGGGTCACTA, such as SEQ Shown as ID NO.2;

[0034] The PRB2 sequence of the dark green Bacillaceae T-15 of the present invention is:

[0035] Example

[0036] Screening of Dark Green Bacillaceae T-15

[0037] 1. Isolation of potential biocontrol bacteria

[0038] Soil samples were evenly collected from the sugarcane fields in Gengma, Yunnan. 10 g of the collected soil samples were weighed, 90 mL of sterile water was added, and the samples were shaken and cultured at 150 rpm for 30 min at room temperature. After that, the supernatant was aspirated and the biocontrol bacteria were isolated on PDA medium using a 10-fold gradient dilution method. 100 μL of soil dilution was evenly spread on each plate and cultured in the dark at 28 ℃ for 1-2 days. After the colonies grew, fungi with different colony morphologies were selected for purification, propagation, and storage for later use.

[0039] 2. Screening of antagonistic bacteria by plate confrontation method

[0040] 2.1. Preparation of haploid MAT-1 and MAT-2 of sugarcane smut pathogen: Take out the frozen MAT-1 and MAT-2 strains and spread them on Ye PS medium plates containing gentamicin and ampicillin, and culture them at 28°C for 2-3 days. After the colonies grow, they are cultured in liquid YePS medium at 200 rpm with shaking until OD600≈1.5, which is used for confrontation inhibition test with isolated strains.

[0041] 2.2. Screening of antagonistic bacteria: PDA plate confrontation method was used. A 5 mm puncher was used to punch a bacterial cake at the edge of the antagonistic fungal colony and placed in the center of the PDA plate. A mixed bacterial solution of MAT-1 and MAT-2 (1:1 mix, 5 μL) was dropped 1 cm away from the antagonistic fungal cake. After the bacterial solution was blown dry, the plate was inverted and cultured in a 28 ℃ constant temperature incubator in the dark for 1-2 days. After the blank control mixed bacterial solution grew white fluffy hyphae, the hyphae growth of the mixed bacterial solution on the PDA plate containing the isolated bacteria was observed.

[0042] 2.3. Antagonistic bacteria screening criteria: Sexual mating of the mixed bacterial solution of sugarcane smut yeast-like haploid strains MAT-1 and MAT-2 on PDA plates, 1-2 days later, white velvety hyphae can be seen, which is the diploid of sugarcane whip smut fungus. If the mixed bacterial solution still maintains a yeast-like state under the presence of isolated bacteria on the plate, the isolated bacteria is a potential biocontrol bacterium.

[0043] Through confrontation culture experiments, it was found that strain T-15 can effectively inhibit the sexual maturation of sugarcane smut pathogens, making the mixed bacterial liquid of MAT-1 and MAT-2 still maintain a yeast state ( Figure 1 ).

[0044] 3. Morphological characteristics of the screened strain T-15: On Chadwick yeast agar (CYA) at 28°C for 7 days, T-15 has round colonies with a fluffy and short rope-like texture; the mycelium is white with light yellow; the back of the colony is light yellow. On malt extract agar (MEA) at 28°C for 7 days, T-15 has a short flocculent and rope-like texture; the mycelium is gray-green, yellow-green to white; the back of the colony is dark green. On PDA medium at 28°C for 7 days, T-15 has irregular grooves, yellow-green on the front, gray-green in the middle, and a fluffy and short rope-like texture; the back is yellow-green to dark brown, producing red pigment; the mycelium is white ( Figure 2 ). Conidiophores have smooth walls; broom branches are in double and single whorls; peduncle base has 2-4 in each whorl, arranged closely; phialopse is ampoule-shaped, not arranged closely, 2-4 in each whorl, conidia are ellipsoidal to nearly spherical, with thick walls and smooth ( Figure 3 ).

[0045] 4. Molecular biological identification of the screened strain T-15: The genomic DNA rapid extraction kit of Tiangen Biochemical Technology Co., Ltd. was used to extract the genomic DNA of T-15 mycelium. The extracted DNA was used as a template to amplify its ITS, BenA and RPB2 sequences using the three pairs of primers in Table 1. The PCR reaction system and amplification program were as follows: 25 μL of PCR reaction system, including 12.5 μL of 2×EasyTag PCR SuperMix (TransGen), 1 μL of forward primer and reverse primer, 1 μL of DNA template, and double distilled water to 25 μL. The PCR amplification program was 94 ℃ for 3 min; 94 ℃ for 30 s, 58 ℃ (ITS / BenA) or 50 ℃ (RPB2) for 40 s, 72 ℃ for 1 min, for a total of 35 cycles; 72 ℃ for 10 min; and stored at 4 ℃. The amplified products were detected by 1.2% agarose gel electrophoresis and sent to BGI for sequencing to obtain the sequences of each gene. The original sequences were manually proofread and edited using the biological software Bioedit7.0.9. The single gene sequences were spliced ​​into a multi-gene sequence combination of BenA-RPB2-ITS using the model strain of the reported species of the genus Talaromyces as a reference, and the NJ phylogenetic tree was constructed using MEGA 7.0. Figure 4 It is known that strain T-15 and dark green turbinates Talaromyces fuscoviridis The model strains were clustered into one branch, with a support rate of 97%.

[0046] The strain T-15 was identified as dark green cynaroid fungus by morphological and molecular biological methods. Talaromyces fuscoviridis , named Talaromyces fuscoviridis T-15.

[0047] Table 1 Primers for molecular identification of T. viridis

[0048]

[0049] Detection of the siderophore secretion ability of T-15

[0050] Siderophore refers to a kind of Fe-binding protein secreted by bacteria into the surrounding environment under iron-deficient conditions. 3+ A substance with a very strong specific chelating effect. The CAS plate method uses chrome azure S (CAS), trivalent iron ions and hexadecyltrimethylammonium bromide (HTDMA) to form a blue-blue complex. The culture plate is dyed with CAS dye. When the strain releases trivalent iron ions into the culture plate, the ternary complex is destroyed and turns yellow, that is, a yellow halo appears around the colony. Record the presence or absence of an orange halo on the culture medium. Figure 5 It can be seen that the dark green Bacillaceae T-15 showed a yellow halo on the CAS plate, indicating that it has great potential in promoting growth.

[0051] The efficacy of dark green cycad T-15 in controlling sugarcane smut in barrel cultivation

[0052] 1. Sugarcane planting: Sugarcane with good growth, many sugarcane nodes and abundant seed buds were selected as the research object. The sugarcane variety was Yunzhe 08-1609. The middle part of the sugarcane was cut into single bud segments and soaked in a water bath at 50 ℃ for 2 hours. The seed buds were planted in pots with a diameter of 30 cm and a height of 20 cm containing a 1:1:1 (ordinary soil: nutrient pond mud: matrix soil) mixed soil. Three sugarcane buds were planted in each pot and placed in a greenhouse for cultivation. Watering was done regularly to prevent sudden drought from affecting the growth of sugarcane.

[0053] 2. Sugarcane inoculation: Activate T-15 strain, sugarcane whip smut fungus monosexual strain, sugarcane whip smut fungus monosexual strain MAT-1 and MAT-2 respectively, and culture overnight until OD600=2.5 ​​for use. After one month of cultivation, the height of sugarcane seedlings is about 30-40 cm. Select sugarcane seedlings with good growth and uniform size for inoculation. The treatment methods of the experimental groups are shown in Table 2. Thirty sugarcane seedlings were selected for inoculation in each group of experiments. The inoculation volume was 1 mL of the treatment solution. The inoculation solution was injected into the sugarcane stem from the sugarcane stem 3-5 cm above the ground using a syringe. After inoculation, the sugarcane was cultured for 3-5 months until most of the sugarcane in the control group became ill. The disease situation of sugarcane with different treatments was investigated. At the harvest time, the sugarcane stems were cut and the yield was measured.

[0054] 3. Prevention effect investigation: The disease situation of sugarcane was investigated 4 months after inoculation, and the number of sugarcane infected with sugarcane smut under different treatments was recorded, and the incidence rate was calculated. The incidence rate (%) = number of infected sugarcane plants / total number of sugarcane × 100. The prevention and control effect of the experimental group on sugarcane smut was calculated according to the formula, prevention and control effect (%) = (incidence rate of the control group - incidence rate of the treatment group) × 100 / incidence rate of the control group.

[0055] Table 2 Treatments of barrel planting experiment

[0056]

[0057] From Table 2 and Figure 6 It can be seen that dark green basket fungus T-15 can significantly inhibit the infection of sugarcane smut fungus on sugarcane, reduce the incidence of sugarcane smut fungus, and reduce the inhibitory effect of sugarcane smut fungus on sugarcane growth.

[0058] It can be seen from the above examples that the dark green basket fungus (Talaromyces fuscoviridis) T-15 provided by the present invention can antagonize sugarcane smut fungus for sexual mating, and has a significant inhibitory effect on the infection of sugarcane smut fungus; the strain also has a growth-promoting effect and the ability to produce siderophores, and can be used as a highly efficient disease-resistant and growth-promoting strain resource.

[0059] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A dark green basket fungus, characterized in that The dark green cycad is Talaromyces fuscoviridis T-15, the deposit number is CGMCC No.41660.

2. The dark green basket fungus according to claim 1, characterized in that The ITS sequence of the dark green Bacillaceae is shown in SEQ ID NO: 1; The BenA sequence of the dark green Bacillaceae T-15 is shown in SEQ ID NO: 2; The PRB2 sequence of the dark green Bacillaceae T-15 is shown in SEQ ID NO:

3.

3. A method for culturing the dark green Bacillaceae according to claim 1, characterized in that: The method comprises the following steps: inoculating dark green Basileus vulgaris BVDT-1 into a culture medium, culturing the culture medium, and obtaining dark green Basileus vulgaris culture solution.

4. The method for culturing dark green Bacillaceae according to claim 3, characterized in that: The culturing time is more than 12 hours.

5. The dark green Bacillaceae culture solution obtained by the culture method described in claim 3 or 4.

6. Use of the dark green Basilicum according to claim 1, the cultivation method according to claim 3 or 4, or the dark green Basilicum culture solution according to claim 5 in the preparation of crop pathogenic fungi inhibitors; the crop pathogenic fungi is Ustilago officinalis.

7. Use of the dark green Baxella according to claim 1 or the dark green Baxella culture solution according to claim 5 in the production of siderophores.

8. Use of the dark green Basilicum according to claim 1, the cultivation method according to claim 3 or 4, or the dark green Basilicum culture solution according to claim 5 in the preparation of a biocontrol agent for sugarcane diseases or a sugarcane growth promoter; the crop pathogenic fungus is Ustilago officinalis.

9. A biocontrol agent for sugarcane smut, characterized in that: The biocontrol agent contains the dark green basket fungus described in claim 1.

Images